Skip to main content
NCBI home page
Aquaculture Nutrition logoLink to Aquaculture Nutrition
. 2025 Aug 31;2025:6665220. doi: 10.1155/anu/6665220

Sulforaphane Repairs Oxidative Stress Damage Induced by Oxidized Fish Oil by Activating Nrf2 in Litopenaeus vannamei

Shiping Yang 1, Leyuan Feng 1, Junliang Luo 1, Jichang Jian 1, Shuanghu Cai 1, Huiling Liu 1,✉
PMCID: PMC12414620  PMID: 40923044

Abstract

Nuclear factor erythroid 2-related factor 2 (Nrf2) is an essential component in regulating oxidative stress. Sulforaphane (SFN) is a natural antioxidant and gene Nrf2 agonist that can increase the antioxidant capacity of the organism and reduce oxidative stress. However, research on the repair of oxidative stress damage by SFN in aquatic animals remains extremely scarce. In order to further explore the function and role of SFN in the repair of oxidative stress injury in aquatic animals, this study took Litopenaeus vannamei as the research object. We established an oxidative stress model of L. vannamei through 6% oxidized fish oil (OFO) feeding. Methods, such as RNA interference (RNAi), qPCR, histopathological analysis, and TUNEL assay, were used to detect the changes in the oxidative stress status of L. vannamei. The results showed that the expression of Nrf2 in the hepatopancreas of L. vannamei in the double-stranded RNA (dsRNA)-Nrf2 + SFN group was significantly higher than that in the dsRNA-Nrf2 group and control group at 24 h (p < 0.05). The transcription levels of antioxidant and autophagy genes in the SFN group were significantly higher than those in the control group (p < 0.05), and the expression of related genes in the dsRNA-Nrf2 + SFN group was also higher than that in the dsRNA-Nrf2 group. Histopathology showed that Nrf2 knockdown would aggravate hepatopancreatic apoptosis and vacuolation, while SFN treatment after Nrf2 knockdown could alleviate hepatopancreatic injury and apoptosis caused by OFO. The results indicated that SFN could repair the oxidative stress injury of L. vannamei induced by OFO by activating Nrf2. This study investigated the role of SFN in alleviating and repairing the oxidative stress damage in L. vannamei caused by OFO, aiming to provide a theoretical basis for the research on the antioxidant effect of SFN and the regulation of the antioxidant capacity of shrimp.

Keywords: antioxidant, Litopenaeus vannamei, Nrf2, oxidized fish oil, sulforaphane

1. Introduction

Litopenaeus vannamei ranks as the world's most widely farmed crustacean species and the globally preeminent penaeid in commercial value, accounting for over 80% of total global farmed shrimp production [1]. L. vannamei features rapid growth, relatively strong disease resistance, high aquaculture yield, and high economic value, making it one of the excellent prawn-farming varieties. However, in the process of farming, L. vannamei is extremely susceptible to environmental factors, such as ammonia nitrogen, nitrite, and high temperature, which leads to oxidative damage and the decline of body immunity, resulting in the outbreak of various diseases and great economic losses to the shrimp farming industry. Fish oil is a nutrient that can provide a large amount of high-quality fat and protein. It is rich in unsaturated fatty acids, which play a vital role in the growth and metabolism of aquatic animals [2]. However, these unsaturated fatty acids contain unsaturated bond structures and are extremely prone to oxidation. Fish oil is prone to being oxidized into oxidized fish oil (OFO), and it is also capable of inducing oxidative stress. Fish fed OFO showed an increasing number of free radicals, such as reactive oxygen species (ROS) [3], which can result in oxidative stress damage. Antioxidants can be appropriately added to the feed for prevention. This situation can be prevented by appropriately adding antioxidants to the feed.

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a member of the CNC transcription factor family and contains seven homologous domains [4]. Nrf2 performs important functions in various aspects of the body, including regulating redox balance, energy metabolism, amino acid metabolism, autophagy, apoptosis, mitochondrial function, and so on [5, 6]. Nrf2 regulates the transcription level of over 100 genes involved in the control of apoptosis, autophagy, inflammation, antioxidant capability, and other activities, such as NQO1, GSH, HO-1, CAT, and SOD [6, 7]. Especially, Nrf2 has a crucial function in cellular antioxidant protection. When the body experiences oxidative stress, the activated Nrf2 pathway can help the body remove excess ROS and reduce oxidative damage [8]. Kelch-like ECH-associated protein 1 (Keap1) is a key protein that regulates Nrf2 activity. In cells, Keap1 can form the E3 ubiquitin ligase complex with Cullin3 (Cullin-RING E3 ubiquitin ligase) and Rbx1 (ring-box 1, E3 ubiquitin protein ligase) to regulate Nrf2 [9]. When the body is in a normal physiological state, the ubiquitin ligase formed by Keap1 promotes ubiquitination of Nrf2 and then degradation [9, 10]. Under oxidative stress, the ubiquitination of Nrf2 mediated by Keap1 was prevented, the Nrf2 was translocated into the nucleus. Then Nrf2 will bind to antioxidant response element (ARE) for the induction the gene expression of cytoprotective genes involved in antioxidant and detoxification.

Using the natural compounds as a therapeutic agent to improve oxidative stress damage is a highly promising strategy [11]. Sulforaphane (SFN) plays an important role in keeping cell homeostasis by regulating intracellular redox balance [12, 13]. Studies have shown that SFN, as a natural antioxidant, can significantly reduce oxidative damage in L. vannamei and enhance the immune response [14]. The oxidative stress model of L. vannamei induced by OFO was established to study the repair effect of SFN on oxidative damage. It is revealed for the first time that SFN can repair the oxidative stress injury induced by OFO by activating Nrf2 of L. vannamei, which enriches the theoretical system of crustaceans' oxidative stress defense and provides a new idea for developing green feed additives and improving the stress resistance of shrimp.

2. Materials and Methods

2.1. Experimental Material

Shrimps were purchased from local farms (Zhanjiang, Guangdong, China). The commercial feed and fresh fish oil were provided by Guangdong Yuehai Feeds Group Co., Ltd.; SFN was purchased from Aladdin Company (Shanghai, China); and adhesives were purchased from Taizhou Hongfeng Biotechnology Co., Ltd. (Hong Jie, Taizhou, Jiangsu). Preparation of OFO based on previous research [15].

2.2. Preparation of Double-Stranded RNA (dsRNA)

As reported in the previous study [16], dsRNA of EGFP and Nrf2 was synthesized using the T7 RNAi kit (Takara, China).

2.3. Experiment on Feed Preparation and Shrimp Culture

Based on the commercial feed with a crude protein content of 43%, a crude fat content of 5% and a crude ash content of 16%, two kinds of experimental feed for prawns were prepared: (1) OFO feed, adding 6% OFO to commercial feed, to establish the oxidative stress model of L. vannamei; (2) SFN feed: both OFO and 50 mg·kg−1 SFN were added, which was used for subsequent experiments [15]. When preparing SFN feed, firstly, 50 mg·kg−1 SFN and 6% OFO were added to the binder prepared in advance and mixed thoroughly [17, 18]. Next, the mix was added to the feed and mixed thoroughly again. In order to prevent the feed from deteriorating, it is stored in an environment of −20°C.

Healthy L. vannamei (0.75 ± 0.05 g) were selected and acclimated in the breeding bucket for 1 week to adapt to the new environment. Then divide the shrimps into 4 groups, with 3 replicates in each group and 40 shrimps in each bucket. Feed OFO regularly at 8:00, 12:00, 16:00, and 20:00 every day, and the feeding amount is calculated as 10% of the total weight of shrimp, and it is continuously fed for 35 days to induce oxidative stress. After stress induction, different groups of prawns were treated differently. Shrimps (2.07 ± 0.05 g) in the dsRNA-Nrf2 group were injected with dsRNA-Nrf2 (0.50 μg/g shrimp; the same below), and were fed with commercial feed. Shrimps in the dsRNA-Nrf2 + SFN group were injected with dsRNA-Nrf2 and supplied with SFN feed. Shrimps in the control group received dsRNA-EGFP injections and were fed the commercial feed. Shrimps in the SFN group received dsRNA-EGFP injections and were fed the SFN feed. During the experiment, the water was cleaned regularly to keep it clean. Culture water exchange, water temperature, salinity, and pH values were consistent with previous studies [14].

2.4. Sample Collection

The euthanasia of prawns adopts the ice-water bath method: the individual is placed in artificial seawater with aeration at 4°C (salinity 30%) until the nerve reflex is completely lost (tail limb twitching disappears), and then it is dissected and sampled quickly (refer to ISO 20178:2018, the Ethical Guide to Aquatic Animal Experiments).

At 24, 48, 72, and 96 h following the injection, the hepatopancreas of nine shrimps in each group was sampled to extract total RNA. At the same time, the hepatopancreas of shrimps were randomly sampled from each group at 96 h and fixed with Carnoy's fluid for the histopathological experiment and TUNEL detection of apoptosis.

2.5. Gene Expression Analysis

Total RNA was extracted from the sample tissue by RNAiso Plus reagent (TaKaRa, China), and cDNA was synthesized by PrimeScript RT kit (TaKaRa, China) containing gDNA scavenger. EF-1α was used as an internal reference to detect the expression of antioxidant, apoptosis, and autophagy-related genes in L. vannamei. The primer sequences are shown in Table 1, and the relative expression level of genes was analyzed by the 2−ΔΔCt method. Using the system is the same as the previous article [19].

Table 1.

Genes and primer sequences used in gene expression analysis.

Primer name Sequence (5′–3′) GenBank accession number
dsNrf2-T7F TAATACGACTCACTATAGGGAGCAACCACACATACCACAT XM_027367068.1
dsNrf2-T7R TAATACGACTCACTATAGGGAGGACCAACAAGATACTCCC
dsEGFP-T7F TAATACGACTCACTATAGGGAGGTGCCCATCCTGGTCGAGCT LC739776.1
dsEGFP-T7R TAATACGACTCACTATAGGGAGTGCACGCTGCCGTCCTCGAT
qCAT-F TCAGCGTTTGGTGGAGAA AY518322.1
qCAT-R GCCTGGCTCATCTTTATC
qNrf2-F GATGAGAAGCGAGCCAGAGCG XM_027367068.1
qNrf2-R GCCGTCGGATGTCTCGGATAA
qHSP70-F GCGTACTGCCTGTGAGCG Y645906
qHSP70-R CGGGTGATGGAGGTGTAGAAA
qGST-F AAGATAACGCAGAGCAAGG AY573381.2
qGST-R TCGTAGGTGACGGTAAAGA
qGPX-F AGGGACTTCCACCAGATG XM_027372127.1
qGPX-R CAACAACTCCCCTTCGGTA
qSOD-F CTGGTTCCGTTGCTTGGC DQ005531
qSOD-R CGCTCATTCACGTTCTCCC
qTrx-F TTAACGAGGCTGGAAACA XM_027377405.1
qTrx-R AACGACATCGCTCATAGA
qHIF-1α-F GGAGGCCTACAAGACACTGC FJ807918.1
qHIF-1α-R TGAGACACACGACGTACTGC
qprx2-F AATGACCGCGTTGAGGAGTT XM_027353910.1
qprx2-R AGTGGGATCTTCAGCTTGCC
qATG5-F GGAACCTCACTGCCCACTTT MH797023.1
qATG5-R TGCCCTCTGTGCTTCAAACC
qATG10-F GGATGCTCTTGTTGCGTCAGG MH797021.1
qATG10-R CAATCACTCGGGTAAACTTCT
qcaspase-2-F TAAAGTTCCCTCACGACAA XM_027358707.1
qcaspase-2-R GCTCATCACCATCCCTAAT
qcaspase-3-F AACCAAGGCATCCCTGTCA XM_027378310.1
qcaspase-3-R GGGTTTATTCTGAAGTTGTGGG
qEF1α-F GTATTGGAACAGTGCCCGTG XM_027373349.1
qEF1α-R ACCAGGGACAGCCTCAGTAAG
qHO-1-F
qHO-1-R
qNQO1-F
qNQO1-R		 GCATGGCAGTGACCGAGATTGA
GTCGCTGCTTCGTCTCCTCATC
ATGAGTACTTCAGCCAAAATG
TCATCATTTTGGCTGAAGTA		 XM_027376282.1
XM_027358901.1
Open in a new tab

2.6. Histological and Pathological Analysis

The fixed samples were dehydrated with gradient alcohol, transparent in xylene, embedded, and cut into 8 µm slices. Following rehydration and dewaxing, sections were stained with a hematoxylin–eosin staining kit (Beyotime, China). The Leica microscope (Leica, Wetzlar, Germany) was used to view and take pictures of the stained sections.

2.7. TUNEL Apoptosis Detection

With the help of the TUNEL detection kit (Green FITC, Elabscience, China), hepatopancreas cell apoptosis was identified.

2.8. Statistical Analysis

The data were represented by the average value. The data were analyzed and tested by one-way ANOVA using IBM SPSS software. p < 0.05 indicates a statistically significant difference. Significant variations were shown by distinct lowercase letters.

3. Results

3.1. Expression Profile of Nrf2 Knockdown

As shown in Figure 1, in comparison with the control group and the dsRNA-Nrf2 group, the transcription level of Nrf2 in the dsRNA-Nrf2 + SFN group was markedly upregulated at 24 h (p < 0.05). Specifically, it was 2.8-fold that of the control group and 4.5-fold that of the dsRNA-Nrf2 group. The transcription level of Nrf2 was not notable disparity between the SFN group and the control group. At 48 h, the transcription level of Nrf2 in the SFN group was approximately 3 times that of each of the other three groups. There was no notable disparity in the expression level of Nrf2 among the control group, the dsRNA-Nrf2 group, and the dsRNA-Nrf2 + SFN group at 48 h.

Figure 1.

Figure 1

Open in a new tab

Expression of Nrf2 in the hepatopancreas of four groups. The mock value is the expression level of the control group at 0 h. Different letters indicated significant differences at the same time (p < 0.05). All values are average standard deviation, n = 3.

3.2. Expression of Antioxidant-Related Genes in Hepatopancreas of L. vannamei

As shown in Figure 2A–C, in contrast to the control group, the transcription level of GST, SOD, CAT, and GPX in the dsRNA-Nrf2 group was lower (p < 0.05). Specifically, the expression levels of GST, SOD, and GPX in the control group were 3.3, 2.2, and 2.1 times those of the dsRNA-Nrf2 group, respectively. At 24 h, in contrast to the dsRNA-Nrf2 group, the transcription level of HIF-1α, SOD, GPX, GST, prx2, NQO1, CAT, and HSP70 in the dsRNA-Nrf2 + SFN group was significantly increased. (p < 0.05). Specifically, the transcription levels of CAT, SOD, GST, NQO1, HO-1, and GPX in the dsRNA-Nrf2 + SFN group reached 4.8, 2.4, 15, 10, 2, and 5.7 times of those of the dsRNA-Nrf2 group, respectively. The transcription level of SOD, CAT, GPX, GST, Trx, HSP 70, and prx2 in the SFN group was the highest at 48 h,

Figure 2.

Figure 2

Open in a new tab

(A) The expression of direct antioxidant execution-related genes (CAT, SOD, GPX, and prx2) in hepatopancreas. (B) The expression of antioxidant pathway regulation-related genes (HO-1 and NQO1) in hepatopancreas. (C) The expression of stress response and antioxidant synergistic assistance-related genes (TRX, GST, HIF-1α, and HSP70) in hepatopancreas. The different letters indicate significant differences at the same time point (p < 0.05).

In the dsRNA-Nrf2 + SFN group, the expression peak of antioxidant-related genes appeared at 24 and 48 h. In the SFN group, the transcription level peak of antioxidant-related genes appeared from 48 to 96 h.

3.3. Expression of Autophagy and Apoptosis-Related Genes in Hepatopancreas of L. vannamei

As shown in Figure 3, the expression levels of ATG5 and ATG10 in the dsRNA-Nrf2 group were significantly lower than the control group at 24 h (p < 0.05), and the expression levels of ATG5 and ATG10 were about 0.08 and 0.03 times those of the control group, respectively. From 24 to 96 h, the expression levels of ATG5 and ATG10 in the dsRNA-Nrf2 + SFN group were stable, and the expression levels of ATG5 and ATG10 in the SFN group were the highest among the four groups (p < 0.05). From 24 to 96 h, the expression levels of caspase-2 in the dsRNA-Nrf2 group were unstable, while the expression of caspase-3 gradually decreased, and the expression level of caspase-3 was the lowest in the four groups at 96h (p < 0.05), which was 0.22 times the corresponding expression level of the control group. In contrast to the dsRNA-Nrf2 group, the transcription level of caspase-2 in the dsRNA-Nrf2 + SFN group and the SFN group was stable and showed no significant fluctuations.

Figure 3.

Figure 3

Open in a new tab

The expression of apoptosis- and autophagy-related genes in four groups of hepatopancreas. The different letters indicate significant differences at the same time point (p < 0.05).

3.4. Pathological Analysis of Hepatopancreas

As shown in Figure 4A,B, pathological analysis showed that abnormal hepatopancreatic structure appeared in the control group, including vacuolation of hepatic tubules and significant expansion of a few hepatic tubules. In the dsRNA-Nrf2 group, not only lots of vacuoles appeared in the lumen of hepatic tubules but also the wall of hepatic tubules contracted in size. In the dsRNA-Nrf2 + SFN group, the lumen of hepatic tubules recovered, and it showed a star shape. Moreover, in the SFN group, the degree of vacuolation decreased, and the wall thinning of hepatic tubules was alleviated. The hepatic tubules presented a well-defined star shape, and the detailed structure of the lumen was clearly visible. The results demonstrated that OFO was capable of inducing oxidative damage to the hepatopancreas. Conversely, SFN exhibited the potential to repair such oxidative damage. However, the knockdown of Nrf2 weakened the reparative effect of SFN.

Figure 4.

Figure 4

Open in a new tab

Pathological picture of hepatopancreas. Pathological pictures stained with hematoxylin and eosin at magnification of 100 times (A) and 200 times (B). Where the arrow is marked, it shows that the hepatic tubule is cavitated and the thickness of the tubular wall is reduced (scale bar: 50 μm).

3.5. TUNEL Apoptosis Detection Results

As shown in Figure 5, obvious green fluorescence signals were observed in the control group. Moreover, more green fluorescent signals were observed in the dsRNA-Nrf2 group, which indicated that apoptosis occurred in the hepatopancreas of both the control and the dsRNA-Nrf2 groups, but the apoptosis in the dsRNA-Nrf2 group was more serious. However, the signal of apoptosis in the dsRNA-Nrf2 + SFN group and the SFN group was obviously weakened. The results indicated that SFN could effectively reduce the apoptosis of hepatopancreas cells.

Figure 5.

Figure 5

Open in a new tab

Apoptosis of hepatopancreatic cells in four groups of L. vannamei. The positive control is an important component in the kit used to verify the effectiveness of the detection system. The negative control, on the other hand, is used to exclude nonspecific staining and other factors that may interfere with the experimental results. Apoptotic signals are indicated by green fluorescence, with stronger green signals correlating to more severe apoptosis. The nuclei are marked with blue. All sections were examined at a magnification of 100x (scale bar: 50 μm).

4. Discussion

Our previous studies showed that Nrf2 can regulate the antioxidant capacity, autophagy mechanism, and apoptosis of L. vannamei [20]. To further study the role of Nrf2 in oxidative stress, we used OFO to induce oxidative stress in L. vannamei and then explored the reparative effect of SFN on oxidative stress-induced injury. Studies showed that SFN could effectively reduce oxidative damage inflicted by OFO on L. vannamei. This process was characterized by the significant upregulation of Nrf2 expression, which further influenced the differential expression of antioxidant-, autophagy-, and apoptosis-related genes. The preliminary results indicated that SFN mitigated the oxidative damage of L. vannamei induced by OFO by activating Nrf2.

4.1. Activation of Nrf2 by SFN and Its Antioxidant Stress Effect

When an organism undergoes oxidative stress, its antioxidant defense system will be activated. The expression level of Nrf2 increases significantly when the organism is subjected to oxidative stress. Nrf2 binds to the ARE, inducing the expression of antioxidant genes in the organism. Thereby, it eliminates free radicals such as ROS in the body and alleviates the oxidative stress damage caused by oxidative stress [21, 22]. SFN can not only activate Nrf2 to reduce neuronal apoptosis and brain tissue damage, but also upregulate the expression of antioxidant-related genes through the Nrf2 signaling pathway [23], thereby protecting the blood-brain barrier and maintaining neural function [24]. The transcription level of Nrf2 decreased significantly 24 h after knockout, in contrast to the control group in this study. (p < 0.05), and no significant changes in the expression level of Nrf2 were observed at subsequent time points. This phenomenon may be attributed to the fact that the shrimp continuously suffered from the oxidative stress induced by the intake of OFO, which maintained Nrf2 in a highly expressed state and weakened the efficiency of RNA interference (RNAi). Compared with the dsRNA-Nrf2 group, feeding the diet containing SFN significantly raised the transcription level of Nrf2. Meanwhile, the transcription level of antioxidant-related genes and stress-related genes was upregulated. Previous studies have confirmed that natural active components, such as Brassica plant extracts and dill essential oil, can significantly enhance the antioxidant capacity of aquatic animals [11–25]. Similarly, the results of this study indicated that the antioxidant capacity of the organism was further enhanced, and the damage induced by oxidative stress in L. vannamei was effectively alleviated and repaired after feeding the diet containing SFN.

4.2. The Core Regulation of Oxidative Stress and Its Epigenetic Mechanism

Although this study focuses on the Nrf2 pathway's response to oxidative stress induced by OFO, it is essential to emphasize that oxidative stress itself plays a central regulatory role in cellular regulatory networks. Recent evidence indicated that oxidative stress dynamically modulates ARE-driven gene expression through histone modifications (e.g., H3K27ac), a finding that closely aligns with the synchronous elevation of Nrf2 activity peaks and antioxidant enzyme expression observed in our study [26]. The SFN-mediated activation of Nrf2 and subsequent induction of antioxidant genes in this research essentially reflect the cell's adaptive response to oxidative stress through regulatory networks [27].

4.3. Nrf2 Repairs Oxidative Stress Damage by Participating in Autophagy

Autophagy is a process in which abnormal proteins and organelles in the cytoplasm are degraded and recycled via lysosomes under stress conditions [28]. Low levels of oxidative damage can trigger autophagy, through which cells clear and renew damaged cellular components to maintain cellular and tissue homeostasis, ultimately mitigating oxidative stress-induced cellular damage [29, 30]. In this study, knockdown of Nrf2 in L. vannamei significantly downregulated the expression of ATG5 and ATG10 at 24 h, indicating that Nrf2 knockdown compromised the cells' ability to maintain homeostasis via autophagy under oxidative stress. SFN not only increased Nrf2 expression in L. vannamei but also induced upregulation of autophagy genes ATG5 and ATG10. The results indicated that SFN enhanced cellular autophagy via Nrf2 activation to clear oxidatively damaged components, repair oxidative stress injuries, and maintain cellular homeostasis and health.

4.4. SFN Participates in the Regulation of Apoptosis Induced by Oxidative Stress and Its Protective Effect on Hepatopancreas

A common mode of cell death in oxidative stress is apoptosis, a programed cell death process that serves as a critical mechanism for cells to maintain homeostasis [31]. During oxidative stress, if cellular damage remains mild, cells preferentially utilize autophagy to maintain internal homeostasis. However, when the intensity of oxidative stress exceeds the cell's capacity, the autophagic mechanism becomes ineffective, and cells initiate apoptosis to eliminate irreparably damaged cells that can no longer maintain normal physiological functions, thereby preserving overall organismal health [32, 33]. Caspase 2 acts as an initiator of programed cell death [34], while caspase 3 serves as an apoptosis executioner [35]. In this study, L. vannamei with knocked-down Nrf2 was fed a diet containing SFN. It was found that the transcription level of caspase 2 was significantly reduced, and the difference was notable compared with the control group at 96 h. TUNEL apoptosis assay revealed that Nrf2 knockdown increased the apoptosis of hepatopancreatic cells in L. vannamei, while SFN treatment significantly decreased such apoptosis. Knockdown of Nrf2 will induce an increase in ROS and affect cell apoptosis [36, 37]. Histological analysis of the hepatopancreas demonstrated that Nrf2 knockdown led to severe vacuolization of the hepatopancreatic lumen and thinning of the hepatic tubule walls in L. vannamei. Mice with Nrf2 deficiency exacerbated the radiation-induced histopathological changes in the lungs of mice [38]. After Nrf2 knockdown, SFN treatment significantly ameliorated the vacuolization of the tubule lumen and promoted the restoration of the hepatopancreatic tubules to their normal star-shaped morphology. Moreover, treatment with SFN alone also significantly alleviated the vacuolization of the lumen of the hepatopancreatic tubules induced by OFO, presenting a clear and complete star-shaped structure. Studies in mice have found that SFN can improve phosgene-induced lung injury through the Nrf2 signaling pathway [39]. The results indicated that knocking down Nrf2 exacerbated oxidative stress damage in the hepatopancreas of L. vannamei and led to an increase in hepatopancreatic cell apoptosis. In contrast, SFN treatment effectively mitigated oxidative stress damage in the hepatopancreas and reduced hepatopancreatic cell apoptosis. SFN may repair the oxidative stress induced by OFO in L. vannamei by enhancing the organism's antioxidant capacity, reducing oxidative damage, and inhibiting the initiation of apoptosis.

5. Conclusion

In summary, Nrf2 knockdown exacerbated vacuolization of hepatopancreatic tubule lumens and increased cell apoptosis in L. vannamei fed with OFO. Conversely, SFN could activate Nrf2 expression in L. vannamei, thereby regulating antioxidant-, autophagy-, and apoptosis-related gene expression and reducing apoptotic signaling in the hepatopancreas. Nrf2 was involved in the process by which SFN repaired OFO-induced oxidative damage in L. vannamei.

Acknowledgments

This work was funded by the Innovative Team Building Project of Guangdong Modern Agricultural Industrial Technology System (Grant 2024CXTD25), the Agricultural Sci-Tech Commissioners of Guangdong Province (Grant KTP20210291), the Modern Seed Industry Park for White-leg Shrimp of Guangdong Province (Grant K22219), and the Open Fund of Tianjin Key Lab of Aquatic Ecology and Aquaculture (Grant TJAE201506).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Ethics Statement

The animal study was reviewed and approved by the Guangdong Province Laboratory Animal Management Regulations (Approval Number: GOU-IACUC-20240-A0326; Approval Date: April 5, 2024).

Conflicts of Interest

The authors declare no conflicts of interest.

Author Contributions

Shiping Yang: writing – original draft, resources. Leyuan Feng: data curation, validation. Junliang Luo: methodology, data curation. Jichang Jian: resources. Shuanghu Cai: methodology. Huiling Liu: writing – review and editing.

Funding

This work was funded by the Innovative Team Building Project of Guangdong Modern Agricultural Industrial Technology System (Grant 2024CXTD25), the Agricultural Sci-Tech Commissioners of Guangdong Province (Grant KTP20210291), the Modern Seed Industry Park for White-leg Shrimp of Guangdong Province (Grant K22219), and the Open Fund of Tianjin Key Lab of Aquatic Ecology and Aquaculture (Grant TJAE201506).

References

  • 1.Yang S., Yuan Y., Chen C., et al. NQO1 From Litopenaeus vannamei Involved in the Regulation of Antioxidant Capacity, Inflammation, and Apoptosis. Aquaculture Reports . 2024;39 doi: 10.1016/j.aqrep.2024.102380.102380 [DOI] [Google Scholar]
  • 2.Jin G., Zhang L., Mai K., Chen X., Xu S., Ai Q. Effects of Different Dietary Lipid Sources on Growth Performance, Hepatic Lipid Deposition and Transcriptome Response in Spotted Sea Bass (Lateolabrax maculatus) Aquaculture . 2023;566 doi: 10.1016/j.aquaculture.2022.739143.739143 [DOI] [Google Scholar]
  • 3.Hasanpour S., Salati A. P., Falahatkar B., Azarm H. M. Effects of Dietary Green Tea (Camellia sinensis L.) Supplementation on Growth Performance, Lipid Metabolism, and Antioxidant Status in a Sturgeon Hybrid of Sterlet (Huso huso ♂ × Acipenser ruthenus ♀) Fed Oxidized Fish Oil. Fish Physiology and Biochemistry . 2017;43(5):1315–1323. doi: 10.1007/s10695-017-0374-z. [DOI] [PubMed] [Google Scholar]
  • 4.Murakami S., Motohashi H. Roles of Nrf2 in Cell Proliferation and Differentiation. Free Radical Biology and Medicine . 2015;88:168–178. doi: 10.1016/j.freeradbiomed.2015.06.030. [DOI] [PubMed] [Google Scholar]
  • 5.Tonelli C., Chio I. I. C., Tuveson D. A. Transcriptional Regulation by Nrf2, Antioxid Redox Signal. 2018;29(17):1727–1745. doi: 10.1089/ars.2017.7342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.He F., Ru X., Wen T. NRF2, a Transcription Factor for Stress Response and Beyond. International Journal of Molecular Sciences . 2020;21(13) doi: 10.3390/ijms21134777.4777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kobayashi A., Ohta T., Yamamoto M. Methods in Enzymology . Academic Press; 2004. Unique Function of the Nrf2–Keap1 Pathway in the Inducible Expression of Antioxidant and Detoxifying Enzymes; pp. 273–286. [DOI] [PubMed] [Google Scholar]
  • 8.Motohashi H., Yamamoto M. Nrf2-Keap1 Defines a Physiologically Important Stress Response Mechanism. Trends in Molecular Medicine . 2004;10(11):549–557. doi: 10.1016/j.molmed.2004.09.003. [DOI] [PubMed] [Google Scholar]
  • 9.Canning P., Sorrell F. J., Bullock A. N. Structural Basis of Keap1 Interactions With Nrf2. Free Radical Biology and Medicine . 2015;88:101–107. doi: 10.1016/j.freeradbiomed.2015.05.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.He F., Antonucci L., Karin M. NRF2 as a Regulator of Cell Metabolism and Inflammation in Cancer. Carcinogenesis . 2020;41(4):405–416. doi: 10.1093/carcin/bgaa039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Vijayaram S., Razafindralambo H., Sun Y.-Z., et al. Application Development on Brassica Species in Aquaculture–A Review. Annals of Animal Science . 2024;24(2):321–329. doi: 10.2478/aoas-2023-0048. [DOI] [Google Scholar]
  • 12.Wang B., Zhang C., Zhang Q., et al. Can Sulforaphane Alter Growth Performance, Innate Immunity and Antioxidant Capability of Common Carp (Cyprinus carpio Huanghe Var)? Aquaculture Reports . 2023;31 doi: 10.1016/j.aqrep.2023.101666.101666 [DOI] [Google Scholar]
  • 13.Tang L., Ren X., Han Y., et al. Sulforaphane Attenuates Apoptosis of Hippocampal Neurons Induced by High Glucose via Regulating Endoplasmic Reticulum. Neurochemistry International . 2020;136 doi: 10.1016/j.neuint.2020.104728.104728 [DOI] [PubMed] [Google Scholar]
  • 14.Luo J., Huang Y., Chen Y., et al. Heme Oxygenase-1 is Involved in the Repair of Oxidative Damage Induced by Oxidized Fish Oil in Litopenaeus vannamei by Sulforaphane. Marine Drugs . 2023;21(10) doi: 10.3390/md21100548.548 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Luo J., Li G., Chen Y., et al. Sulforaphane Alleviates Oxidative Stress Induced by Oxidized Fish Oil in Litopenaeus vannamei by Involving Antioxidant Capacity, Inflammation, Autophagy, and Apoptosis. Aquaculture Reports . 2023;33 doi: 10.1016/j.aqrep.2023.101851.101851 [DOI] [Google Scholar]
  • 16.Huang Y., Li Q., Yang S., et al. Identification and Characterization of Heme Oxygenase-1 From Litopenaeus vannamei Involved in Antioxidant and Anti-Apoptosis Under Ammonia Stress. Fishes . 2022;7(6) doi: 10.3390/fishes7060356.356 [DOI] [Google Scholar]
  • 17.Lv Y., Jiang H., Li S., et al. Sulforaphane Prevents Chromium-Induced Lung Injury in Rats via Activation of the Akt/GSK-3β/Fyn Pathway. Environmental Pollution . 2020;259 doi: 10.1016/j.envpol.2019.113812.113812 [DOI] [PubMed] [Google Scholar]
  • 18.Yu H., Ren Y., Wei H., et al. Dietary Oxidized Fish Oil Negatively Affected the Feed Utilization, Health Status and Fillet Quality of Juvenile Amur Sturgeon, A. schrenckii. Aquaculture . 2022;546 doi: 10.1016/j.aquaculture.2021.737290.737290 [DOI] [Google Scholar]
  • 19.Livak K. J., Schmittgen T. D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods . 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 20.Huang Y., Li Q., Yuan Y., et al. Silencing of Nrf2 in Litopenaeus vannamei, Decreased the Antioxidant Capacity, and Increased Apoptosis and Autophagy. Fish & Shellfish Immunology . 2022;122:257–267. doi: 10.1016/j.fsi.2022.02.010. [DOI] [PubMed] [Google Scholar]
  • 21.Ma Q. Role of Nrf2 in Oxidative Stress and Toxicity. Annual Review of Pharmacology and Toxicology . 2013;53(1):401–426. doi: 10.1146/annurev-pharmtox-011112-140320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ngo V., Duennwald M. L. Nrf2 and Oxidative Stress: A General Overview of Mechanisms and Implications in Human Disease. Antioxidants . 2022;11(12) doi: 10.3390/antiox11122345.2345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kubo E., Chhunchha B., Singh P., Sasaki H., Singh D. P. Sulforaphane Reactivates Cellular Antioxidant Defense by Inducing Nrf2/ARE/Prdx6 Activity During Aging and Oxidative Stress. Scientific Reports . 2017;7(1) doi: 10.1038/s41598-017-14520-8.14130 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ping Z., Liu W., Kang Z., et al. Sulforaphane Protects Brains Against Hypoxic-Ischemic Injury Through Induction of Nrf2-Dependent Phase 2 Enzyme. Brain Research . 2010;1343:178–185. doi: 10.1016/j.brainres.2010.04.036. [DOI] [PubMed] [Google Scholar]
  • 25.Ghafarifarsani H., Aftabgard M., Hoseinifar S. H., Raeeszadeh M., Van Doan H. Comparative Effects of Savory (Satureja hortensis), Dill (Anethum graveolens), and Mooseer (Allium hirtifolium) Essential Oils on Growth, Digestive, and Immunoantioxidant Parameters and Resistance to Aeromonas hydrophila in Juvenile Common Carp (Cyprinus carpio) Aquaculture . 2023;572 doi: 10.1016/j.aquaculture.2023.739541.739541 [DOI] [Google Scholar]
  • 26.Li Q., Ci H., Zhao P., et al. NONO Interacts With Nuclear PKM2 and Directs Histone H3 Phosphorylation to Promote Triple-Negative Breast Cancer Metastasis. Journal of Experimental & Clinical Cancer Research . 2025;44(1) doi: 10.1186/s13046-025-03343-5.90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yang Q., Han B., Li S., et al. The Link Between Deacetylation and Hepatotoxicity Induced by Exposure to Hexavalent Chromium. Journal of Advanced Research . 2022;35:129–140. doi: 10.1016/j.jare.2021.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Glick D., Barth S., Macleod K. F. Autophagy: Cellular and Molecular Mechanisms. The Journal of Pathology . 2010;221(1):3–12. doi: 10.1002/path.2697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Buratta S., Tancini B., Sagini K., et al. Lysosomal Exocytosis, Exosome Release and Secretory Autophagy: The Autophagic- and Endo-Lysosomal Systems Go Extracellular. International Journal of Molecular Sciences . 2020;21(7) doi: 10.3390/ijms21072576.2576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kageyama S., Gudmundsson S. R., Sou Y.-S., et al. p62/SQSTM1-Droplet Serves as a Platform for Autophagosome Formation and Anti-Oxidative Stress Response. Nature Communications . 2021;12(1):p. 16. doi: 10.1038/s41467-020-20185-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sun M. S., Jin H., Sun X. Free Radical Damage in Ischemia-Reperfusion Injury: An Obstacle in Acute Ischemic Stroke after Revascularization Therapy. Oxidative Medicine and Cellular Longevity . 2018;2018 doi: 10.1155/2018/3804979.3804979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Baechler B. L., Bloemberg D., Quadrilatero J. Mitophagy Regulates Mitochondrial Network Signaling, Oxidative Stress, and Apoptosis During Myoblast Differentiation. Autophagy . 2019;15(9):1606–1619. doi: 10.1080/15548627.2019.1591672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sharma P., Kaushal N., Saleth L. R., Ghavami S., Dhingra S., Kaur P. Oxidative Stress-Induced Apoptosis and Autophagy: Balancing the Contrary Forces in Spermatogenesis, Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2023;1869(6) doi: 10.1016/j.bbadis.2023.166742.166742 [DOI] [PubMed] [Google Scholar]
  • 34.Kopeina G. S., Zhivotovsky B. Caspase-2 as a Master Regulator of Genomic Stability. Trends in Cell Biology . 2021;31(9):712–720. doi: 10.1016/j.tcb.2021.03.002. [DOI] [PubMed] [Google Scholar]
  • 35.Rao G., Zhong G., Hu T., et al. Arsenic Trioxide Triggers Mitochondrial Dysfunction, Oxidative Stress, and Apoptosis via Nrf 2/Caspase 3 Signaling Pathway in Heart of Ducks. Biological Trace Element Research . 2023;201(3):1407–1417. doi: 10.1007/s12011-022-03219-1. [DOI] [PubMed] [Google Scholar]
  • 36.Orrù C., Giordano S., Columbano A. Nrf2 in Neoplastic and Non-Neoplastic Liver Diseases. Cancers . 2020;12(10) doi: 10.3390/cancers12102932.2932 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tang T., Jia Y., Liang H., et al. Knockdown of Nrf2 Radiosensitizes Glioma Cells by Inducing Redox Stress and Apoptosis in Hypoxia. Translational Cancer Research . 2022;11(11):4105–4116. doi: 10.21037/tcr-22-1420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tian X., Wang F., Luo Y., et al. Protective Role of Nuclear Factor-Erythroid 2-Related Factor 2 Against Radiation-Induced Lung Injury and Inflammation. Frontiers in Oncology . 2018;8 doi: 10.3389/fonc.2018.00542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lu Q., Huang S., Zhao Y., et al. Sulforaphane Attenuates Phosgene-Induced Acute Lung Injury via the Nrf2-HO-1/NQO1 Pathway. Journal of Thoracic Disease . 2024;16(10):6604–6615. doi: 10.21037/jtd-24-819. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Aquaculture Nutrition are provided here courtesy of Wiley

RESOURCES