Sustained Mg/Sr ion delivery from injectable silk fibroin hydrogels drives SCAP osteogenic differentiation

Summary

This study highlights the biomedical relevance of injectable TS (tannic acid-silk fibroin)-Mg/Sr hydrogels in alveolar bone repair, particularly their prospective role as carriers for stem cells from the apical papilla (SCAPs) in tissue regeneration. By utilizing self-assembling silk material, noted for its favorable handling properties, we present a useful approach for single-wall bone defects, such as bone fenestration and fractures in the oral cavity. Furthermore, our findings regarding the involvement of the TRPM7 ion channel indicate a possible regulatory pathway for improving alveolar bone defect repair. This study provides a biological and applicational basis for future use in oral and maxillofacial regeneration.

Graphical abstract

Highlights

• •Injectable TS-Mg/Sr hydrogel offers sustained ion release for irregular bone defects
• •Dual ions synergistically boost SCAP proliferation, migration, and osteogenic differentiation
• •TRPM7 mediates TS-Mg/Sr-induced SCAP osteogenesis in bone regeneration

Drug delivery system; Biological sciences; Bioengineering; Materials science; Biomaterials

Introduction

Tissue and organ damage related problems caused by diseases, injuries, and treatment have brought many challenges to modern medicine.^1,2,3 Malocclusion is a common oral disease, which cause functional and esthetic impairment and adversely affect quality of life, body image perception, self-confidence, and social interaction.⁴ Orthodontic treatment is universally recognized as essential in the treatment of malocclusions. However, alveolar bone dehiscence or fenestration, which may cause alveolar bone loss and gingival recession, is the common sequelae of orthodontic treatment.⁵ Such complications can diminish tooth stability, expose roots, and hinder tooth movement. Timely repair of alveolar bone defects resulting from orthodontic treatment is crucial for preserving natural teeth and promoting oral function.⁶ However, the clinical effects of traditional treatments, both surgical and non-surgical, are considered to be insufficient.⁷ Therefore, prompt and easily implemented repair of alveolar bone defects is essential for maintaining oral health and function, and it represents an urgent issue that needs to be addressed.

With the rapid development of tissue engineering in the field of regenerative medicine, it is hoped that these problems can be breakthrough. As one of nature’s strongest fibrous proteins with excellent biocompatibility, biodegradability, low immunogenicity, and tuneable mechanical properties, silk fibroin (SF) is a unique natural protein that has been used as a biopolymer for tissue engineering.^8,9 Based on its characteristic, SF have been used as a carrier for efficient delivery of various therapeutic bioactive molecules, such as drugs, growth factors and cells. Recently, a self-assembly tannic acid with SF (TS) hydrogels were synthesized, which characterized with better mechanical strength, gelation rate, and bioactivity.¹⁰ Acting as a matrix to form functional adhesive materials, TS have not only an efficiency of delivery but also stable retention for no less than one month. Besides, the TS was also applied herein to prevent bacterial infection and promote the wound healing of full-thickness skin wounds on the dorsal skin of mice. The TS can be a promising scaffold for drug delivery to promote bone tissue healing. However, previously developed injectable silk hydrogels for bone regeneration typically employ expensive biologics. Currently, various bioactive agents are commonly incorporated into hydrogel materials to enhance bone defect repair, with the most frequently used factors, including BMP-2 (Bone Morphogenetic Protein-2), VEGF (Vascular Endothelial Growth Factor), transforming growth factor β (TGF-β), and fibroblast growth factor (FGF). However, the application of these biologics may be associated with several adverse side effects. For instance, BMP-2 has been reported to induce ectopic bone formation and inflammatory responses¹¹; VEGF may inhibit terminal osteogenic differentiation and potentially promote tumor-associated angiogenesis¹²; and FGF has been shown to increase the risk of tissue fibrosis. Thus, it is necessary to find an active factor with osteogenic activity and low cost.

Biogenic mineral ions have become important additives in treatments for bone regeneration and repair. Both magnesium and strontium ions have been reported to stimulate tissue regeneration with a great biocompatibility. Magnesium and strontium can promote the growth and repair of bone tissue by directly stimulate osteoblast proliferation and differentiation, as well as, effective inhibit P. gingivalis and P. nigrescens survival,¹³ and improve the angiogenic capacity in terms of proliferation, migration, tube formation, and expression of angiogenic genes, which indirectly improve the bone repair.^14,15,16 Moreover, magnesium ions can also inhibit inflammatory responses by reducing the levels of inflammatory mediators, thereby helping tissue repair and regeneration. Conversely, focal osteoporosis of the metaphyseal spongious bone was observed, with the lowering of BMD, increased bone fragility, and altered bone architecture, in magnesium-deficient experimental mice.¹⁷ For strontium, the expression of osteogenic differentiation genes, including alkaline phosphatase (ALP), type I collagen (COL-I), osteopontin (OPN), bone sialoprotein (BSP), and osteocalcin (OCN), were increased in a strontium concentration-dependent manner. Besides, Strontium could directly suppress the osteoclast activity by simultaneously increasing osteoprotegerin production, and decreasing receptor activator of nuclear factor kappa beta ligand expression.¹⁸ In postmenopausal women, the risks of new vertebral fractures were reduced by 49% and 41% at 1 year and 3 years, respectively, in the strontium ranelate group. Additionally, a higher bone mineral density of the lumbar spine and femoral neck was also found after treatment. Although, both magnesium and strontium ions have certain effects on tissue repair and regeneration, the specific mechanisms and applications of magnesium and strontium ions in the repair of oral hard tissue defects still need further study and exploration.

Stem cells play pivotal roles in bone tissue regeneration and bone wound repairing. Stem cell-based tissue engineering is gaining considerable opportunities for the successful reconstruction of bone tissue.¹⁹ Compared to the bone marrow mesenchymal stem cell, oral cavity-derived stem cells have a higher proliferation rate, are easier to obtain, and are very promising sources for alveolar bone regeneration.²⁰ Of these, stem cells from the apical papilla (SCAPs) are a stem-cell population separated from the apical papilla of human teeth, which showed a higher mineralization potential and proliferation rate compared to the other oral cavity-derived stem cells.^21,22 Besides, the potential of SCAPs in differentiate into adipogenic, neurogenic, odontogenic, and osteoblastic cells have been proved.

In this study, we developed a cell-laden hydrogel by synthesizing a sustained release Mg/Sr ion-injectable silk hydrogel and combining it with SCAPs. The hydrogel exhibited prolonged metal ion release and enhanced therapeutic effectiveness. Both in vitro and in vivo experiments demonstrated that the TS-Mg/Sr hydrogel significantly promoted bone tissue regeneration by facilitating SCAPs differentiation into osteogenic cells through the TRPM7 ion channel. The significance of this research lies in the development of the TS-Mg/Sr hydrogel, a promising biomedical tool for enhancing mandibular bone repair, particularly when utilized in conjunction with SCAPs, offering potential applications in regenerative medicine.

Results

Rheological analysis of one-component Mg/Sr silk fibroin liquid/two-component TS-Mg/Sr hydrogel

Dynamic frequency scanning (0.1–100 rad/s) shows that There is a significant difference in the viscoelastic behavior between the single-component Mg-Sr silk fibroin liquid and the two-component TS-Mg/Sr hydrogel. (Figure 1A) the single-component Mg-Sr silk fibroin liquid exhibits a viscous fluid advantage throughout the test frequency range, and the loss modulus (G″) exceeds the storage modulus (G′) after the scan frequency is greater than 5 rad/s. The gradual increase in the G″/G′ ratio from low to high frequencies confirms the absence of a stable network, which is characteristic of nonentangled polymer solutions. In contrast, the two-component TS-Mg/Sr hydrogel exhibits a solid-like elasticity, and G′ remains frequency independent and significantly exceeds G′ by two orders of magnitude, indicating the presence of a stable chemical cross-linking network. These unique rheological properties meet the functional requirements for biomedical applications: the frequency insensitive elastic modulus of the hydrogel mimics the mechanical stability of native osteochondral tissue, while the shear thinning behavior of the liquid precursor supports injectability. Such programmable rheological properties are essential for engineering scaffolds that orchestrate mechanical support and dynamic cell interactions, facilitating applications in bone regeneration and minimally invasive tissue engineering.

Figure 1.

Characterization of material properties of injectable TS-Mg/Sr hydrogels

(A) Dynamic frequency scanning reveals significant rheological differences between the one-component Mg/Sr silk fibroin liquid/two-component TS-Mg/Sr hydrogel.

(B) NMR spectra demonstrated the TS/blank hydrogel and TS/Mg-Sr hydrogel have similar peaks.

(C) Ion release profiles of TS/Mg-Sr hydrogels (Mg²⁺ 3 mM, Mg²⁺ 2 mM; Sr²⁺ 1 mM, Mg²⁺ 1.5 mM; Sr²⁺ 1.5 mM, Mg²⁺ 1 mM; Sr²⁺ 2 mM, and Sr²⁺ 3 mM).

(D) Scanning electron micrographs (SEM) of internal pore structures for TS/Mg-Sr hydrogels ([i] Mg²⁺ 3 mM, [ii] Mg²⁺ 2 mM; Sr²⁺ 1 mM, [iii] Mg²⁺ 1.5 mM; Sr²⁺ 1.5 mM, [iv] Mg²⁺ 1 mM; Sr²⁺ 2 mM, and [v] Sr²⁺ 3 mM). Gelation of silk hydrogels containing different weight percentages Mg, Sr, or mix, respectively. Scale bars, 200 μm.

The ¹H-NMR spectra analysis

We conducted experiments using ¹H-NMR (Hydrogen Nuclear Magnetic Resonance) spectroscopy to analyze both blank silk and silk samples containing Mg and Sr elements. In the first ¹H-NMR spectrum (Figure 1B), representing the blank TS hydrogel, we observed a series of peaks with different chemical shift values (δ values). These peaks correspond to hydrogen atoms in the blank silk, providing information about their chemical environment and relative quantities. Subsequently, in the ¹H-NMR spectrum of the silk samples containing Mg and Sr elements. By comparing these two spectra, we can conclude that the addition of Mg and Sr ions did not alter the hierarchical chemical structure of silk protein. This analysis provides valuable insights into the impact of element doping on the structure and properties of silk samples, which is highly pertinent to our research.

Ions released from TS-Mg/Sr hydrogels

The release ability of TS-Mg/Sr hydrogel was verified by measuring the release concentrations of Mg and Sr ions in the hydrogel. Inductive coupled plasma optical emission spectrometry (ICP-OES) was used to measure TS-Mg/Sr hydrogels with different divalent metal salt concentrations (Mg²⁺ 3 mM, Mg²⁺ 2 mM; Sr²⁺ 1 mM, Mg²⁺ 1.5 mM; Sr²⁺ 1.5 mM, Mg²⁺ 1 mM; Sr²⁺ 2 mM, and Sr²⁺ 3 mM) analysis showed that the concentration of Mg and Sr ions released from each group showed a trend of first-order kinetic sustained release over the incubation time of 30 days (Figure 1C). The porous and interconnected three-dimensional structure of hydrogels is conducive to cell growth, and their easily modifiable characteristics allow them to serve as carriers for drug deliver.²³ These results indicated that the TS hydrogels possess a slow-release function. This sustaining-release capability of hydrogel extends the residence time of metal ions within the body, enhancing treatment efficacy while reducing the likelihood of adverse side effects. Moreover, the porous and interconnected three-dimensional structure of hydrogels promotes cell growth, which holds significant importance in the fields of biomedical engineering and tissue engineering applications.

SEM characteristics of TS-Mg/Sr

Ultrastructural observations revealed the presence of two distinct pore morphologies within the gel. Under varying magnesium ion concentrations, the gel’s microstructure exhibited significant alterations. This observation provides crucial insights into our understanding of the influence of magnesium and strontium doping on the gel’s structure. Two distinct pore morphologies have been observed in the lyophilized hydrogels via SEM examination (Figure 1D). With the increased Mg concentration, especially in TS-Mg/Sr-3/0 and 2/0 groups, the TS-Mg/Sr showed sponge network morphologies with 100-200 μm pore sides. With the addition of magnesium, the trend of increasing sponge-like 3D porous structured hydrogel has been observed previously.²⁴ Conversely, leaf-like structures were observed with the upregulation of Sr, and TS-Mg/Sr-0/3 exhibiting a more “flaky” microstructure. Thickness of pore walls showed no significant different among the groups. The pore structure of hydrogels significantly influences stem cell behavior, encompassing various aspects, such as proliferation, differentiation, migration, release of bioactive substances, cell-matrix interactions, and mechanical properties. An appropriate pore structure can promote cell proliferation, affect cell differentiation fate, regulate cell migration and positioning, control the diffusion and release of bioactive substances, influence cell-matrix interactions, and adjust the mechanical properties of the gel. Therefore, in the field of biomedical research, the deliberate design and optimization of hydrogel pore properties are crucial steps in achieving specific stem cell behavior and functional goals, with significant practical implications for applications in tissue engineering, regenerative medicine, and drug delivery.

In vitro biocompatibility of TS-Mg/Sr hydrogels

To detect the cytotoxic effect of TS-Mg/Sr hydrogels, SCAPs were treated with TS-Mg/Sr hydrogels with different divalent metal salt concentrations (Mg²⁺ 3 mM, Mg²⁺ 2 mM; Sr²⁺ 1 mM, Mg²⁺ 1.5 mM; Sr²⁺ 1.5 mM, Mg²⁺ 1 mM; Sr²⁺ 2 mM, and Sr²⁺ 3 mM) for 24, 48 and 72 h. CCK-8 assay showed that no significant different has been found at 24 h. However, at 48 h and 72 h, with the increased of the Mg²⁺ concentration, the cell viability of the SCAPs was significantly enhanced (Figures 2A and 2B).

Figure 2.

Biocompatibility, osteogenic differentiation, and migration of TS-Mg/Sr hydrogel in vitro

(A) The diagram illustrates the culturing of SCAPs in TS-Mg/Sr hydrogels and the subsequent biocompatibility testing.

(B) CCK-8 assay showed no significant difference in cell viability at 24 h. However, at 48 and 72 h, with the increase of magnesium and strontium ion concentration and coordination, the cell viability (expressed as absorbance value at 450 nm) of SCAPs was significantly enhanced. Group TS-Mg/Sr-1.5/1.5 has the strongest proliferation capacity.

(C) Calcein-AM/propidium iodide (PI) double staining was utilized to assess the number of viable SCAPs cultured within the TS-Mg/Sr hydrogels. Scale bars, 100 μm.

(D) With the increase of the concentration of magnesium and strontium ions and the coordination effect, the proliferation and osteogenic ability of stem cells were upregulated simultaneously.

(E) RT-qPCR showed the level of RUNX2 in group TS-Mg/Sr-1.5/1.5 exhibited significantly higher than that in other experimental groups and blank group.

Data are the means ± SD. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001; one-way ANOVA.

(F) Representative images of migrated cells at 8 h and 12 h. Scale bars, 100 μm.

(G) Quantification of migration rates normalized to the blank group, the group TS-Mg/Sr-1.5/1.5 exhibited significantly accelerated cell migration at both 8 h and 12 h.

Data expressed as mean ± SD (n = 6). ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001. Statistical significance was determined by two-tailed unpaired Student’s t test.

Calcein-AM/PI staining showed no significant cytotoxicity between the TS-Mg/Sr hydrogels and the TS-Mg/Sr hydrogels supplemental with divalent metal salt (Figures 2C and 2D). The Mg and Sr showed a great biocompatibility, and they were nontoxic in wide concentration ranges.²⁴ With the upregulation of Mg, the capacity of proliferation and osteogenesis was increased in stem cells.²⁵ These results verified the good biocompatibility of TS-Mg/Sr hydrogels in vitro, and the TS-Mg/Sr-1.5/1.5 has been selected for the followed research.

Synergistic effect of magnesium and strontium ions on osteogenic differentiation and migration of stem cells

TS-Mg/Sr-1.5/1.5 hydrogels (Mg²⁺ 1.5 mM; Sr²⁺ 1.5 mM) demonstrated a unique synergistic capacity to concurrently enhance osteogenic differentiation and stem cell migration (Figures 2E and 2F), surpassing the effects of individual ions or lower concentrations. Quantitative reverse-transcription PCR (RT-qPCR) analysis revealed significantly elevated RUNX2 expression in the dual-ion group compared to all controls, confirming its potent role in activating osteogenic transcription. This molecular response was functionally paralleled by accelerated cell migration, with the Mg²⁺/Sr²⁺ group exhibiting markedly increased migration rates at both 8 h and 12 h, suggesting coordinated regulation of cytoskeletal dynamics and adhesion turnover. The synergy like originates from complementary ion-specific mechanisms: Mg²⁺ promotes transient membrane fluidity and rapid cell motility, while Sr²⁺ stabilizes osteogenic signaling pathways to lock differentiation commitment post-migration. These dual functionalities address critical challenges in bone regeneration—spatiotemporal control of progenitor cell recruitment and site-specific differentiation. By mimicking the ionic kinetics of natural fracture healing, this strategy enables biomaterials to sequentially guide cell homing and mineralization, offering a programmable platform for engineering scaffolds that integrate injectable delivery, mechanical support, and bioactive signaling in bone defect repair.

In vivo bone regenerative properties of TS-Mg/Sr hydrogels

In vivo tests were conducted on C57 mouse model for evaluating the osteogenesis ability of the TS-Mg/Sr hydrogels. We established a 1.2 mm diameter mandibular bone defect model by drilling holes, which is a classic model for studying mandibular bone healing. Scaps-loaded TS-Mg/Sr hydrogel was implanted into the bone defect. 28 days after modeling, micro-CT reconstruction of the mandibular morphology showed that TS-Mg/Sr hydrogel promoted the healing of bone defects. (Figure 3A). There was no significant difference in body weight between two groups (Figure 3C). The degradation curves of TS blank and TS-MG/Sr hydrogels showed similar curve progression over 28 days (Figure 3D). The blank TS hydrogel degraded to 12.8% at 7 days and reached 73.7% at 28 days, while the TS-MG/Sr hydrogel showed a similar degradation rate. This similarity suggests that Mg²⁺/Sr²⁺ incorporation does not impair structural stability or accelerate global degradation. The sustained ion release observed in previous experiments may result from two synergistic mechanisms: (1) passive diffusion through the porous network of the hydrogel, and (2) gradual cleavage of the fibroin matrix, which determines the long-term release kinetics. Micro-CT was used to evaluate the tissue regeneration in bone defect area, and the result showed greater bone mass in the bone defect in the TS-Mg/Sr hydrogels than in the control group, which filled up completely of the defect volume, whereas only approximately 50% of the defect volume in control groups (Figure 3B). Meanwhile, a comparison on the BMD, BV/TV, Tb.Th, Tb.N, and Tb.Sp in TS-Mg/Sr hydrogels group showed the upregulated volume at 4 weeks (Figures 3E and 3F). Except the osteogenic capacity of Mg, strontium doped material also showed 5%–10% increased new bone formation compared with a similar material without strontium.¹⁵ Mg/Sr-doped beta-TCP scaffold promoted more osteogenesis than pure beta-TCP, and the upregulated OCN and COL1A2 expression indicated the faster bone formation in vivo.²⁶ In summary, the result verified the promoting osteogenesis capacity of Mg/Sr in vivo.

Figure 3.

In vivo bone regenerative properties of TS-Mg/Sr hydrogels

(A) Schematic representation of the bone defect construction and implantation of SCAPs-laden TS-Mg/Sr hydrogel.

(B) The representative microCT images of mandibular defect repair effect of TS-Mg/Sr-1.5/1.5 and TS-Mg/Sr-blank. Scale bars, 0.5 mm.

(C) There was no difference in body weight between TS-Mg/Sr-1.5/1.5 and TS-Mg/Sr-blank.

(D and E) Micro-CT quantitative analysis demonstrated that the TS-Mg/Sr-1.5/1.5 exhibited significantly higher values for bone volume (BV/TV), bone mineral density (BMD), trabecular thickness (Tb.Th), and lower values for trabecular number (Tb.N), and trabecular separation (Tb.Sp). Each group included representative images from n = 6 samples. SCAPs: stem cells derived from the apical papilla.

Data are the means ± SD. ∗p < 0.05, ∗∗p < 0.01, and ∗∗∗p < 0.001; two-tailed unpaired Student’s t test.

TS-Mg/Sr hydrogels promote SCAPs osteogenesis via TRPM7

To further investigate the effect of Mg²⁺ and Sr²⁺ incorporation into the hydrogel system on osteogenic differentiation of SCAPs and the underlying mechanisms, we transfected SCAPs with fluorescent-labeled siRNA-TRPM7 and quantitatively evaluated TRPM7mRNA expression by RT-qPCR. The results confirmed that TRPM7 expression was significantly reduced. (Figure 4A) We analyzed the expression of osteogenic markers in vitro in blank hydrogel group, control hydrogel group, and TRPM7 knockdown hydrogel group. At the mRNA level, the expression of ALP, BMP2, OCN, and OPN increased at multiple time points (7, 14, and 21 days) after treatment of SCAPs with TS-Mg/Sr hydrogel, while the expression of TRPM7 knockdown group was significantly decreased compared with the control group (Figure 4B). ALP staining and ALP activity in the aforementioned three groups were qualitatively and quantitatively analyzed. After 7 days of culture, ALP staining showed that the expression of SCAPs in TS-Mg/Sr group was significantly higher than that in control group. Similarly, ARS staining showed a significant increase in calcium deposition, with many large massive calcium nodules with full morphology seen in the TS-Mg/Sr group (Figures 4C and 4D). These results suggest that the presence of Mg²⁺ and Sr²⁺ ions contributes to the upregulation of ALP and ARS, while TRPM7 effectively prevents the osteogenic promotion of Mg²⁺ and Sr²⁺ ions in cells. Immunofluorescence analysis showed that the expression of osteogenesis-related proteins was upregulated in the TS-Mg/Sr group, while that of TRPM7 silenced group was decreased (Figure 4E). The expression of osteogenesis-related proteins was upregulated in TS-Mg/Sr group, suggesting that the presence of Mg and Sr ions in the hydrogel enhanced the osteogenic differentiation of SCAPs and helped to improve bone tissue regeneration. In contrast, the reduced expression of these proteins in the TRPM7 silenced group highlights the critical role of TRPM7 ion channels in mediating these osteogenic effects. This finding highlights the potential therapeutic value of targeting TRPM7 in promoting bone regeneration processes and warrants further investigation of the specific mechanisms involved.

Figure 4.

TS-Mg/Sr hydrogels promote SCAPs osteogenesis via TRPM7

(A) Cells were transfected with TRPM7-specific siRNA (siTRPM7) and scramble siRNA (siNC) for 48 h, knockdown efficiency quantification showing approximately 70% reduction in TRPM7 mRNA levels upon siRNA transfection.

(B) RT-qPCR results showed that the expressions of ALP, BMP2, OCN, and OPN at 7, 14, and 21 days in SCAPs were increased after TS-Mg/Sr-1.5/1.5 hydrogel treatment. The expression of ALP, BMP2, OCN and OPN at 7, 14, and 21 days in TRPM7 knockout cells treated with TS-Mg/Sr-1.5/1.5 hydrogel decreased compared with non-knockout control cells.

(C) TS-Mg/Sr-1.5/1.5 hydrogel showed the presence of the Mg²⁺ ions and Sr²⁺ ions promoted the upregulation of ALP and ARS. Scale bars, 100 μm.

(D) While the TRPM7 silenced, quantitative ALP and Alizarin red staining decreased significantly.

Data are the means ± SD.∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001; one-way ANOVA.

(E) Immunofluorescence results indicated an increased expression of the osteogenesis related protein Col1a1 express higher in TS-Mg/Sr-1.5/1.5, which impaired after TRPM7 silence. Scale bars, 5 μm.

Discussion

Defects in the alveolar bone pose a formidable clinical challenge, necessitating the development of effective strategies to enhance bone repair. Hydrogels, such as TS hydrogel, capable of controlled ion release to facilitate stem cell osteogenic differentiation, have emerged as promising candidates in tissue regeneration owing to their unique properties. In this study, our primary objective was to investigate the potential of TS-Mg/Sr hydrogel in mandibular bone repair while elucidating the underlying mechanisms, with a specific focus on the contribution of the silk fibroin matrix.

Our findings unequivocally demonstrated a remarkable enhancement in mandibular bone repair upon the application of TS-Mg/Sr hydrogel. Notably, the silk fibroin matrix embedded within the hydrogel played a pivotal role in augmenting the survival and differentiation potential of stem cells derived from the apical papilla (SCAPs), a critical cell source indispensable for bone regeneration. The self-assembling nature of this hydrogel further facilitates its applicability in constrained spaces, such as those encountered in alveolar bone defects, and its injectable characteristics make it suitable for irregularly defects. Our results underscore the profound impact of TS-Mg/Sr hydrogel in promoting mandibular bone repair. Specifically, the silk fibroin matrix’s contribution to enhancing the survival and differentiation capabilities of SCAPs holds paramount significance in the realm of oral bone defect treatment.

This study has unveiled the promising prospects of TS-Mg/Sr hydrogel-based therapy for the treatment of oral bone defects. Furthermore, our results have shed light on the mechanistic regulation of SCAPs’ activity at the cellular level by the TRPM7 ion channel. TRPM7 (transient receptor potential melastatin 7) is a unique member of the TRP (transient receptor potential) channel family. It possesses both ion channel and kinase functions, with a kinase domain directly linked to the channel structure. Functionally, TRPM7 plays a crucial role in maintaining Mg²⁺ balance, which is indispensable for cellular survival, proliferation, migration, and differentiation across multiple cell types.²⁷ Recent studies have revealed that Mg²⁺ upregulates TRPM7 expression during the early stages of inflammation,²⁸ and TRPM7 plays a critical role in promoting osteogenesis in BMSCs.²⁹ Additionally, previous research has shown that TRPM7 deficiency impairs bone formation.³⁰ The specific activation of the TRPM7 ion channel has been shown to facilitate the release of Mg and Sr ions through a mechanism that activates downstream signaling pathways, such as nuclear factor kappa B (NF-κB) signaling pathway.³¹ This finding underscores the potential role of utilizing this ion channel in conjunction with biomaterials for the controlled release of specific ions like Mg²⁺ and Sr²⁺ in promoting bone regeneration, thus, paving the way for promising directions in future oral regenerative therapies.

Based on the existing studies, our work also employs silk fibroin materials with excellent biocompatibility to mediate ion release. Magnesium (Mg²⁺) and strontium (Sr²⁺) have been previously reported to promote bone tissue reconstruction individually.^32,33 However, the combined system of these two ions is still in its nascent stage of investigation, with unclear cellular mechanisms. Our study innovatively develops and optimizes a controlled release system for TS-Mg/Sr, elucidating an optimal biocompatible ratio for enhanced bone tissue regeneration. Additionally, injectable self-assembling materials are more suitable for irregular bone defects, such as extraction sockets. Furthermore, our research reveals the crucial role of the TRPM7 ion channel in the ion release process at the mechanistic level. This channel system effectively modulates downstream effects following TS-Mg/Sr release, laying the foundation for subsequent studies in which biomaterials and molecular biology targets collaborate to promote tissue repair and regeneration. This study holds significance not only in the realm of biomaterial design but also offers a promising direction for future biomedical research and tissue engineering.

To further elucidate the underlying mechanism governing the sustained release of Mg²⁺ and Sr²⁺ ions from the TS-Mg/Sr hydrogel, we propose a dual-mode model that integrates both passive diffusion and matrix degradation. While our degradation studies (Figure 3D) confirmed that the incorporation of divalent ions did not accelerate hydrogel decomposition, we observed a continuous release profile over 28 days that cannot be solely attributed to bulk degradation. This suggests that passive diffusion also plays a prominent role, particularly in the early phase of ion release. The silk fibroin network, reinforced by tannic acid, forms a semi-permeable hydrogel matrix with interconnected pores ranging from 100–200 μm as shown by SEM imaging (Figure 1D). Such a porous microarchitecture enables Fickian diffusion of small ions such as Mg²⁺ and Sr²⁺ along concentration gradients, a phenomenon well documented in hydrogel systems with similar mesh sizes.^34,35 This is further supported by the initial burst-like release profile observed within the first week (Figure 1C), characteristic of diffusion-controlled kinetics. Notably, the hydrogel maintained its structural stability during this period (Figure 3D), reinforcing the argument for diffusion-based transport during the early release phase. In the subsequent phase, the progressive degradation of silk fibroin—mediated by proteolytic cleavage in physiological environments—gradually increased matrix permeability and contributed to long-term ion release. This controlled degradation phase not only sustains therapeutic ion concentrations but also supports scaffold remodeling and cell infiltration, which are critical for tissue integration. Therefore, our findings support a composite release mechanism involving initial passive diffusion through a porous, intact matrix, and sustained ion liberation coupled to gradual hydrogel degradation. This dual-mode paradigm is consistent with release behaviors observed in other silk-based hydrogel systems^36,37 and underscores the rational design of TS-Mg/Sr as a spatiotemporally tunable delivery platform for bone regeneration.

The findings of this study provide valuable insights into the field of oral biomedicine, particularly in the context of treating bone defects using bioactive materials and cell therapies. The demonstrated enhancement in mandibular bone repair achieved through TS-Mg/Sr hydrogel underscores the potential of this approach as a promising therapeutic strategy for addressing oral bone deficiencies. Furthermore, the identification of the regulatory role of the TRPM7 ion channel in modulating SCAPs’ activity offers significant avenues for understanding the intricate cellular mechanisms involved in bone regeneration. These discoveries not only contribute to advancing the field of regenerative medicine but also hold promise for the development of innovative oral regenerative therapies. Ultimately, these insights have the potential to improve the clinical outcomes and overall quality of life for individuals with oral bone defects, highlighting the importance of continued research in this area. Future investigations should focus on refining and translating these findings into clinically applicable treatments, ultimately benefitting a broader patient population.

In conclusion, this study demonstrates the remarkable efficacy of TS-Mg/Sr hydrogel in promoting mandibular bone repair, with a specific emphasis on the pivotal role played by the silk fibroin matrix. Moreover, our findings elucidate the cellular-level regulation of SCAPs activity through the TRPM7 ion channel, suggesting its potential in bone regeneration. These discoveries offer promising avenues for the development of innovative approaches in oral bone defect therapy, ultimately enhancing the quality of life for individuals suffering from such conditions. Future research should continue to explore the translational potential of these insights and their clinical applications.

Limitations of the study

While the study highlights the potential of TS-Mg/Sr hydrogel in oral bone defect therapy, it is important to acknowledge certain limitations. Further research is needed to assess the long-term clinical efficacy and safety of the TS-Mg/Sr hydrogel in clinical applications. Additionally, the investigation into the role of the TRPM7 channel primarily relied on in vitro experiments, and more direct insights into TRPM7-mediated ion metabolism in stem cell osteogenic differentiation could be obtained through in vivo experiments, such as conditional knockout mouse models. Furthermore, while degradation-mediated ion release was experimentally supported by mass loss measurements showing progressive hydrogel erosion, the contribution of passive diffusion remains indirectly inferred. This inference is based on the observed porous microstructure and cumulative ion release profiles rather than direct experimental measurements of diffusion flux or real-time tracking of ion transport through the hydrogel network. These limitations should be considered and addressed in future studies.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dr. Yang Yue (yangyue200455@outlook.com).

Materials availability

All unique/stable reagents generated in this study are available from the lead contact without restriction.

Data and code availability

• •The data reported in this paper will be shared by the lead contact upon request.
• •This paper does not report original code.
• •Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Acknowledgments

This work was supported by grants from the National Key R&D Program of China (grant number 2022YFC2402900, 2020YFA0710401, and 2022YFB3804300); the National Natural Science Foundation of China (grant numbers 82221003, 82071161, U22A20160, 82100979, 82430033, and 82225012); and Beijing Municipal Science & Technology Commission (221100007422088).

Author contributions

C.C., Z.G., Y.L., T.Z., and H.Z. performed the cell experiments, animal experiments, and analyzed data. Y.W. provided valuable input in drafting the manuscript and participated in sequence alignment. C.C., Z.G., S.J., and Y.Y. analyzed data and wrote the paper. Y.Y. conceived the study and led and managed the project. We would also like to express our appreciation to all authors for their thorough review of the final manuscript. All authors read and approved the final manuscript.

Declaration of interests

The authors declare no competing interests.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-F-actin antibody	Abcam	Cat# ab205; RRID: AB_302794
Collagen Type I Monoclonal antibody	Proteintech	Cat# 67288-1-Ig; RRID: AB_2882554
Goat anti-mouse IgG (H + L) Alexa Fluor 488	Abcam	ab150115; RRID: AB_2687948
Critical commercial assays
PrimeScript RT reagent kit	Takara	Cat# RR037A
SYBR Premix Ex Taq II kit	Takara	Cat# RR820A
Calcein-AM/PI live/dead cell dual staining kit	Solarbio	Cat# CA1630
Cell counting kit 8	Dojindo	Cat# CK04
Experimental models: Cell lines
SCAPs	ORAL STEM CELL BANK (Beijing Tason Biotech Co., Ltd.)	N/A
Experimental models: Organisms/strains
C57 mice	Peking University Health Science Center Department of Laboratory Animal Science	Ethical Approval Document:LA2024295
Oligonucleotides
si TRPM7 (ID: 54822)	GenePharma	N/A
Software and algorithms
CTvox	Bruker	N/A
CTvol	Bruker	N/A
GraphPad Prism	GraphPad	N/A
ImageJ	https://ImageJ.net/	RRID: SCR_003070
Other
GeminiSEM 300	ZEISS	N/A
ICP-OES 5110	Agilent	N/A
NanoDrop 2000	Thermo Fisher	N/A
Orthotopic confocal microscopy (TCS SP8)	Leica	N/A
Skyscan 1276	Bruker	N/A
HAAKE MARS	Thermo Fisher	N/A
AVANCE II 400	Bruker	N/A

Experimental model and study participant details

Cell culture

SCAPs were provided by ORAL STEM CELL BANK (Beijing Tason Biotech Co.,Ltd.). Briefly, SCAPs were cultured in α-minimal essential medium (α-MEM; Procell, Wuhan, China) supplemented with 10% of fetal bovine serum (Gibco, Thermo Fisher, New York, NY, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin before the experimental intervention. Cells from passages 3 to 5 were used, and osteogenic induction was carried out when cells reached 70%–90% confluence.

Animals and surgical procedures

All animal experiments were conducted in strict compliance with the Animal Ethics Committee of Peking University, following the approved guidelines (IACUC number LA2024295). The following procedures were performed on male C57 mice (Peking University Health Science Center Department of Laboratory Animal Science). After a one-week acclimation period, the mice were randomly assigned to one of the experimental groups (TS-Blank, and TS-Mg/Sr-1.5/1.5) at n = 6 for each group at each time point. A circular hole measuring 1.2 mm in diameter was carefully drilled into the mandibular bone. Subsequently, TS-Mg/Sr-1.5/1.5 was implanted into the hole, and the area was tightly sutured. After a period of 4 weeks, the mice were sacrificed in order to obtain their alveolar bone for further assessments.

Method details

Preparation of TS-Mg/Sr

Silk fibroin (SF) was extracted from cocoons according to previous reports.³⁸ Briefly, Bombyx mori cocoons were boiled in 0.02 M sodium carbonate for 1 h and rinsed with Milli-Q (MQ) water to remove the sericin. The steps above were repeated three times. Extracted silk fibroin was dried at 37 °C overnight, and then, dissolved in 9.3 M lithium bromide aqueous solution at 60 °C for 4 h. The solution was dialyzed in ultra-pure water for 36 h to remove the salt, and concentrated against 20% (w/v) PEG for 36 h to obtain a final SF concentration of 20 wt %.

Different amounts of MgCl2 (Sigma Co.,Ltd, USA) and SrCl2 (Sigma Co.,Ltd, USA) were dissolved in SF solution (20 wt %) to gain SF solutions with different divalent metal salt concentrations (Mg²⁺ 3 mM, Mg²⁺ 2 mM and Sr²⁺ 1 mM, Mg²⁺ 1.5 mM and Sr²⁺ 1.5 mM, Mg²⁺ 1 mM and Sr²⁺ 2 mM, and Sr²⁺ 3 mM). TS-Mg/Sr hydrogel were formed by mixing SF solution with different ratios of metal salt and TA solution (25 wt % in PBS) according to fixed ratios of TA/SF: 1:1 and shaking. Then the hydrogels were freeze-dried immediately after formation for the SEM observation.

Oscillatory rheometer frequency scanning

Dynamic oscillatory frequency sweeps were performed using a strain-controlled rotational rheometer (HAAKE MARS;Thermo Fishe,USA) equipped with parallel plate geometry (diameter: 20 mm; gap: 1.0 mm). Samples were loaded at 25°C following 5-min thermal equilibration, with solvent trap applied to prevent evaporation. Prior to frequency sweeps, linear viscoelastic region (LVE) was confirmed through amplitude sweeps (0.1–100% strain at 10 rad/s). Frequency-dependent viscoelastic properties were then characterized under constant strain (1%, within LVE) across angular frequency range 0.1–100 rad/s. Storage modulus (G′), loss modulus (G″) were recorded at 7 data points. Three independent replicates were analyzed for each formulation.

Nuclear magnetic resonance (NMR) spectra

Blank silk hydrogel and silk hydrogel samples containing Mg and Sr elements were prepared for analysis. The NMR spectra were acquired for the samples using the 1H-NMR equipment and settings (AVANCE II 400; Bruker, Switzerland).

Ion release tests

For quantifying ion release, hydrogel samples (0.4 mL) from each group were immersed in 1.2 mL of either 1× PBS or α-MEM. At time points of 3 h and 3, 6, 10, 12, 16, 18, 21, 23, and 28 days, 0.5 mL of the solution was extracted and diluted to 10 mL with MQ water. This diluted solution was then subjected to ion concentration measurement, including magnesium, silicon, and strontium, using inductive coupled plasma optical emission spectrometry (ICP-OES, Agilent, USA). The solutions were replenished at each time point. The cumulative ion concentrations at each time point allowed us to determine the total amount of each ion released. Four hydrogel samples were used for each group and solution, minimizing repetition and ensuring robust results.

Scanning electron microscopy (SEM)

TS-Mg/Sr hydrogels with five different volume ratios were freshly prepared and flash frozen in liquid nitrogen. After lyophilization, these samples were fractured, gold sputtered and scanned with SEM equipment (GeminiSEM 300; ZEISS, Germany). All data were analyzed by ImageJ software on SEM images of at least five independent samples, and 10 randomly selected pore size regions per sample were counted and finally presented as “mean ± SD”

Cell cytotoxicity assay

We encapsulate SCAPs in a pre-gel solution of TS-Mg/Sr hydrogel to allow the hydrogel to solidify under physiological conditions to create a 3D culture environment. After culturing in the hydrogel for 7 days, the SCAPs were seeded in 96-well plates and cultured for 24 h. Then, the culture medium was replaced by 100 μL of conditioned medium and cultured for 24 h. The culture medium was used as a blank control. Cell viability was measured by a cell counting kit 8 (CCK-8) (Dojindo, Japan) assay according to the manufacturer’s instructions. For calcein-AM/propidium iodide (PI) double staining, after washed with PBS for 2 times, the SCAPs were incubated with the mixture of dye (2 μL calcein-AM and 3 μL PI in 1 mL α-MEM) for 15 min at 37°C. Red and green signal indicated the apoptotic cells and alive cells, respectively.

Osteogenic induction

Osteogenic induction was carried out by culturing cells in osteogenic differentiation medium (Cyagen Biosciences), and performed as previously described.³⁹ The culture medium was changed every 3 days.

ALP and alizarin red S (ARS) staining

The SCAPs were then washed twice in PBS, fixed with 4% (w/v) paraformaldehyde for 15 min, and then stained with ALP staining solution (Beyotime) after 7 days of induction, or stained with ARS staining solution (Cyagen Biosciences) after 21 days of induction according to the manufacturer’s instructions.

RT-qPCR

Total RNA was extracted from SCAPs using TRIzol reagent (Invitrogen). The absorbance of the RNA was measured at 260 nm (NanoDrop 2000). The RNA was reverse-transcribed using the PrimeScript RT kit (Takara). The RT-qPCR was conducted in optical 96-well reaction plates (Thermo Fisher Scientific) with a final volume of 20 μL.

The RT-qPCR performed with the SYBR Premix Ex Taq II kit (Takara). Melting curves were used to confirm primer specificity, and the 2−ΔΔCt method was used to calculate target gene expression levels. All values were normalized to GAPDH. All used primers were listed as below:

Gene Sequence

• RUNX2 Forward 5′- CGGAATGCCTCTGCTGTTA -3′

• Reverse 5′- GCTTCTGTCTGTGCCTTCT -3′

• ALP Forward 5′- CCGTGGCAACTCTATCTT -3′

• Reverse 5′- TACAGGATGGCAGTGAAG -3′

• BMP2 Forward 5′- GAGGTCCTGAGCGAGTTC -3′

• Reverse 5′- CTGAGTGCCTGCGATACA -3′

• OCN Forward 5′- TCACACTCCTCGCCCTATTG -3′

• Reverse 5′- CTGGGTCTCTTCACTACCTC -3′

• OPN Forward 5′- CAATGATGAGAGCAATGAG -3′

• Reverse 5′- GTCTACAACCAGCATATCT -3′

• GAPDH Forward 5′- AAGACGGGCGGAGAGAAACC -3′

• Reverse 5′- CGTTGACTCCGACCTTCACC -3′

Hydrogel degradation rate measurement

The degradation behavior of TS-Blank, and TS-Mg/Sr-1.5/1.5 hydrogels was evaluated using a gravimetric method. Briefly, hydrogels (n = 5 per group) were freeze-dried to determine their initial dry weight (W₀). Samples were then immersed in PBS (pH 7.4, 37°C) under sterile conditions to simulate physiological environments. At predetermined time points (7, 14, 21, and 28 days), hydrogels were retrieved, rinsed with deionized water to remove soluble residues, lyophilized to constant weight, and reweighed (W_t). The degradation rate was calculated as:Degradation (%) = [(W₀− W_t)/W₀]×100. To ensure reproducibility, PBS was refreshed every 48 h, and temperature was maintained at 37 ± 0.5°C.

Micro-computed Tomography (micro-CT) Scanning

The specimens were harvested and fixed in 4% (w/v) paraformaldehyde for 24 h at room temperature. The specimens were then examined using the Bruker Skyscan 1276 (Germany) with a resolution protocol of 21.2 μm (voltage: 100 kV; current: 200 μA; Cu filter; integration time: 1500 ms). The micro-CT images were reconstructed using CTvox software. The bone mineral density (BMD), bone volume/tissue volume ratio (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp) were determined from 3-dimensional (3D) micro-CT images.

Immunofluorescence analysis

Samples were rinsed with PBS and fixed in 4% (w/v) paraformaldehyde for 15 min. Then, samples were permeabilized with 0.1% (w/v) Triton X-100 (diluted with PBS) for 10 min and blocked with 3% (w/v) bovine serum albumin (BSA; diluted with PBS) for 1 h, followed by incubation with the primary antibodies against F-actin (1:200; ab205; Abcam), and Col1a1 (1:200; 67288-1-Ig; Proteintech) in 3% (w/v) BSA overnight at 4 °C. The next day, after thorough removing excess antibodies, the cells were incubated with fluorophore-conjugated secondary antibodies for 1 h in darkness. 4′,6-Diamidino-2-phenylindole (DAPI; 1:1000, Sigma, USA) was used to stain cellular nuclei. Images of three random fields of vision were captured with a confocal laser scanning microscope (Leica).

Small interfering RNA (siRNA) production and transfection

The siRNA encoding transient receptor potential melastatin 7 (TRPM7) was purchased from GenePharma Co., Ltd (siTRPM7, AACCGGAGGTCAGGTCGAAAT). For gene silencing experiments, SCAPs were seeded in 12-well plates at 1 × 10⁵ cells/well 1 day before transfection. The siRNA molecules were transfected into SCAPs with 60–80% confluence using Lipofectamine 2000 reagent (#11668019; Invitrogen, USA) following the manufacturer’s instructions.

Quantification and statistical analysis

Statistical analysis

All values are presented as mean ± SD. Statistical analyses were performed using Prism software v10.1.2 (GraphPad, La Jolla, CA, USA). For 2-group comparisons, the significant difference was analyzed by Student’s t test, and for multi-group comparisons, one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons tests were used. p < 0.05 was considered significant.

Published: August 14, 2025