Puerariae radix flavones induce apoptosis in bladder cancer T24 cells via the FAS/TNFR1 pathway: A potential therapeutic candidate

Abstract

Puerariae radix flavones (PRFs), bioactive components derived from the Pueraria lobata plant, exhibit anti-inflammatory and anti-tumor properties. However, their therapeutic potential for bladder cancer remains poorly understood. The present study aimed to investigate the anti-tumor effects and molecular mechanisms underlying the effects of PRF on human bladder cancer T24 cells. In vitro experiments were performed out in PRF-treated T24 cells, and the effects of PRF were assessed through MTT assay, acridine orange/ethidium bromide staining, agarose gel electrophoresis, reverse transcription-quantitative PCR and ELISA. PRF significantly inhibited T24 cell proliferation via inducing apoptosis through the extrinsic apoptosis pathway. Mechanistically, PRF induced FAS receptor/tumor necrosis factor-α receptor, enhanced the activity of cysteinyl aspartate-specific protease-3 and downregulated NF-κB. To the best of our knowledge, the present study is the first to demonstrate that PRF could suppress the proliferation of human bladder cancer T24 cells and to elucidate its underlying molecular mechanism. These findings may provide novel insights into PRF as a promising therapeutic agent for bladder cancer treatment.

Introduction

Bladder cancer (BC) is one of the most prevalent malignancies globally, with an estimated 613,791 new cases reported in 2022 according to GLOBOCAN 2022(1). Clinically, BC is categorized into three main subtypes, namely non-muscle-invasive (NMI), MIB and metastatic BC (2). While NMIBC accounts for ~80% of initial BC diagnoses and is associated with a favorable 5-year survival rate >90% (3), it has a 1-year recurrence rate of 15-61%, and a 5-year recurrence rate of 31-78% (4). Its high recurrence rate imposes substantial healthcare burdens (5-9). By contrast, MIBC and metastatic BC, accounting for ~25% of all diagnoses, are associated with aggressive progression and poorer prognosis (10). Disparities in BC outcomes are associated with ethnicity, sex and socioeconomic factors (11-16). Management strategies for NMIBC and MIBC include transurethral resection combined with intravesical therapies, such as mitomycin C and Bacillus Calmette-Guérin (17-21), and platinum-based neoadjuvant chemotherapy followed by radical cystectomy, respectively (10,22). However, chemotherapy resistance and toxicity underscore the need for more safe and effective therapeutic agents (22).

Pueraria spp. (Leguminosae), notably P. lobata and P. thomsonii, are medicinal plants that are widely distributed in East Asia. The 2020 edition of the Chinese Pharmacopoeia recognizes the dried roots (radix) of Pueraria as a source of bioactive compounds, particularly isoflavonoids such as puerarin, which are the primary active components of Puerariae radix flavones (PRF) (23-43). Previous studies demonstrated that PRF exhibit multifaceted pharmacological properties, such as anti-cancer effects, in colon (HT-29 cells), cervical (HeLa cells), liver (SMMC-7721 cells) and breast cancer (HS578T, MDA-MB-231 and MCF-7 cells), acute promyelocytic leukemia (NB4 cells), neuroblastoma (SHSY5Y cells), pancreatic carcinoma (BxPC-3 cells) and lung cancer (A549 cells) (44-48). Despite these findings, the anti-tumor activity of PRF against BC remains unexplored.

T24 cells serve as the preferred model for research on invasion, metastasis and drug resistance mechanisms in BC. Their intrinsic cisplatin resistance (49) makes T24 cells a classical system for exploring drug mechanisms of action (50) that are widely used in fundamental BC research (51,52). Moreover, in natural compound anticancer mechanism studies, most researchers employ single-cell models to investigate mechanisms of action (47,50). Therefore, the present study investigates the effects of PRF on human bladder cancer T24 cells and its underlying molecular mechanisms.

Materials and methods

Drug preparation and cell culture

PRF (Taobao; purity ≥80%) was dissolved in anhydrous ethanol to prepare an 8,000 µg/ml stock solution, which was stored at 4˚C. T24 cells (Procell Life Science & Technology Co., Ltd.) were authenticated by STR profiling (Mayo Clinic Cytogenetics Core) and confirmed to be free of mycoplasma contamination. Cells were cultured in RPMI-1640 (Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Shanghai VivaCell Biosciences, Ltd.) at 37˚C in a humified atmosphere with 5% CO₂. Cells were maintained at a density of <1x10⁶ cells/ml and used within three passages.

MTT assay

Cells (5x10³/well) in 200 µl medium were treated with 0, 25, 50, 100 and 200 µg/ml PRF at 37˚C for 24 or 48 h. Following treatment with MTT reagent (Sigma-Aldrich, Merck KGaA), cells were incubated at 37˚C for an additional 4 h. Finally, the absorbance at 490 nm was measured using a microplate reader.

Acridine orange/ethidium bromide (AO/EB) fluorescence staining

Following treatment with 0-200 µg/ml PRF at 37˚C for 24 or 48 h, T24 cells were stained with AO/EB (Sigma-Aldrich, Merck KGaA) in the dark at room temperature for 5 min. Images were captured under a fluorescence microscope (magnification, x200).

DNA ladder assay

Following incubation with PRF (0, 50, 100 and 200 µg/ml) at 37˚C for 24 or 48 h, 1x10⁶ T24 cells were collected. Subsequently, genomic DNA was extracted from untreated and PRF-treated cells using the Apoptosis DNA Ladder Extraction kit (cat. no. #C0007; Beyotime Institute of Biotechnology) according to the manufacturer's instructions. Finally, 5 µl DNA (containing 1 µg DNA) was mixed with 6X Loading Buffer and loaded onto a 1% agarose gel prepared in TBE buffer containing 0.5 µg/ml ethidium bromide (EB; Thermo Fisher Scientific, Inc.). Electrophoresis was performed at a constant voltage of 100 V for 30 min. DNA bands were visualized under UV irradiation (302 nm) using a gel imaging system. Caution: Ethidium bromide is a mutagenic agent. All procedures were conducted with nitrile gloves, and waste was disposed as hazardous material.

Reverse transcription-quantitative (RT-q)PCR

Following the manufacturer's protocols, total RNA was extracted from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and reverse-transcribed into cDNA using the Transcriptor First Strand cDNA synthesis kit (cat. no. #4897030001; Roche Diagnostics). cDNA amplification was performed in triplicate with the FastStart Universal SYBR Green Master (ROX) kit (cat. no. #4913850001; Roche Diagnostics) on an ABI Prism 7500 system (Thermo Fisher Scientific, Inc.). The primer sequences for BCL2, BAX, FAS receptor (FAS), FAS ligand (FASL), tumor necrosis factor receptor 1 (TNFR1), tumor necrosis factor-α (TNF-α), cysteinyl aspartate-specific protease-3 (CASP3), NF-κB and GAPDH are listed in Table I. The primers were designed and synthesized by Sangon Biotech Co., Ltd.

Table I.

Primer sequences for reverse transcription-quantitative PCR.

Gene	Primer sequence, 5'→3'	Product length, bp
GAPDH	F:GCATCCTGGGCTACACTG	103
	R:TGGTCGTTGAGGGCAAT
BAX	F:CGGAACTGATCAGAACCATCA	97
	R:AGGAGTCTCACCCAACCA
BCL2	F:GTGGATGACTGAGTACCTGAAC	125
	R:GAGACAGCCAGGAGAAATCAA
CASP3	F:CTCCACAGCACCTGGTTATT	106
	R:AAATTCAAGCTTGTCGGCATAC
NF-kB	F:GGTGCGGCTCATGTTTACAG	85
	R:GATGGCGTCTGATACCACGG
TNFR1	F:CTCCAAATGCCGAAAGGAAATG	100
	R:ATAATGCCGGTACTGGTTCTTC
TNFα	F:CCAGGGACCTCTCTCTAATCA	106
	R:TCAGCTTGAGGGTTTGCTAC
FAS	F:GTGATGAAGGACATGGCTTAGA	115
	R:GGGTCACAGTGTTCACATACA
FASL	F:CATTTAACAGGCAAGTCCAACTC	105
	R:CACAAGGCCACCCTTCTTAT

F, forward; R, reverse.

The thermocycling conditions were as follows: Initial denaturation at 50˚C for 2 min and 95˚C for 10 min, followed by 45 cycles of 95˚C for 15 sec and 60˚C for 1 min. The relative mRNA expression levels were calculated using the 2^-ΔΔCq method (53).

ELISA

Following incubation with PRF (0, 50, 100 and 200 µg/ml) at 37˚C for 24 or 48 h, cells and culture medium were collected. The protein expression levels of FAS and TNF-α were quantified in T24 cells and culture supernatant using the corresponding ELISA kits (cat. nos. #JL14207 and #JL10208, respectively; both Shanghai Future Industrial Co., Ltd.) according to the manufacturer's instructions.

Statistical analysis

All data were analyzed using SPSS Statistics (version 25; IBM Corporation) or GraphPad Prism (version 8.1; GraphPad Software, Inc.; Dotmatics). Experiments were performed in triplicate, and all data are presented as the mean ± SD. Data were analyzed using two-way repeated-measures ANOVA followed by Dunnett's post hoc tests. P<0.05 was considered to indicate a statistically significant difference.

Results

PRF inhibits the viability of T24 cells

MTT assay demonstrated that PRF could significantly inhibit the viability of T24 cells in a time- and dose-dependent manner (Fig. 1A). The inhibition rate in cells treated with 200 µg/ml PRF for 12 h was significantly higher compared with that in the control group (Fig. 1A). Additionally, the inhibition rates of cells exposed to 50, 100 and 200 µg/ml PRF for 24 h were all increased compared with the control group. Consistently, at 48 and 72 h, the inhibition rates in the 100 and 200 µg/ml PRF-treated groups were significantly higher compared with the control group. PRF exhibited a clear dose- and time-dependent inhibitory effect on cell viability, with inhibition increasing with enhanced concentration and exposure duration (Fig. 1B). Significant differences in inhibition rates were observed between time points (12, 24, 48 and 72 h).

Figure 1.

Inhibitory effect of PRF on bladder cancer T24 cells. (A) Inhibitory rate of each PRF treatment group on cell viability at each time point. ^*P<0.05. (B) At each time point, the cell viability inhibition rate exhibited a concentration-dependent increase with PRF. PRF, Puerariae radix flavone.

Morphological changes in T24 cells treated with PRF

AO/EB staining revealed distinct apoptotic progression in T24 cells (Fig. 2). Increasing PRF concentrations induced a progressive fluorescence shift from green to orange-red emission. Morphologically, cells progressed from intact plasma membranes with uniform chromatin distribution to display early apoptotic hallmarks (cellular shrinkage, nuclear condensation, and apoptotic body formation) and late-stage apoptosis typified by membrane rupture, chromatin fragmentation, and nuclear dissolution. Control cells exhibited a uniform green staining (Fig. 2A and E). However, 50 µg/ml PRF induced early apoptotic features, such cell shrinkage, condensed nuclei and apoptotic bodies (Fig. 2B and F). Additionally, higher PRF concentrations (100-200 µg/ml) induced features of late apoptosis, including enhanced membrane permeability, chromatin fragmentation (orange/red staining) and nuclear disintegration (Fig. 2C, D, G and H). Notably, 100-200 µg/ml PRF exposure for 24-48 h promoted concentration- and time-dependent morphological alterations, characteristic of late-stage apoptosis.

Figure 2.

Acridine orange/ethidium bromide staining of T24 cells exposed PRF. (A) Control for 24 h, the yellow arrow indicates viable T24 cells exhibiting green fluorescence with intact plasma membranes. (B) 50 µg/ml and 24 h, yellow arrow indicates early apoptotic cells demonstrating green fluorescence with punctate orange-red fluorescence, along with characteristic morphological changes including cell shrinkage, nuclear condensation, and apoptotic body formation. (C) 100 µg/ml and 24 h, yellow arrow indicates apoptotic cells in early and late stages, exhibiting green fluorescence accompanied by orange-red fluorescence. Early-stage cells show apoptotic body formation, while late-stage cells display plasma membrane disintegration, chromatin fragmentation, and diffuse nuclear orange-red fluorescence. (D) 200 µg/ml and 24 h, the yellow arrow indicates late apoptotic cells exhibiting orange-red fluorescence, characterized by chromatin fragmentation and nuclear disintegration. (E) Control and 48 h, the yellow arrow indicates viable T24 cells exhibiting green fluorescence with intact plasma membranes. (F) 50 µg/ml and 48 h, yellow arrow indicates early apoptotic cells demonstrating green fluorescence with punctate orange-red fluorescence, along with characteristic morphological changes including cell shrinkage, nuclear condensation, and apoptotic body formation. (G) 100 µg/ml and 24 h, yellow arrow indicates apoptotic cells in early and late stages, exhibiting green fluorescence accompanied by orange-red fluorescence. Early-stage cells show apoptotic body formation, while late-stage cells display plasma membrane disintegration, chromatin fragmentation and diffuse nuclear orange-red fluorescence. (H) 200 µg/ml and 48 h, the yellow arrow indicates late apoptotic cells exhibiting orange-red fluorescence, characterized by chromatin fragmentation and nuclear disintegration. Magnification, x200. PRF, Puerariae radix flavone.

Assessment of DNA fragmentation in T24 cells following PRF treatment

The DNA ladder assay showed no apoptotic fragmentation in T24 cells treated with PRF (0-200 µg/ml) for 24-48 h, thus suggesting that PRF-induced apoptosis was triggered via a DNA fragmentation-independent pathway (Fig. 3).

Figure 3.

Fragmentation of genomic DNA in T24 cells treated with PRF at concentrations of 0, 50, 100, and 200 µg/ml for 24 or 48 h. Compared with the 0 µg/ml PRF group, no significant changes were observed in the other treatment groups, and no characteristic DNA ladder was detected. PRF, Puerariae radix flavone.

PRF modulates the expression of apoptosis-related genes

RT-qPCR demonstrated that treatment with 100 or 200 µg/ml PRF for 24 h upregulated FAS (2.0- and 2.3-fold, respectively), FASL (48.9- and 15.2-fold, respectively), TNF-α (1.4- and 2.2-fold, respectively) and CASP3 (2.1- and 1.8-fold, respectively; Fig. 4A-C and E). However, the expression of TNFR1 only significantly increased in cells treated with 200 µg/ml PRF (1.2-fold; Fig. 4D). No significant changes were observed in the mRNA expression of NF-κB, BCL-2 and BAX (Fig. 4F-H). Additionally, treatment with PRF for 48 h slightly upregulated FAS at 100 and 200 µg/ml (1.3- and 1.2-fold, respectively; Fig. 4A), and markedly upregulated TNF-α at 200 µg/ml (1.6-fold; Fig. 4C). By contrast, FASL (0.5-fold at 100 µg/ml), TNFR1 (0.8-fold at 200 µg/ml), and NF-κB (0.8- and 0.6-fold at 100 and 200 µg/ml, respectively) were significantly downregulated (Fig. 4B, D and F). No significant alterations were detected in the mRNA expression of CASP3, BCL-2 and BAX (Fig. 4E, G and H).

Figure 4.

Effects of PRF on the expression of apoptosis-related genes in T24 cells. T24 cells were treated with PRF (0, 50, 100 and 200 µg/ml) for 24 or 48 h. The mRNA levels of (A) FAS, (B) FASL, (C) TNFα, (D) TNFR1, (E) CASP3, (F) NF-κB, (G) BCL2 and (H) BAX were assessed by quantitative PCR (normalized to GAPDH). ^*P<0.05. PRF, Puerariae radix flavones; CASP3, cysteinyl aspartate-specific protease-3.

PRF modulates the protein expression of FAS and TNF-α

ELISA showed that treatment with PRF for 24 h resulted in a dose-dependent increase of intracellular FAS and TNF-a protein levels (50-200 µg/ml; Fig. 5A and C). By contrast, the secreted levels of FAS were reduced in the culture supernatant (50-200 µg/ml; Fig. 5B). In addition, the secreted levels of TNF-α were elevated only at 50 µg/ml (Fig. 5D). Furthermore, T24 cell exposure to PRF for 48 h dose-dependently increased the intracellular and secreted levels of FAS (50-200 µg/ml; Fig. 5A and B). However, intracellular and secreted TNF-α levels were only significantly elevated at 50 µg/ml (Fig. 5C and D).

Figure 5.

PRF regulates intracellular and secreted levels of FAS and TNF-α in T24 cells. T24 cells were exposed to PRF (0, 50, 100 or 200 µg/ml) for 24 or 48 h. (A) FAS levels in cell lysate (intracellular proteins). (B) Secreted FAS levels in conditioned medium. (C) TNF-α levels in cell lysates (intracellular proteins). (D) Secreted TNF-α levels in conditioned medium. Protein quantification was performed by ELISA. ^*P<0.05. PRF, Puerariae radix flavone.

Discussion

The present study demonstrated that treatment with PRF for 24 and 48 h significantly inhibited T24 cell viability in a dose- and time-dependent manner, with the most pronounced effects observed at 100 and 200 µg/ml. The ability of PRF to promote T24 cell apoptosis was shown by flow cytometry in our previous study (54). Here, morphological examination revealed characteristic apoptotic features, including early-stage membrane shrinkage and late-stage apoptotic body formation. Notably, the absence of DNA laddering suggested that PRF induced apoptosis via a non-canonical DNA fragmentation pathway. Although no direct evidence currently demonstrates PRF-induced apoptosis via this mechanism in other cancer cells, it is hypothesized that negative DNA fragmentation results may contribute to the underreporting of such findings. Consistent with this observation, our team previously demonstrated flavonoid compounds extracted from Galium verum L. likewise yield negative DNA fragmentation results when inducing apoptosis in HepG2 hepatocellular carcinoma cells (unpublished data). The hypothesis that PRF induces apoptosis through non-classical DNA fragmentation pathways is based on the T24 cell model. To the best of our knowledge, the present study is the first to report a non-canonical DNA fragmentation route during PRF-induced apoptosis in T24 cells.

PRF treatment significantly upregulated FAS, FASL, TNFR1, TNFα and CASP3 in T24 cells, while NF-κB was downregulated. mRNA expression levels of both BCL2 and BAX remained unchanged, indicating that PRF-mediated apoptosis in T24 cells may involve the coordinated regulation of FAS, FASL, TNFR1, TNFα, CASP3 and NF-κB expression dynamics (Fig. 6).

Figure 6.

Mechanism of apoptosis. Apoptotic signaling primarily occurs via two pathways: the extrinsic death receptor pathway and the intrinsic mitochondrial pathway. In T24 cells, PRF induces apoptosis predominantly by activating FAS and TNFR1, thereby initiating the death receptor pathway. This ultimately leads to the activation of CASPASE3, resulting in characteristic biochemical and morphological changes characteristic of programmed cell death. Concurrently, NF-κB participates in the regulation of this apoptotic pathway. TNFR, tumor necrosis factor receptor; TRAF, TNFR-Associated Factor; TRADD, TNFR-associated death domain; RIP, receptor-interacting protein; IKK, IκB kinase; tBid, truncated Bid; PRF, Puerariae radix flavone.

Binding of FASL to its receptor induces receptor trimerization and activation (55,56). Subsequently, activated FAS can recruit Fas-associated death domain (FADD), which undergoes conformational changes that allow it to bind and cleave procaspase-8, promoting the formation of the death-inducing signaling complex (DISC). Within this complex, activated caspase-8 propagates the apoptotic cascade via cleaving and activating caspase-3 (55,56). Here, the pronounced upregulation of FAS, FASL and CASP3, accompanied by the increased intracellular FAS protein levels, supported the activation of the extrinsic apoptotic pathway. Protein expression levels of FAS were markedly decreased in cell supernatant following treatment with PRF for 24 h, and significantly elevated at 48 h. During early apoptosis, FAS proteins may aggregate and bind to the plasma membrane, leading to elevated intracellular FAS levels. In late apoptosis, loss of plasma membrane integrity may facilitate the release of membrane-bound FAS proteins into the culture medium in a soluble form (57-59), resulting in the observed increase in soluble FAS protein levels at 48 h.

DISC-associated caspase-8 can undergo auto-proteolysis to activate caspase-8, which cleaves interacting domain death agonist (Bid) into truncated (t)Bid (56,60). tBid can translocate to mitochondria, thus perturbing the equilibrium between pro-apoptotic and anti-apoptotic Bcl-2 family members (60-62). However, the lack of alterations in the mRNA expression levels of BCL2 and BAX indicated that the PRF-induced cell apoptosis may occur independently of the mitochondrial pathway. Nandana et al (50) confirmed that Brucein D (a bioactive quassinoid compound isolated from Brucea javanica fruit) induces apoptosis in T24 cells by regulating the Bcl-2/Bax pathway, exhibiting the classical DNA ladder feature. Conversely, the typical DNA laddering would not be expected in apoptotic mechanisms independent of the Bcl-2/Bax pathway. This was further reinforced by the absence of characteristic DNA ladder fragmentation, supporting extrinsic apoptotic pathway involvement.

In parallel with the FAS pathway, TNFα binding to TNFR1 disrupts its interaction with the inhibitory protein silencer of death domains, enabling the recruitment of TNF receptor-associated death domain (TRADD) through the intracellular death domain (63-67). TRADD interacts with FADD, activating procaspase-8 to caspase-8, which cleaves caspase-3. In the present study, the concurrent upregulation of TNFR1, TNFα and CASP3 further supported the involvement of this TNFα-driven apoptotic mechanism. In addition, the significant elevation of the TNF-α protein expression demonstrated that TNF-α may be involved in PRF-induced apoptosis in BC cells.

TRADD recruits TNFR-associated factor 2 and receptor-interacting serine/threonine-protein kinase 1, leading to the activation of the IKK complex, which degrades IκB (63,64). This process can promote the release of NF-κB, allowing its nuclear translocation and the subsequent transcription of pro-survival genes (63,64). Paradoxically, the present NF-κB downregulation indicated that PRF may suppress this survival signaling axis, thus shifting the cellular balance toward apoptosis. Although this interaction may be indirect, the inverse association between NF-κB suppression and caspase activation may provide evidence for the pro-apoptotic effects of PRF.

NF-κB exhibits biphasic regulation (68). NF-κB upregulation promotes cellular survival via transcription of pro-survival genes (63,64). However, its pathological hyperactivation promotes tumor progression and chemoresistance through the upregulation of anti-apoptotic factors and activation of survival signaling (69,70). By contrast, crosstalk between TNF-α and FAS could promote the establishment of a compensatory apoptotic axis by amplifying the activation of caspase-8 and -3, thus counteracting NF-κB-mediated cytoprotection (71). In the present study, PRF led to a biphasic modulation of NF-κB, which was characterized by transient upregulation at 24 h followed by downregulation at 48 h. The aforementioned finding was consistent with context-dependent biphasic NF-κB regulation, implicating NF-κB in PRF-induced apoptosis. These results indicated a dual role for NF-κB in T24 cells, acting as both a pro-survival mediator and a stress-responsive modulator of apoptosis.

The present study had limitations. Firstly, the antitumor effects of PRF were not validated through in vivo animal experiments. Secondly, the findings were verified solely in the T24 cell line without replication in other BC cell lines, thereby restricting the generalizability of the conclusions. Investigation of the mechanistic pathways lacked protein-level validation by western blot analysis. Fourthly, no positive control was included in the DNA ladder assay.

In conclusion, the present study demonstrated that PRF exhibited a significant inhibitory effect on the viability of BC cells (T24 cell line). This inhibitory activity displayed a time- and dose-dependent association, with more pronounced effects observed at PRF concentrations of 100 and 200 µg/ml following treatment for 24 and 48 h. Mechanistically, the results indicated that the PRF-induced apoptosis was triggered by two mechanisms, namely the death receptor-mediated pathways (FAS/TNFR1) in the absence of mitochondrial pathways and the biphasic modulation of NF-κB signaling, characterized by a switch from survival to apoptosis. Overall, these findings highlighted the therapeutic potential of PRF for the treatment of apoptosis-resistant BC.

Funding Statement

Funding: The present study was supported by the National Natural Science Foundation of China (grant nos. 82173568, 81703269, 81973097 and 82273687), the Natural Science Foundation of Heilongjiang Province (grant no. LH2023H054), the Huoju Plan Research Foundation of Mudanjiang Medical University (grant no. 2022-MYHJ-014), the Special Program for Supervisor Scientific Research of Mudanjiang Medical University (grant nos. YJSZX2022137 and YJSZX2022141), the Administration of Science & Technology Foundation of Mudanjiang (grant nos. HT2022NS112 and HT2022NS113), the Scientific Research Project of the Health Commission of Heilongjiang Province (grant no. 20221212060609) and the Fundamental Research Funds for the Universities of Heilongjiang Province (grant no. 2022-KYYWFMY-0712).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

JD designed the study, analyzed and interpreted data and wrote and revised the manuscript. YG and HG designed the study and analyzed data. TJ and YM analyzed data and wrote the manuscript. SR designed the study and wrote and revised the manuscript. JD and SR confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.