M2 macrophages promote PKM2 production in fibroblasts to alleviate UVB-induced photoaging

ABSTRACT

Ultraviolet radiation is a major factor in causing skin aging. Compared to younger individuals, older adults exhibit a significant imbalance in the M1/M2 macrophage ratio, with an elevated proportion of M1 macrophages, but little is known about the role of macrophages in skin aging. Here, we report the critical role of M2 macrophages and PKM2 in preventing fibroblast photoaging. UVB-treated photoaged fibroblasts showed a reduction in PKM2. Compared to M1 macrophages, treatment with M2 macrophage significantly alleviated this photoaging and enhanced PKM2 synthesis in fibroblasts. Mechanistically, this is due to the secretion of CCL1 by M2 macrophages, which acts on the CCR8 receptor on the cell surface, promoting PKM2 production in photoaged fibroblasts. This further activates the TGF-β1/Smad2 pathway, thereby reducing cellular aging. This provides a potential strategy for the treatment of skin photoaging.

Introduction

Aging is a systemic issue characterized by the gradual loss of function and regenerative capacity across various organs and tissues, with skin aging being the most visible manifestation. Aging skin exhibits decreased efficacy in barrier protection and immune regulation. Changes occur in the epidermis, dermis, subcutaneous tissue, and the connective components between these layers, leading to a gradual loss of structural integrity and increased vulnerability [1–4]. As the body’s primary barrier against the external environment, skin aging is influenced by both intrinsic and extrinsic factors. Intrinsic aging, also known as natural aging, results from the passage of time and involves DNA damage, free radical production, mitochondrial damage, and telomere shortening in skin cells. This leads to phenomena such as thinning, sagging, reduced perspiration, heightened sensitivity to temperature changes, and the development of fine wrinkles [5].

Extrinsic aging is associated with environmental factors, mainly photoaging caused by ultraviolet (UV) radiation. UV radiation is classified into three types: UVA (315–400 nm), UVB (280–315 nm), and UVC (100–280 nm). Skin exposed to sunlight is affected by both UVA and UVB, with UVB being the primary threat. Long-term and/or repeated exposure to UVB accelerates the premature aging of dermal fibroblasts, resulting in coarse wrinkles, pigmentation, and other changes [6].

Skin aging is also linked to inflammation and innate immunity. One characteristic of physiological aging is the gradual increase in low-grade, asymptomatic, chronic inflammation, known as “inflammaging”, which is considered a pathogenic factor for various age-related diseases [7]. Mononuclear phagocytes, such as macrophages, are crucial players in chronic inflammation [8,9]. Macrophages can polarize into two phenotypes: classically activated or M1 and alternatively activated or M2. These macrophages are capable of secreting various chemokines, such as C-C motif chemokine ligand 1 (CCL1), CCL3, and CCL5, which play crucial roles in the biological activities of various cells [10,11].

Pyruvate Kinase M2 (PKM2), a key enzyme in glycolysis, has been shown to improve the aging phenotype in mice and enhance cardiac function when targeted expression to endothelial cells [12]. In cancer research, PKM2 expression is often positively correlated with M2 macrophage infiltration, facilitating tumor cell proliferation, migration, and invasion [13,14]. We hypothesize that in aging skin, an increased proportion of M2 macrophages similarly promotes PKM2 production. Transforming growth factor-β1 (TGF-β1) is a major regulator of procollagen type I protein synthesis in dermal fibroblasts, with Smad proteins being key downstream targets of TGF-β [15]. PKM2 can stabilize the TGF-β type I receptor on the cell surface, thereby promoting TGF-β1 signaling and fibrosis, while PKM2 knockdown inhibits TGF-β1-induced fibroblast activation [16].

In our study, we observed that UVB-treated fibroblasts exhibited a range of aging phenomena, including reduced PKM2 levels and weakened TGF-β1 signaling. CCL1 secreted by M2 macrophages facilitates the generation of PKM2 in photoaged fibroblasts, enhances TGF-β1 signaling, and increases the overall levels and phosphorylation of the downstream protein Smad2, thereby alleviating the extent of fibroblast photoaging. This may represent a potential strategy for mitigating skin photoaging.

Materials and methods

Cell culture of L929 fibroblasts and macrophages

Mouse fibroblasts L929 and mouse macrophages RAW264.7 were cultured in high-glucose DMEM medium (BasalMedia, China). The media were supplemented with 10% fetal bovine serum (Gibco, USA), 50 U/mL penicillin (BasalMedia, China), and 50 μg/mL streptomycin (BasalMedia, China). Cells were seeded in 10 cm culture dishes and maintained in a 37°C incubator with 5% CO₂. The medium was replaced with fresh medium every 2 days, and cells were passaged when they reached 80%–90% confluence.

Macrophage polarization

To polarize RAW264.7 macrophages into classic-activated macrophages (hereinafter referred to as M1), the culture medium was supplemented with 100 ng/mL Lipopolysaccharide (LPS) (MedChemExpress, USA) and 20 ng/mL interferon-γ (IFN-γ) (MedChemExpress, USA). To polarize RAW264.7 macrophages into alternative activated macrophages (hereinafter referred to as M2), the culture medium was supplemented with 20 ng/mL interleukin (IL)-4 (Novoprotein, China) and 20 ng/mL IL-13 (Novoprotein, China).

Infection by lentivirus in cells

The packaging of the lentivirus for PKM2 gene overexpression was commissioned to Beijing Tsingke Biotech Co., Ltd. The PKM2 overexpression sequence was constructed into a shuttle vector. Endotoxin-free shuttle vector and endotoxin-free lentiviral packaging plasmids were co-transfected into producer cells to generate the lentivirus. The lentiviral particles were then collected, concentrated, and subjected to titer determination. L929 cells were seeded at 150,000 cells per well in a 6-well plate. Once adhered, the medium was replaced with DMEM medium lacking penicillin and streptomycin, and lentivirus mixed with 5 μg/mL polybrene (Tsingke, China) was added (MOI = 20). After 48 h, the medium was replaced with fresh medium containing 1 μg/mL puromycin (Beyotime, China) for selection over a week. Cells were then collected and transduction efficiency was assessed.

UVB irradiation

Following the protocol established by Ruth Greussing et al. [17], cells were exposed to a total UVB dose of 4000 J/m². Adherent cells were washed twice with PBS, leaving a small amount of PBS to keep the cells moist. UVB lamps were positioned 10 cm above the dish, with an irradiance of 5.55 W/m². Cells were irradiated for 1.5 min per session, twice daily, for a total of 4 days. The total UVB dose was approximately 5.55 W/m² ×180 s × 4 ≈ 4000 J/m².

RNA extraction and reverse transcription

Total RNA was extracted from cells using the RNA-Quick Purification Kit (ES Science, China). After thoroughly lysing the cells with Lysis Buffer, an equal volume of absolute ethanol was added and mixed well. Following centrifugation, the supernatant was discarded. Wash Buffer was added, and the mixture was centrifuged again, followed by removal of the supernatant. Then, 30 μL of Elution Buffer was pipetted onto the center of the spin column membrane and allowed to stand for 2 min. The column was centrifuged at 12,000 × g for 1 min to elute the RNA into the bottom of the EP tube. The eluate was re-applied to the center of the spin column membrane, left to stand for 5 min, and centrifuged again. The final RNA solution was kept on ice, and its concentration was measured using a microvolume spectrophotometer (Denovix, USA). The RNA was either immediately subjected to reverse transcription or stored at −80°C.

Reverse transcription was performed using a cDNA synthesis kit (Abclonal, China). A reaction mixture was prepared by adding 4 μL of 5× ABScript III RT Mix and 1 μL of 20× gDNA Remover Mix to 500 ng of total RNA, and nuclease-free H₂O was added to a final volume of 20 μL. The thermal cycling program (Applied Biosystems, USA) was set as follows: 37°C for 2 min, 55°C for 15 min, 85°C for 5 min, and hold at 4°C. During this process, RNA was reverse transcribed into cDNA, which was then stored at −80°C.

Real-time quantitative PCR

This step was performed using a real-time quantitative PCR kit (Abclonal, China). A reaction mixture was prepared by adding 10 μL of 2× Universal SYBR Green Fast qPCR Mix, 0.4 μL of forward primer (10 μM), and 0.4 μL of reverse primer (10 μM) to 50 ng of cDNA, and adjusting the final volume to 20 μL with nuclease-free H₂O. The PCR tubes were placed into a qPCR instrument (Thermo Fisher, QuantStudio 5), and the thermal cycling program was set according to the steps shown in Table 1. Primer sequences are listed in Table 2.

Table 1.

qRT-PCR reaction program.

Procedure	Temperature	Duration	Cycle(s)
Initial Denaturation	95°C	3 min	1
Cycling	95°C	5 s	40
	60°C	30–34 s
Melting Curve Analysis	Instrument Default Settings

Table 2.

Primer sequence.

Gene	Primer		Size of the amplicon	Tm (°C)	GenBank accession number
β-actin	F	CACTGTCGAGTCGCGTCC	102	60.50	NM_007393.5
	R	CGCAGCGATATCGTCATCCA		60.39
P53	F	TCCGAAGACTGGATGACTGC	142	59.47	NM_011640.4
	R	GATCGTCCATGCAGTGAGGT		59.82
P21	F	GCAGAATAAAAGGTGCCACAGG	84	60.09	NM_001111099.2
	R	GACAACGGCACACTTTGCTC		60.32
COL-1	F	CGATGGATTCCCGTTCGAGT	96	59.90	NM_007742.4
	R	GAGGCCTCGGTGGACATTAG		59.89
COL-3	F	TGACTGTCCCACGTAAGCAC	105	59.57	NM_009930.2
	R	GAGGGCCATAGCTGAACTGA		59.17
PKM2	F	GCTCTAGGTATCGCAGCAGG	81	60.04	NM_001253883.2
	R	AGTCCCTGCTTCACTGTGTG		59.89
iNOS	F	CAACAGGGAGAAAGCGCAAA	125	59.33	NM_001313921.1
	R	ATTCTGTGCTGTCCCAGTGAG		60.00
Arg-1	F	ACATTGGCTTGCGAGACGTA	109	60.04	NM_007482.3
	R	ATCACCTTGCCAATCCCCAG		60.03

Western blot

When cells reached 50%–60% confluence, the medium was replaced with fresh serum-free medium, and cells were treated for 48 h with various components, including macrophage-conditioned media (CM), PKM2-IN-1 (MedChemExpress, USA), CCL1 (MedChemExpress, USA), and R243 (MedChemExpress, USA). Control groups received equivalent volumes of solvents such as PBS and DMSO. Whole-cell lysates were prepared using RIPA Lysis Buffer (New Cell & Molecular Biotech, China) containing 1 mm phenylmethylsulfonyl fluoride (Solarbio, China), protease inhibitor mixture (Solarbio, China), and phosphatase inhibitor (MedChemExpress, USA). Transfer the liquid to a 1.5 mL EP tube and lyse the sample on ice for 20 min. Centrifuge the tube at 12,000 × g for 5 min at 4°C. Carefully collect the supernatant into a fresh EP tube, add protein loading buffer (Epizyme, Shanghai), and mix thoroughly. Heat the mixture in a 95°C metal bath for 5 min, vortex briefly, then heat for an additional 5 min. Load the prepared protein samples together with a pre‑stained protein marker (Epizyme, China) onto a polyacrylamide gel (Epizyme, China) and perform sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS‑PAGE). Once the proteins reach the bottom of the gel, transfer them onto a PVDF membrane (Merck Millipore, USA) using an electric current. Membranes were blocked with 5% Bovine Serum Albumin (Solarbio, China) diluted in TBST (0.1% Tween 20 in Tris-buffered saline) for 1 h, then incubated overnight at 4°C with primary antibodies against collagen type 1 (COL-1) (66761–1-Ig, 1:2000, Proteintech, China), collagen type 3 (COL-3) (22734–1-AP, 1:1000, Proteintech, China), P16 (sc -74,400, 1:500, Santa Cruz Biotechnology, USA), P21 (28248–1-AP, 1:1000, Proteintech, China), P53 (32532S, 1:1000, Cell Signalling Technology, USA), PKM2 (15822–1-AP, 1:2000, Proteintech, China), Caspase-3 (19677–1-AP, 1:1000, Proteintech, China), ATM (A19650, 1:1000, ABclonal, China), TGF-β1 (BY0105, 1:1000, Abways, China), SMAD2 (ab33875, 1:1000, Abcam, UK), p-SMAD2 (3108T, 1:1000, Cell Signaling Technology, USA), CCL1 (YP-Ab -06,187, 1:1000, Research Cloud Biology, China), CCR8 (A4288, 1:1000, ABclonal, China), ACTIN (AC026, 1:100000, ABclonal, China), GAPDH (10494–1-AP, 1:10000, Proteintech, China) and VINCULIN (CY5164, 1:5000, Abways, China). After washing the membranes with TBST, they were incubated at room temperature for 1 h with horseradish‑peroxidase‑conjugated secondary antibodies (goat anti‑rabbit IgG, ZB‑2301, 1:10000, ZSGB‑BIO, China; goat anti‑mouse IgG, ZB‑2305, 1:10000, ZSGB‑BIO, China). An enhanced chemiluminescence (ECL) working solution (Epizyme, China) was freshly prepared. Excess liquid was blotted from the PVDF membrane with absorbent paper, and a sufficient volume of the ECL solution was added to completely and evenly cover the membrane, taking care to avoid bubble formation. The signal was then visualized using a chemiluminescence imaging system (Tanon, China). Band densities were quantified using ImageJ.

Protein extraction from CM

After cells were adherent, the medium was replaced with serum-free medium. CM was collected after 48 h. Using the method described by Christopher Jakobs et al. [18], proteins from CM were precipitated with methanol/chloroform. To 500 μL of CM, 500 μL of methanol and 125 μL of chloroform were added, and samples were vortexed vigorously for at least 30 s. The samples were then centrifuged at 13,000 × g for 5 min, resulting in three layers: the top water/methanol layer, the protein layer, and the bottom chloroform layer. The methanol and chloroform were carefully removed, and 500 μL of methanol was added again. After vigorous vortexing and centrifugation at 13,000 × g for 5 min, a small white protein pellet was visible at the bottom of the tube. Methanol was removed as much as possible without disturbing the pellet, and the remaining methanol was allowed to evaporate. The pellet was resuspended in 40 μL of 1× SDS sample buffer and vortexed vigorously before high-temperature denaturation at 95°C.

SA-β-GAL staining

Cells were stained using the Senescence-associated β-galactosidase (SA-β-GAL) Staining Kit (Solarbio, China) according to the manufacturer’s instructions. Cells were seeded in six-well plates. After removing the culture medium, the cells were washed once with PBS to eliminate residual medium. Then, 1 mL of β-Gal fixation solution was added to each well, and the plate was left at room temperature for 15 min to fix the cells. The fixation solution was then removed, and the cells were washed three times with a small volume of PBS. The staining working solution was prepared by thoroughly mixing reagents B, C, D, and E in a ratio of 5:1:1:93. Following the removal of the wash solution, 1 mL of the staining working solution was added to each well. The plate was sealed with parafilm to minimize evaporation and incubated overnight at 37°C in a low-CO₂ incubator. Images were observed and captured using a standard light microscope.

Cell viability assay

Cells were seeded in 96-well plates and treated with compounds for 48 h. Each well was then replaced with 100 μL of fresh medium and 10 μL of CCK-8 solution (Elabscience, China). The cells were incubated at 37°C for 1 h, and absorbance was measured at 450 nm using a microplate reader (Tecan, Switzerland).

Coomassie brilliant blue staining

PAGE gels were stained using the Coomassie Brilliant Blue Staining Kit (Solarbio, China). The PAGE gel after electrophoresis is immersed in distilled water and heated to boiling. Vigorously shake for 5 min, then discard the water. Add sufficient rapid staining working solution to completely cover the gel, and continue heating until boiling. Maintain boiling for 1 min, followed by vigorous shaking for 10 min. At this point, blue bands should become visible on the gel. Proceed with destaining by immersing the gel in fresh distilled water, heating to boiling, maintaining the boiling state for 1 min, and then vigorously shaking for 10 min. Repeat the destaining process until the background is completely clear.

Immunofluorescence staining

For imaging fixed cells, cells were seeded on 18-well chamber slides (iBidi, μ-Slide, Germany). After treatment, cells were fixed with 4% paraformaldehyde and permeabilized with 0.3% Triton X-100. Cells were then blocked with 5% BSA and incubated overnight at 4°C with primary antibodies against COL-1 (66761–1-Ig, 1:50, Proteintech, China), COL-3 (22734–1-AP, 1:50, Proteintech, China), PKM2 (15822–1-AP, 1:50, Proteintech, China), CCL1 (YP-Ab -06,187, 1:50, Research Cloud Biology, China), CCR8 (A4288, 1:50, ABclonal, China), CD206 (18704–1-AP, 1:50, Proteintech, China), CD86 (13395–1-AP, 1:50, Proteintech, China). After washing with PBS, cells were incubated with secondary antibodies (4414S, 1:500, Cell Signaling Technology, USA; 4413S, 1:500, Cell Signaling Technology, USA) at 37°C for 1 h. Finally, cells were stained with DAPI (S2110, Solarbio, China) and imaged using a confocal microscope (Zeiss, Germany).

Live/dead cell staining assay

This step utilizes the Calcein/PI Cell Viability and Cytotoxicity Assay Kit (Beyotime, China). The staining working solution is prepared by mixing Calcein AM (1000×), PI (1000×), and assay buffer at a ratio of 1:1:1000, followed by thorough mixing and protection from light. Cells are seeded in a six-well plate. After removing the culture medium, the cells are washed once with PBS. Subsequently, 1 mL of the Calcein AM/PI working solution is added to each well, and the cells are incubated in the dark at 37°C for 30 min. After incubation, the staining solution is discarded, the cells are washed once with PBS, and fresh PBS is added to keep the cells moist. Fluorescence images are then observed and captured using a fluorescence microscope (Olympus, Japan).

Statistical analysis

All data are expressed as mean ± SEM from at least three independent experiments. Statistical analysis was performed using GraphPad Prism software. The Shapiro–Wilk test was used to assess the normality of data distribution. For data following a normal distribution, homogeneity of variances was evaluated using the Brown–Forsythe test. When variances were equal, comparisons between the two groups were conducted using the unpaired t-test, and comparisons among multiple groups were performed using one-way ANOVA. If variances were unequal, Welch’s correction was applied to reanalyze the data. For data that did not meet the assumption of normality, the Mann–Whitney U-test was used for two-group comparisons, and the Kruskal – Wallis test was applied for comparisons among multiple groups. p < 0.05 was considered statistically significant, with p values < 0.05, 0.01, 0.001, and 0.0001 denoted by *, **, ***, and #, respectively.

Results

UVB-treated L929 cells showed senescence and reduced PKM2 levels

L929 cells were subjected to UVB irradiation (Figure 1(a)). During this process, changes in cell morphology were observed, including increased cell size and irregular shapes (Figure 1(b)). SA-β-GAL is an enzyme that accumulates in the lysosomes of senescent cells and is a widely used marker for cellular senescence, which can be detected at pH 6.0 [19]. We used SA-β-GAL staining to determine the proportion of senescent cells. After 4 days of UVB treatment, over 80% of the cells were positive for SA-β-GAL staining (Figure 1 (b)), indicating that the cells have undergone photoaging. CCK-8 assays indicated a significant reduction in the cell viability of UVB-treated L929 cells compared to untreated controls (Figure 1(c)). Various pathways leading to cellular senescence result in alterations in the expression of P16, P21, and P53 genes. UVB exposure induces DNA damage and promotes apoptosis. Accordingly, we analyzed the expression of related molecular markers. As expected, UVB irradiation induced senescence features in L929 cells, including elevated levels of P16, P21, P53, Caspase-3 and ataxia telangiectasia mutated (ATM) (Figure 1(d,e)). Since UVB causes ECM degradation, and collagen plays a crucial role in the ECM, we measured collagen production, specifically types I and III. Significant reductions in COL-1 and COL-3 were observed post-UVB treatment (Figure 1(d,e,f)). Notably, Western blotting and qPCR results showed a significant decrease in PKM2 production in fibroblasts after UVB exposure (Figure 1(d,e,f)).

Figure 1.

UVB-treated L929 cells showed senescence and reduced PKM2 levels. (a) L929 cells were exposed to UVB irradiation for 4 days in culture dishes. (b) After UVB treatment, L929 cells exhibited positive SA-β-GAL staining, whereas control cells were negative. (c) UVB exposure led to a marked decrease in cell viability. (d, e) Collagen and PKM2 production were reduced in UVB-treated L929 cells, while the expression of P16, P21, and P53 increased. Additionally, the expression of Caspase-3 and ATM was also elevated. (f) Immunofluorescence staining revealed reduced collagen and PKM2 production following UVB irradiation. If the data were normally distributed with equal variances, unpaired t-test was performed. If the data were normally distributed but with unequal variances, Welch’s t-test was used. For non-normally distributed data, the Mann–Whitney U-test was applied. n ≥ 3 (biological replicates).

M2 macrophages alleviate the aging extent of photoaged L929 cells

Using established methods [20], RAW264.7 cells were polarized into M1 macrophages with 100 ng/ml LPS and 20 ng/ml IFN-γ, and into M2 macrophages with 20 ng/ml IL-4 and 20 ng/ml IL-13. After 48 h, we confirmed the surface markers of these polarized macrophages. M1 macrophages exhibited irregular, polygonal shapes (Figure 2(a)) and increased levels of inducible nitric oxide synthase (iNOS) and CD86 (Figure 2b,c). M2 macrophages were more round or spindle-shaped (Figure 2a) and increased levels of arginase 1 (Arg-1) and CD206 (Figure 2b,c). CM from both types of macrophages were collected, centrifuged to remove cells and debris, and added to the photoaged L929 cells. After 48 h, the aging extent of these cells was reassessed. Cell viability assays showed that compared to M1 macrophages, M2 macrophages significantly enhanced the cell viability of photoaged L929 cells (Figure 2d). SA-β-GAL staining revealed that the proportion of positive cells significantly decreased in photoaged L929 cells treated with M2 macrophage CM, while there was no significant effect under M1 macrophage CM (Figure 2e). Consistent with the SA-β-GAL staining results, the supernatant from M2 macrophages reduced the production of P16, P21, and P53 in senescent cells, reversed cellular DNA damage, enhanced anti-apoptotic capacity, and increased collagen production (Figure 2f). Importantly, PKM2 levels also increased during this process (Figure 2f,g). Additionally, live/dead cell staining showed that cell viability was above 96% in all groups (Figure 2h), suggesting that the small amount of cell death does not affect the experimental results.

Figure 2.

M2 macrophages alleviate the aging extent of photoaged L929 cells. (a, b, c) RAW264.7 cells exhibit morphological changes and differential expression of iNOS, Arg-1, CD86, and CD206 after treatment with LPS + IFN-γ (M1) or IL-4 + IL-13 (M2). (d) Photoaged cells treated with M2 macrophage CM show significantly enhanced viability compared to those treated with M1 macrophage CM. (e) M2 macrophages CM reduces the proportion of SA-β-GAL positive cells. (f) M2 macrophage CM increases the synthesis of COL-1, COL-3, and PKM2 in photoaged cells, with a decrease in P16, P21, P53, Caspase-3 and ATM production. (g) Immunofluorescence staining shows that photoaged cells treated with M2 macrophages CM produce more PKM2. (h) Cell survival is assessed after different treatments. M1 macrophage CM results in increased cell death, whereas M2 macrophage CM and control group show no significant differences in cell survival. If the data were normally distributed with equal variances, one-way ANOVA was performed. If the data were normally distributed but with unequal variances, Welch’s one-way ANOVA was used. For non-normally distributed data, the Kruskal–Wallis test was conducted. n ≥ 3 (biological replicates).

PKM2 overexpression alleviates senescence in photoaged L929 cells

In human fibroblasts, the absence of PKM2 leads to direct cellular senescence, while PKM2 overexpression (PKM2 OE) can delay replicative senescence [12]. However, whether PKM2 plays a similar role in UVB-induced cellular senescence remains unclear. In our previous studies, we found that the CM from M2 macrophages could alleviate UVB-induced senescence in cells, accompanied by an increase in PKM2 production. This observation led us to hypothesize that PKM2 might also mitigate photoaging.

Firstly, we achieved PKM2 OE in L929 cells and confirmed it (Figure 3a). These PKM2 OE cells were then subjected to UVB treatment as described previously. Subsequent SA-β-GAL staining revealed that the proportion of positive cells was significantly reduced in the PKM2 OE group compared to the NC group (Figure 3b), and cell viability increased significantly (Figure 3c). Western blot analysis showed increased production of COL-1 and COL-3, along with reduced activation of P16, P21, P53, Caspase-3 and ATM (Figure 3d). However, qPCR results indicated no significant differences in mRNA levels of P21 and P53 (Figure 3e).

Figure 3.

PKM2 overexpression alleviates senescence in photoaged L929 cells. (a) PKM2 is stably overexpressed in L929 cells. (b) PKM2 OE cells exhibit greater resistance to photoaging, with fewer senescent cells compared to controls. (c) After UVB treatment, PKM2 OE cells retain more cell viability. (d) PKM2 OE cells produce more COL-1 and COL-3 compared to NC cells, with lower levels of P16, P21, P53, Caspase-3, and ATM proteins. (e) mRNA analysis shows that PKM2 OE cells have increased transcription of PKM2, COL-1, and COL-3, consistent with the Western blot results. There is no significant difference in P53 and P21 levels between PKM2 OE and NC cells. (f) Treatment with PKM2-IN-1 induces a transition from normal cells to a senescent phenotype. (g) PKM2-IN-1 reduces the cell viability of L929 cells If variances were equal, comparisons between two groups were conducted using the unpaired t-test, and comparisons among multiple groups were performed using one-way ANOVA. If variances were unequal, Welch’s correction was applied to reanalyze the data. For data that did not meet the assumption of normality, the Mann–Whitney U-test was used for two-group comparisons, and the Kruskal–Wallis test was applied for comparisons among multiple groups. n ≥ 3 (biological replicates).

We also investigated the effects of PKM2 inhibition on L929 cells. Addition of the PKM2 inhibitor PKM2-IN-1 to normal L929 cells led to a concentration-dependent reduction in collagen production, activation of P16, P21, P53, Caspase-3 and ATM, and impaired cell viability (Figure 3f, g). These results confirm that PKM2 presence is beneficial in mitigating UVB-induced damage to L929 cells.

CCL1 secreted by M2 macrophages enhances PKM2 production in photoaged L929 cells

We measured CCL1 levels in RAW264.7 cells and found that CCL1 was produced in M2 macrophages treated with IL-4 and IL-13 (Figure 4a,b). CCL1 was detectable in the protein extracts from CM of these M2 macrophages, whereas it was not found in M1 macrophages (Figure 4a). We also observed that C-C Chemokine Receptor 8 (CCR8), the specific receptor for CCL1, is expressed in L929 mouse epithelial fibroblasts (Figure 4c,d), indicating that L929 cells can respond to CCL1 stimulation.

Figure 4.

CCL1 secreted by M2 macrophages enhances PKM2 production in photoaged L929 cells. (a) Comparison of CCL1 levels in M1/M2 macrophages and their supernatants. (b) Immunofluorescence staining shows that M2 macrophages produce higher levels of CCL1. (c,d) Western blot and immunofluorescence staining reveal that both L929 and photoaged L929 cells express CCR8. (e) Exogenous CCL1 reduces the proportion of SA-β-GAL positive senescent cells. (f, g) Exogenous CCL1 increases the production of collagen and PKM2, while reducing the activation of P16, P21, P53, Caspase-3, and ATM in photoaged L929 cells. (h, i) The CCR8 antagonist R243 partially reverses the effects of M2 macrophage CM on photoaged L929 cells. If variances were equal, comparisons between two groups were conducted using the unpaired t-test, and comparisons among multiple groups were performed using one-way ANOVA. If variances were unequal, Welch’s correction was applied to reanalyze the data. For data that did not meet the assumption of normality, the Mann–Whitney U-test was used for two-group comparisons, and the Kruskal–Wallis test was applied for comparisons among multiple groups. n ≥ 3 (biological replicates).

To explore whether CCL1 secreted by M2 macrophages affects fibroblast senescence, we treated photoaged L929 cells with exogenous CCL1 (80 ng/ml) for 48 h and assessed various senescence markers. SA-β-GAL staining showed a reduction in positive cells (Figure 4e), and there was a decrease in P16, P21, P53, Caspase-3 and ATM proteins along with a significant increase in COL-1, COL-3 and PKM2 levels (Figure 4f,g). R243, an antagonist of CCR8, was used to inhibit CCL1 binding to CCR8. The addition of R243 (4 μmol/L) alongside M2 macrophage CM partially blocked the reduction in senescence markers induced by M2 macrophage CM (Figure 4h,i). This suggests that CCL1 in the M2 macrophage CM is one of the factors contributing to the increased PKM2 production in photoaged fibroblasts.

M2 macrophages activate the TGF-β1/Smad2 pathway in L929 cells to alleviate photoaging

In photoaged L929 cells, we observed a significant reduction in TGF-β1, SMAD2, and phosphorylated SMAD2 levels (Figure 5a). Our previous research indicated that PKM2 is beneficial in countering photoaging in L929 cells. Inhibition of PKM2 can hinder the activation of the TGF-β1/SMAD2 pathway, while overexpression of PKM2 facilitates its activation (Figure 5b,c). Further experiments showed that treatment with M2 macrophage CM and exogenous CCL1 resulted in a significant increase in TGF-β1 and p-SMAD2 levels, whereas M1 macrophage CM had no significant effect (Figure 5d,e). The addition of R243 blocked the activation of TGF-β1/SMAD2 induced by M2 macrophage CM (Figure 5f). Based on the changes in PKM2 across different conditions, we speculate that the activation of the TGF-β1/SMAD2 pathway is associated with the increase in PKM2 levels caused by CCL1.

Figure 5.

M2 macrophages activate the TGF-β1/SMAD2 pathway in L929 cells to alleviate photoaging. (a) Activation of the TGF-β1/SMAD2 pathway is reduced in photoaged L929 cells. (b, c) PKM2 inhibitor PKM2-IN-1 blocks the activation of the TGF-β1/SMAD2 pathway in L929 cells, whereas the overexpression of PKM2 enhances this activation. (d, e, f) Addition of M2 macrophage CM or exogenous CCL1 promotes activation of the TGF-β1/SMAD2 pathway in photoaged L929 cells, while the CCR8 antagonist R243 inhibits the effect of M2 macrophage CM. If variances were equal, comparisons between two groups were conducted using the unpaired t-test, and comparisons among multiple groups were performed using one-way ANOVA. If variances were unequal, Welch’s correction was applied to reanalyze the data. For data that did not meet the assumption of normality, the Mann–Whitney U-test was used for two-group comparisons, and the Kruskal–Wallis test was applied for comparisons among multiple groups. n≥3 (biological replicates).

Discussion

UVB exposure in human dermal fibroblasts (HDFs) induces oxidative stress and damages DNA, proteins, and lipids, resulting in increased cytoplasmic ROS and the release of inflammatory cytokines such as IL-1 and tumor necrosis factor-alpha (TNF-α). This exposure also leads to the overexpression of matrix metalloproteinases, causing alterations in dermal remodeling and contributing to photoaging of the skin [1,2,21,22]. Repeated UV damage causes macrophages to infiltrate the skin after each exposure, where they also express matrix metalloproteinases, further exacerbating damage and degradation of the dermal extracellular matrix (ECM). The number and functionality of aging fibroblasts decline, accompanied by increased overall levels of P16 and P53. P21, as a downstream effector molecule of P53, is also upregulated. This response to cellular aging results in cell cycle arrest and reduced collagen production, impairing the ability to effectively repair or regenerate the ECM [8,21,23]. UVB damages cellular DNA, activating ataxia telangiectasia mutated (ATM), and also induces the activation of the P53-mediated Bcl-2/BAX/Caspase-3 apoptotic pathway [24–27]. Additionally, aging cells exhibit abnormal enlargement, including enlarged nuclei and focal points of condensed chromatin, known as senescence-associated heterochromatic foci (SAHF) [28]. We irradiated L929 cells with UVB for 4 consecutive days and observed changes in cell morphology and reduced proliferation under the microscope. Additionally, SA-β-GAL staining was positive, and there was an upregulation of P16, P21, P53, Caspase-3 and ATM, with a marked decrease in COL-1/3 production, indicating that UVB stimulation triggers the aging process, impairing the ability to repair and regenerate ECM.

Research indicates that innate immunity plays a major role in the inflammatory-aging process [29]. Mononuclear phagocytes such as macrophages are crucial in innate immunity and are key executors of chronic inflammation. M1 macrophages secrete pro-inflammatory factors like TNF-α, IL-1β, IL-6, iNOS, chemokines and exhibit increased expression of certain cell surface markers such as CD40, CD80, and CD86. M1 macrophages promote early inflammation and impair tissue regeneration and wound healing [30]. In contrast, M2 macrophages express IL-10, TGF-β, vascular endothelial growth factor, epidermal growth factor, and Arg-1, as well as increase the expression of cell surface markers CD163, CD204, and CD206. They help suppress inflammation and promote tissue repair and wound healing, thus also known as reparative macrophages [30]. Macrophages secrete various cytokines at sites of inflammation, causing chronic inflammatory features such as tissue damage and fibrosis to appear locally [9]. Many age-related diseases, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), and atherosclerosis, are characterized by chronic inflammation and macrophage infiltration [9]. In our study, the addition of M2 macrophage CM alleviated the aging phenotype of photoaged L929 cells, as evidenced by a decrease in SA-β-GAL positive cells and an increase in cell viability. In contrast, M1 macrophage CM did not exhibit such effects and instead exacerbated cell damage. Consistent with our findings, an increase in M1 macrophages or the M1/M2 macrophage ratio has been associated with the onset or exacerbation of various inflammatory skin diseases, such as psoriasis, AD, systemic lupus erythematosus (SLE), and Behçet’s disease, where M1 macrophages dominate in the persistent inflammatory response and destructive cycles [30]. Studies of skin tissue samples from younger and older individuals have found that, despite no significant change in the total number of macrophages, the ratio of M1 to M2 macrophages significantly increases with aging skin. Additionally, there is a notable positive correlation between the proportion of P21+ cells in the dermis and the M1/M2 ratio [31]. Compared to young mice, older mice exhibit an elevated M1/M2 macrophage ratio across various organs and tissues. Exercise training in aged mice can reduce macrophage infiltration and M1 polarization in tissues, thereby mitigating age-related chronic inflammation [32]. M2 macrophages have also been shown to increase collagen production in normal airway fibroblasts [33]. Our findings are in line with previous reports, demonstrating that M1 macrophage CM further decreases the ability of photoaged L929 cells to produce COL-1/3, while M2 macrophages protect and enhance this ability, indicating an improved capacity for fibroblast repair and ECM regeneration.

The tetrameric form of PKM2 is a key enzyme involved in glycolysis, while the dimeric form functions as a protein kinase that can initiate gene transcription by translocating to the nucleus. This dual functionality allows PKM2 to promote cell viability through both metabolic and non-metabolic pathways [16]. Extracellular PKM2 can promote angiogenesis and aid in wound repair, as well as activate integrins, which then promote the production of cellular collagen through a series of signal transduction pathways [34]. Wu et al. demonstrated that targeted expression of PKM2 in endothelial cells improved the aging phenotype and cardiac function in mice, whereas the absence of PKM2 accelerated cellular aging [12]. Our study found that UVB reduces PKM2 production in L929 cells, while M2 macrophages CM increases PKM2 levels. Furthermore, L929 cells with stable PKM2 OE exhibit greater resistance to UVB irradiation. Therefore, we hypothesize that M2 macrophages promote PKM2 production in photoaged L929 cells, thereby alleviating cellular senescence.

Different macrophage phenotypes secrete distinct chemokines. Chemokines are classified into four subfamilies: C, CC, CXC, and CX3C, each playing distinct roles in skin inflammation, wound healing, and other processes [20,35,36]. CCL1 is a member of the CC chemokine family. CCL1 and its receptor CCR8 are typically involved in recruiting immune cells, shaping the tumor immune microenvironment, and influencing disease progression [37,38]. In studies involving liver cancer cells and macrophages, it was found that CCL1 secreted by macrophages binds to CCR8 on cancer cells, promoting the exocytosis of PKM2 and remodeling the tumor microenvironment [38]. Thus, we hypothesized that M2 macrophages could influence PKM2 activity in L929 cells through the secretion of CCL1. Western blot and immunofluorescence analyses showed that CCL1 levels in M2 macrophages and their CM were significantly higher compared to M1 macrophages. L929 and photoaged L929 cells also expressed the CCL1 receptor CCR8, indicating their capability to respond to CCL1 stimulation. Research has indicated that M2 macrophage CM, induced by IL-4, is rich in CCL1, CCL5, and G-CSF, which play crucial roles in promoting cell migration and collagen production, beneficial for skin wound healing [20]. Dermal microvascular endothelial cells express the CCL1 receptor CCR8, and stimulation with CCL1 significantly enhances cell migration [39]. This suggests that CCL1 may have beneficial effects in skin aging. To verify this, we directly stimulated photoaged L929 cells with exogenous CCL1. We observed a significant increase in PKM2 production and a marked reduction in cellular senescence. Additionally, CCL1 accelerated the cell viability of photoaged L929 cells, indicating an improvement in cell viability and suggesting that CCL1 may be beneficial for skin wound healing. R243, a selective CCR8 antagonist, inhibits the interaction between CCL1 and CCR8 and suppresses CCR8 signaling and chemotaxis. In the presence of M2 macrophage supernatant and R243, the production of PKM2 in photoaged L929 cells is inhibited, and the severity of cellular senescence is reversed. This further confirms that CCL1 promotes PKM2 production in photoaged L929 cells.

TGF-β1 is a multifunctional cytokine that regulates the production of extracellular matrix (ECM) proteins, including collagen, elastin, and fibronectin. It serves as a major regulator of type I procollagen synthesis in dermal fibroblasts [40,41]. In cases of replicative senescence, drug-induced senescence, and other similar conditions, some tumor cells and cholangiocytes may secrete more TGF-β1, promoting senescence features in surrounding cells [42,43]. However, the loss of collagen can lead to dryness and loss of elasticity in the skin, resulting in an aging appearance. Exogenous TGF-β1 stimulation encourages senescent fibroblasts to produce collagen [15]. Considering the critical role of ECM proteins, especially collagen, in maintaining skin rejuvenation, we believe that the effect of TGF-β1 in aged skin is unique and beneficial.

In aged human skin, components of the TGF-β pathway itself are reduced, leading to downregulation of TGF-β signaling and negatively affecting collagen homeostasis by decreasing the expression of type I procollagen. Fibroblasts exposed to UVB have lower TGF-β1 expression compared to unexposed cells, and TGF-β type II receptor (TRII) expression is also downregulated, resulting in reduced TGF-β-specific cell surface binding and impairment of TGF-β/SMAD pathway activation in human skin [41,44–46]. This suggests that impaired TGF-β signaling may be a major factor contributing to the reduced ECM production in photoaged skin. We found that UVB treatment significantly reduced the total protein levels of TGF-β1 and SMAD2 in L929 cells, which also accounted for the notable decrease in p-SMAD2. Consequently, the production of type I procollagen was diminished, subsequently affecting the overall collagen content. Our findings also indicated that L929 cells with high PKM2 expression, exposed to UVB, showed reduced aging damage and increased activation of the TGF-β1/SMAD2 pathway. The addition of PKM2-IN-1 inhibited this process, suggesting that PKM2 may protect L929 cells from UVB damage by activating the TGF-β1/SMAD2 pathway.

Moreover, stimulation of photoaged L929 cells with M2 macrophage CM also resulted in significant increases in TGF-β1, SMAD2, and p-SMAD2, whereas M1 macrophage CM had the opposite effect. This aligns with previous studies [47], suggesting that M2 macrophages can alleviate photoaging in L929 cells by promoting PKM2 production and activating the TGF-β1/SMAD2 pathway. M2 macrophages, known for their anti-inflammatory properties, can mitigate chronic inflammation associated with aging, thus exerting anti-aging effects. M2 macrophages also produce TGF-β1 and act on TGF-β receptors, which can activate fibroblasts by activating the TGF-β/SMAD pathway [48,49]. Therefore, we propose that M2 macrophages alleviate fibroblast photoaging through multiple pathways, with CCL1 being one of the contributing factors.

Based on our findings, we believe that M2 macrophages secrete CCL1, which acts on the CCR8 receptor of photoaged L929 cells, stimulating the production of PKM2. In the presence of exogenous CCL1, we observed significant activation of TGF-β1/SMAD2 in photoaged L929 cells. As expected, the total protein levels of TGF-β1, SMAD2, and p-SMAD2 increased significantly. The use of R243, an antagonist of CCR8, blocked the activation of TGF-β1/SMAD2 by M2 macrophage CM. This indicates that the CCL1-CCR8 axis plays a crucial role in the protective effects of M2 macrophages on photoaged L929 cells. Previous research has shown that factors in M2 macrophages CM, particularly TGF-β, significantly promote fibroblast viability and ECM production. Our study suggests that the CCL1-CCR8 axis is also a key factor in this process.

This study elucidates the biological significance of M2 macrophages in skin photoaging, demonstrating that M2 macrophages can mitigate UVB-induced aging effects on fibroblasts. Our data indicate that CCL1 secreted by M2 macrophages acts on the fibroblast membrane receptor CCR8, promoting PKM2 production and activating the TGF-β1/SMAD2 pathway, thereby alleviating cellular photoaging.

Our research still has some shortcomings. Macrophages can secrete various types of cytokines and shape the local microenvironment, directly or indirectly influencing other cells. M2 macrophages can affect the skin aging process in multiple ways; this study focused solely on the role of CCL1 in fibroblasts and its potential mechanisms. Other molecules involved in the TGF-β1/SMAD2 pathway, such as SMAD3, SMAD4, and SMAD7, were not all investigated. The mechanism by which CCL1-CCR8 influences PKM2 is still under investigation, and we will further explore this in the upcoming studies.

Funding Statement

The work was supported by the National Natural Science Foundation of China (81873934), Wang Zhengguo Foundation for Traumatic Medicine (growth factor rejuvenation project, SZYZ-TR-09), the Youth Fund from Natural Science Foundation of Shandong Province (ZR2020QH168), Jinan Science and Technology Plan Project (202225065).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Author contributions

Conceptualization, SJ and DJ; Methodology, SJ, NS and DJ; Investigation, SJ, ML and XyW; Writing – Original Draft, SJ; Writing – Review & Editing, NS, XcW, JZ and DJ; Funding Acquisition, DJ and YQ.

Data availability statement

The data that support the findings of this study are openly available in Mendeley Data at http://doi.org/10.17632/pm6jp4y6nf.1.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15384101.2025.2514988