Tongxinluo alleviates myocardial ischemia–reperfusion injury by inhibiting the pyroptosis of endothelial cells via the NLRP3/Caspase-1/GSDMD signaling pathway

Abstract

Numerous people experiencing acute myocardial infarction are also experiencing myocardial ischemia–reperfusion injury (MIRI). Pyroptosis is a core mechanism in MIRI. Tongxinluo (TXL) has a significant protective effect on endothelial cell function. This study utilized network pharmacology to investigate how TXL improves ischemia/reperfusion injury through targeting dysfunction of endothelial cells. Network pharmacology analysis identified 40 key targets through which TXL improves I/R by regulating endothelial dysfunction. We administered TXL (1.5 g/kg/d, oral gavage) to C57BL/6 mice for 7 days before inducing I/R injury, and used 400 μg/ml TXL for in vitro H/R injury in HUVECs. We extensively investigated the effects of TXL on pyroptosis in heart tissue and explored the underlying mechanism through biochemical assays, histopathology, and Western blot analysis. Network pharmacology analysis revealed that TXL targets primarily act on pyroptosis and inflammatory pathways. TXL pretreatment significantly improved cardiac function with increased EF% and decreased LVESV and LVEDV compared to the model group. Myocardial enzymes (CK, CKMB, LDH, cTnI) were markedly reduced by TXL pretreatment. TXL significantly decreased IL-18 and IL-1β levels in serum and reduced neutrophil infiltration in the ischemic area. TXL administration notably downregulated the expression of pyroptosis-related factors (NF-κB, NLRP3, cleaved-Caspase1, GSDMD) in both MIRI mouse model and H/R-treated HUVECs. Molecular docking showed that ginsenoside Rg3, a key TXL component, can directly interact with NLRP3 and GSDMD. TXL has a significant protective effect on endothelial cell function during I/R injury through inhibition of pyroptosis via the NLRP3/Caspase-1/GSDMD signaling pathway, preserving microcirculation barrier integrity.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10735-025-10585-2.

Introduction

Acute myocardial infarction (AMI) stands as one of the primary reasons for mortality and impairment worldwide. Prompt and efficient intravenous thrombolysis or percutaneous coronary intervention (PCI) are the most successful treatment options for reducing myocardial infarction and enhancing cardiac function (Ramachandra et al. 2020). Although the benefit of reperfusion therapy in preventing the serious consequences of myocardial infarction is unquestionable, the reperfusion injury caused by the reperfusion process itself greatly lessens the benefits of revascularization therapy, thus resulting in the mortality rate high at 10% after reperfusion therapy. And this is precisely due to the reperfusion injury during the reperfusion process. The mechanisms of myocardial ischemia–reperfusion injury (MIRI) involve oxidative stress, calcium overload, energy metabolism disorders, autophagy, apoptosis, pyroptosis and ferroptosis, among other factors. These pathological processes are interconnected and contribute to tissue damage during ischemia and reperfusion (Zheng et al. 2022). According to statistics, MIRI induced aggravated myocardial injury even up to 50% of myocardial infarction size (Yellon and Hausenloy 2007).

Ruder et al. use magnetic resonance technology to confirm that the area of MIRI coincided with the area of increased vascular endothelial permeability, which means that there is damage to the microvascular barrier in MIRI (Ruder et al. 2013). Vascular endothelial cells and basement membranes are the main structures of capillaries. The microcirculation system composed of capillaries is an important place for material exchange between blood and tissues. This system is vital for maintaining the proper function of blood circulation (Chang et al. 2021). The primary cause of MIRI is endothelial dysfunction and/or coronary microvascular impairment brought on by oxidative stress or inflammation (Heusch 2020). It is the pro-inflammatory programmed cell death mode (pyroptosis), rather than apoptosis (Vince and Silke 2016), that mediates the disfunction of endothelial barrier in this process. When myocardial I/R injury occurs, tissue damage promotes the release of aseptic inflammatory signals, for example, danger-associated molecular patterns (DAMPs). NF-κB moves to the nucleus when DAMPs are activated, leading to the production of proinflammatory cytokines pro-IL-18, pro-IL-1β, and NLRP3 inflammasome parts through transcription and translation. The NLRP3 inflammasome becomes active by oligomerizing with ASC, leading to the transformation of pro-Caspase-1 into active Caspase-1. The activation of Caspase-1 leads to the development and secretion of pro-inflammatory cytokines IL-1β and IL-18, which play a crucial role in inflammation. Moreover, Caspase-1 cuts Gasdermin D (GSDMD), resulting in the production of GSDMD-N. GSDMD-N subsequently assembles and forms openings on the cell membrane, enabling the discharge of activated IL-1β and IL-18 from inside the cell to the outside surroundings. This enlarges the inflammation, disrupts the endothelial barrier and further aggravates myocardial damage (Burdette et al. 2021).

TXL has traditionally been used to treat coronary atherosclerotic heart disease. The traditional Chinese medicine compound is made up of 12 various Chinese herbs, including ginseng, hirudo, centipede, scorpion, cicada slits, ground beetle, red peony root, borneol, spina date seed, and more. Clinical evidence-based studies have confirmed that for STEMI patients undergoing PCI or thrombolysis, TXL treatment can significantly improve ST-segment recovery and local ventricular wall activity abnormalities, and diminish myocardial no-reflow and infarct size while improving cardiac function (Zhang et al. 2010; You et al. 2005; Xu et al. 2020; Li et al. 2018). Basic studies have confirmed that TXL can play a protective role in heart, blood vessels, microcirculation and endothelial cells through multiple links and multiple targets such as anti-inflammatory (Zhang et al. 2014; Li et al. 2015, 2020a; Xiang-Dong et al. 2013; Jiang et al. 2023), antioxidant (Li et al. 2015; Zhang et al. 2015; Wang et al. 2022; Chen et al. 2018), anti-apoptosis (Xiang-Dong et al. 2013; Bai et al. 2013; Xiong et al. 2022), and improvement of heart microcirculation (Li et al. 2015; Bai et al. 2013; Cui et al. 2014). These findings indicate that TXL shows promise in the prevention and treatment of cardiovascular disorders, as well as in the inhibition of cardiovascular event progression. Currently, it is still unclear whether TXL exerts its protective effects on cardiac microcirculation by inhibiting pyroptosis of endothelial cells. The strategy of network pharmacology is widely recognized as an effective approach for investigating Traditional Chinese Medicine (TCM) by focusing on the balance of biological networks (Hopkins 2007, 2008; Zhang et al. 2018). The core mechanism analysis of TXL improving ischemia–reperfusion (I/R) by regulating endothelial cell dysfunction through network pharmacology methods was initially explored in this study. Key pathways were validated through in vivo models of I/R injury and in vitro models of H/R injury. Futhermore, we systematically explored the interaction between Rg3 and pyroptosis-related proteins, establishing a computational-experimental framework for studying traditional Chinese medicines (TCMs). While most studies focus on cardiomyocytes or immune cells, we demonstrated that Rg3 attenuates H/R-induced pyroptosis in endothelial cells—a less studied but key aspect of myocardial ischemia–reperfusion injury. Our findings suggest that Rg3 may improve microvascular integrity and cardiac recovery, offering potential benefits beyond anti-inflammation, particularly in preventing microvascular obstruction after reperfusion in AMI patients.

Material and methods

Preparation of TXL

Shijiazhuang Yiling Pharmaceutical Corporation (batch number: 20220615, Shijiazhuang, Hebei, China) provided the TXL used in the study. For the animal study, the dosage of TXL was established as 1.5 g/kg/d based on previous studies and the national 973 project research team recommendations (Yuan et al. 2018). Prior to the experiment, TXL ultrafine powder was prepared into a suspension with 0.5% carboxymethyl cellulose (CMC) aqueous solution (Yuan et al. 2018). During the in vitro experiment, a precise amount of TXL was measured using an analytical balance (Sartorius, Germany, precision: 0.1 mg) and then dissolved in DMEM medium without serum. The resulting mixture underwent sonication for half an hour and was subsequently centrifuged at 10,000 rotations per minute for a duration of 20 min. The supernatant (0.22 μm pore size) was filtered, and the centrifugal residue was dried in an oven at 60 °C. The final concentration of the drug was then calculated by weight difference method (Chang et al. 2017). The prepared TXL solution was kept at − 20 °C and then mixed with serum-free DMEM medium to reach the necessary concentration prior to usage.

Ethical considerations regarding animals

10-week-old male C57BL/6 mice weighing 24–26 g(n = 30) were acquired from Beijing Weitong Lihua Experimental Animal Technology Co. Ltd (Quality certificate No. 1100112011020148) with SPF status. The mice were kept at the Key Laboratory under the administration of Traditional Chinese Medicine. The animals were given regular food and water, and housed in a space with SPF conditions, under a 12 h light circadian rhythm, at a temperature between 20 and 25 °C, and a humidity level of 40–70%. The Animal Care and Use Committee at Hebei Yiling Chinese Medicine Research Institute granted approval for the ethical conduct of all animal experiments (Approval No. N2020063, Shijiazhuang, China).

Animal model and administration

C57BL/6 mice were randomly divided into three groups with 10 mice in each group: a sham-operated group (Sham), a Model group for I/R (Model), and a TXL pretreatment group (TXL). Drug intervention was given from day 1 to 7. Mice in the TXL group were administered a daily dose of 1.5 g per kilogram of body weight by oral gavage. Both groups, the Model and Sham operation, were administered the carboxymethyl cellulose solution (CMC) daily via gavage in equal amounts. Gavage volume was 0.2 ml/10 g of body weight. The model was created on the eighth day by tying the LAD artery of C57BL/6 mice for 45 min, followed by 24 h of reperfusion (Martí-Pàmies et al. 2023). The specific operation is as follows: Connecting the small animal ventilator with the tracheal intubation from the mouth (respiratory rate 120 times/min, tidal volume 10 ml/kg body weight), the mice were given isoflurane inhalation anesthesia, fixed in the supine position, connected the extremities to ECG electrodes. Then we connected the small animal ventilator through endotracheal tube. The mice were given chest skin preparation and disinfected with 75% alcohol. We opened the chest cavity, exposed the heart using a small animal thoracic retractor, and lastly ligated the LAD coronary artery. In contrast, for the sham operation group, only threading was required while ligation not. After the ligation, the myocardial tissue in the blood supply area of LAD turned pale, and the ST segment elevation was visible on the electrocardiogram, which was a sign of successful ligation. Following a 24-h period of reperfusion, the mice underwent weighing and were administered anesthesia by intraperitoneal injection using 1% pentobarbital (40 mg/kg). We performed echocardiography to test heart function, took blood from the abdominal aorta and collected the heart sample following a 24-h period of reperfusion.

Echocardiography

Measurements of left ventricular end-systolic volume (LVESV), left ventricular end-diastolic volume (LVEDV), and left ventricular ejection fraction (LVEF) were obtained using the Vevo2100 imaging system from VisualSonics in Canada, known for its ultrahigh resolution in small animal ultrasound. These metrics were assessed and evaluated over five sequential cardiac cycles by an experienced technician utilizing a double-blind methodology for guidance.

Tissue sample collection

After humane euthanasia, we exposed the mouse heart, peeled off the pericardium with ophthalmic forceps, took out the heart, washed it with normal saline and absorbed excess water with filter paper. Some of the samples of heart tissue from the mouse were preserved in liquid nitrogen in preparation for Western Blot examination. The other was immersed in 4% paraformaldehyde, encased in paraffin through a gradient dehydration process, and then sectioned into 4 μm-thick slices across the mid-ventricular short-axis cross-section.

Histopathological staining

Following the induction of MIRI, tissue sections underwent staining procedures using various techniques including hematoxylin and eosin (HE) staining to assess tissue morphology and inflammatory cell infiltration, TUNEL assay (Roche, Switzerland) to detect apoptotic/pyroptotic cells according to manufacturer's instructions, and immunofluorescence staining with specific antibodies against target proteins (NF-κB, NLRP3, Caspase-1, GSDMD). Subsequently, the sections were examined using both optical and fluorescence microscopes to assess the extent of myocardial necrosis, the presence of inflammatory cell infiltration around blood vessels and myocardial tissue, as well as the levels of target proteins of the pyroptosis pathway. For quantitative analysis, five random fields per section were analyzed using Image J software (NIH, USA) to quantify positive staining area and intensity.

Myocardial enzyme assay

Blood was extracted from the aorta in the abdomen and transferred to a tube containing an anticoagulant. The blood specimens that were gathered were cooled on ice and underwent centrifugation at 4 °C, 3500 revolutions per minute for 10 min before serum collection occurred within a 30-min timeframe. Serum levels of creatine kinase (CK), creatine kinase isoenzyme (CKMB), lactate dehydrogenase (LDH), and troponin I (cTnI) were automatically measured using a biochemical analyzer.

Enzyme-linked immunosorbent assay (ELISA)

We collected the mouse serum after 24 h of reperfusion. In accordance with the manufacturer's instructions, we measured the levels of IL-1β and IL-18 in the blood using the ELISA method (Abcam, ab216165, ab197742).

Cell culture and treatment

HUVECs were obtained from the Cell Bank of the Chinese Academy of Sciences located in Shanghai, China. After removing from liquid nitrogen, the frozen HUVECs were ablated in a water bath of 37 °C, and centrifuged at 800 rpm for 2 min. We discarded the supernatant, added complete DMEM medium and pipetted it into a cell suspension. Next, we distributed it evenly on a petri dish and then incubated the dish in a cell incubator at 37 °C with 5% CO2 for cultivation. Upon reaching 80% confluence, HUVECs were subjected to digestion using trypsin and then subcultured. Initially, HUVECs were cultured to a confluence range of 30%-35% under normoxic conditions. Afterward, they were divided into 4 groups (n = 3 per group): (1) Control group (Control): HUVECs were cultured in normoxic conditions; (2) Model group (Model): After being exposed to hypoxic conditions (1%O2, 5%CO2, 94%N2) for 6 h in a three-gas incubator, the cells were returned to normal oxygen levels and then cultured for 18 h to create a hypoxia/reoxygenation (H/R) model as previously described (Li et al. 2020b); (3) H/R + TXL group (TXL): A 4-h pretreatment with TXL (400 μg/ml) was given before establishing the H/R model, and TXL intervention continued until the end of the experiment; (4) H/R + Rg3 group (Rg3): A 4-h pretreatment with Rg3 (10 μmol/L) was given before establishing the H/R model, and Rg3 intervention continued until the end of the experiment.

qRT-PCR

HUVECs were subjected to RNA extraction using the EastepTM Total RNA Extraction Kit from Promega in America. Then we used the PrimeScriptTM Synthesis Kit (TaKaRa, China) to perform reverse transcription of cDNA. After consulting the SYBR Green PCR Master Mix (TaKaRa, China), we utilized GAPDH as the internal reference gene and performed quantitative PCR using the 7900 Real-time PCR system. The 2-ΔΔCt method was utilized for statistical analysis. The table displays the primer sequences for the RT-PCR used in this study (Table 1).

Table 1.

RT-PCR primer sequences

Genes	Forward (5′ → 3′)	Reverse (5′ → 3′)
NLRP3	AAGGAGGAAGAGGAGGAGGAA	TGCTGAGGACCAAGGAGATG
Caspase-1	CCACATCCTCAGGCTCAGAAG	TGCGGCTTGACTTGTCCATTA
Caspase-3	ATTGTGAGGCGGTTGTAGAAG	GATATTCCAGAGTCCATTGATTCG
IL-1β	GATGGCTTATTACAGTGGCAATG	TAGTGGTGGTCGGAGATTCG
IL-18	TCGCTTCCTCTCGCAACA	GCATTATCTCTACAGTCAGAATCAG

Western blot analysis

The protein levels in samples of mouse cardiac tissue and HUVECs were measured using the BCA kit for protein quantification, followed by the performance of SDS–polyacrylamide gel electrophoresis. Following the completion of electrophoresis, semi-dry transfer membrane was conducted, facilitating the transfer of proteins onto the PVDF membrane. When the transfer is finished, put it in Odyssey® blocking buffer and block it for 2 h at 37 °C. The Marker was used to guide the cutting of the target molecular weight position, which was then placed in the primary antibody dilution solution (NF-κB, NLRP3, Caspase-1, GSDMD, IL-1β, IL-18) (Table 2), and left to incubate overnight at 4 °C. The membrane underwent three washes with 1 × TBST, each for 10 min, followed by incubation in the secondary antibody in the dark for 1 h. After the incubation, the membrane was once again washed. The Odyssey dual-wavelength infrared laser imaging system from LI-COR in Lincoln, USA, was used to scan images. Utilizing GAPDH as an internal control reference, we determined the ratio between the gray values of the target protein, enabling us to evaluate the relative expression levels of the protein within the sample and conduct subsequent statistical analysis.

Table 2.

Primary antibodies

Primary antibodies	Companies	Dilution rate
NF-κB p65	Abcam, ab32536	1:1000
NLRP3	Abcam, ab263899	1:1000
Pro-Caspase-1	Abcam, ab238972	1:1000
cleaved-Caspase-1	Cell Signaling Technology, 89332 s	1:1000
IL-1β	Abcam, ab234437	1:1000
IL-18	Abcam, ab207323	1:1000
GSDMD	Abcam, ab219800	1:1000
β-Actin	Proteintech, 66,009–1-Ig	1:20,000
NLRP3(cell)	Proteintech, 19,771–1-AP	1:1000
Caspase-1	Proteintech, 22,915–1-AP	1:1000
IL-1β	Abcam, ab9722	1:1000
GSDMD	Cell Signaling Technology, 93,709	1:1000
GAPDH	Thermo Fisher, MA5-15,738	1:1000

Acquisition of target profiles of TXL

TXL ingredients were meticulously gathered from various databases including TCM_ID (Chen et al. 2009), TCM_Mesh (Zhang et al. 2017), TCMGeneDIT (Fang et al. 2008), TCMID (Xue et al. 2012; Huang et al. 2018), ETCM (Xu et al. 2019), TM_MC (Kim et al. 2015), TcmSP (Ru et al. 2014), BATMAN-TCM database (Liu et al. 2016). Afterward, the ingredient information was standardized by utilizing the CID number found in the PubChem database (Kim et al. 2019). To thoroughly investigate the potential targets of TXL components, strict quality control criteria and threshold settings were applied during the target prediction process. Specifically, we used multiple target prediction tools including TargetNet (Yao et al. 2016), SwissTargetPrediction (Gfeller et al. 2014), ChEMBL_prediction tool (Bosc et al. 2019), BATMAN-TCM (Liu et al. 2016), STITCH (Szklarczyk et al. 2016), DrugBank (Wishart et al. 2018) and TTD (Wang et al. 2020), ChEMBL (Gaulton et al. 2017) and PubChem (Kim et al. 2016) to retrieve targets. For each compound, only targets with a predicted score or probability above a certain threshold were retained: For TargetNet, we selected targets with a predicted probability ≥ 0.7 (high-confidence predictions); for SwissTargetPrediction, we considered only targets with a probability score ≥ 0.6, which indicates medium-to-high confidence; for ChEMBL_prediction tool, we used a threshold of pCHEMBL ≥ 5 as a cutoff for meaningful bioactivity; in BATMAN-TCM, we set the score cutoff to ≥ 20 to retain only highly confident target predictions; for STITCH, we included only interactions with a combined score ≥ 0.7 (high confidence). The targets were standardized using the UniProt database (Iwasawa et al. 2019) and only targets associated with “Homo sapiens” were retained.

Core mechanism analysis of TXL improving ischemia–reperfusion (I/R) by regulating endothelial cell dysfunction

Five databases including DisGeNET (Piñero et al. 2019), Open Target Platform (Carvalho-Silva et al. 2019), CTD (Davis et al. 2019), MalaCards (Rappaport et al. 2017), GeneCards (Safran et al. 2010) were used to get gene set related to ischemia/reperfusion (I/R) or endothelium dysfunction. Genes meeting the criteria of being present in more than 3 databases are selectively preserved. Overlapping analysis was conducted to explore targets of TXL for improving ischemia–reperfusion by regulating endothelium dysfunction process. By employing STRING Version 11.5 (https://string-db.org/) (Szklarczyk et al. 2017), a network of interactions between proteins (PPI) was created and then displayed using Cytoscape v3.7.1 (Shannon et al. 2003). The importance of each node was assessed based on its degree. Following this, clusterProfiler Version 4.0.3 (Yu et al. 2012) was employed to perform Gene ontology (GO) and REACTOME pathway enrichment analysis in order to pinpoint the central pathway or process and explain the mechanism of TXL systematically.

Molecular docking

To provide further reference for experimental verification, molecular docking method was used to evaluate the binding affinity of compounds with NLRP3, CASP1, and GSDMD. AutoDock Vina 1.1.2 is an open-source molecular docking and virtual screening program that has much higher average binding mode prediction accuracy compared to AutoDock 4 (Trott and Olson 2010). SDF files of compounds from PubChem database (https://pubchem.ncbi.nlm.nih.gov/) (Kim et al. 2016) Download and convert to MOL2 format using Open Babel 2.4.1 (O'Boyle et al. 2011). The crystal structures of CASP1 (PDB ID: 1RWK), GSDMD (PDB ID: 5NH1), and NLRP3 (PDB ID: 7ALV) were obtained from the PDB database (https://www.rcsb.org/) (Karuppasamy et al. 2020) Download. Choose the co crystallization ligand Q27451692 (CID: 5,287,427) of CASP1 and the co crystallization ligand RM5 (CID: 10,195,003) of NLRP3 as positive controls. The PyRx-0.8 software is used to minimize the energy of small molecules, with the aim of optimizing the three-dimensional structure of ligands and finding the lowest energy molecular conformation. Prepare ligands and receptors according to AutoDock Vina 1.1.2 tutorial. Using a rigid docking method, the grid properties during docking are determined based on the spatial position of the co crystallized ligand binding in the protein. The parameters in the x, y, and z dimensions of CASP1 grid coordinates are set to 11.392, with a spacing of 0.375 Å. The positions of the x center, y center, and z center of the grid are 33.162, 60.434, and 4.632, respectively. Set the energy range to 3 and exhaustively set it to 8; The parameters in the x, y, and z dimensions of NLRP3 grid coordinates are set to 17.665, with a spacing of 0.375 Å. The positions of the x center, y center, and z center of the grid are 16.756, 35.449, and 125.714, respectively; The parameters of the grid coordinates x, y, and z dimensions of GSDMD are set to 15.0, 19.5, and 15.0, with a spacing of 0.375 Å. The positions of the x center, y center, and z center of the grid are 6.536, 114.869, and 11.4, respectively. The energy range was set to 3 and exhaustively set it to 8. For each structure, we removed water molecules, added nonpolar hydrogen, calculated Gasteiger charges, and saved them in the PDBQT format. Generally, the lower the Vina score, the higher the Affinity between ligand and receptor. The general selection threshold is binding energy ≤  − 5 kcal/mol (Li et al. 2019, 2012). Finally, Pymol software was used to visualize the interaction mode between compound and target proteins.

Statistical analysis

Statistically analyzing the experimental data, we analyzed and graphed it using SPSS19.0 and GraphPad Prism v5.0 software. Measurement data was presented using the mean ± standard deviation, and when variables presented normal distribution and equal variance, student’s t-test was performed for comparison of data of paired samples and one-way analysis of variance (ANOVA) was used for multiple group comparisons. For multi-group comparisons, post hoc pairwise comparisons were performed with Bonferroni correction to adjust for multiple testing. A significance level of less than 0.05 was deemed statistically significant.

Results

TXL plays a core role in improving I/R by regulating endothelial cell pyroptosis

By conducting intersection analysis of TXL targets, I/R gene sets, and endothelium dysfunction, a total of 40 targets were identified (Fig. 1A). They are key targets for TXL to improve I/R by regulating endothelial cell dysfunction. Furthermore, by conducting enrichment analysis on the above targets, key pathways or biological processes through which TXL improves I/R by regulating endothelial cell dysfunction were identified (Tables 3 and 4). Analysis revealed significant regulation of pathways related to pyroptosis and inflammation (Fig. 1B). In addition, PPI network analysis revealed that targets such as IL1B, CASP1, IL18, TNF, CASP8, NLRP3, RELA, CASP3, and GSDMD are located at the core of the network (Fig. 1C, D).

Fig. 1.

TXL plays a key role in improving I/R by regulating endothelial cell pyroptosis. A Intersection analysis of TXL targets, I/R gene sets, and endothelium dysfunction. B Biological process enriched by 40 TXL targets. (C) PPI network of 40 TXL targets. D Top 20 targets in PPI network

Table 3.

Top20 Gene ontology (GO) biological process enriched by 40 TXL targets

Description	q-value	Gene_Name
pyroptosis	1.46E-28	NLRP3/CASP1/CASP4/CASP6/CASP8/DHX9/DPP9/ELANE/GSDMD/NAIP/NLRP1/PYCARD/TREM2/ZBP1
cellular response to chemical stress	2.38E-25	CASP3/NLRP3/CASP1/PYCARD/TREM2/TNF/IL6/NFE2L2/BCL2/HMOX1/RELA/MPO/AKT1/PTGS2/BECN1/IL10/TLR4/CAT/EIF2AK3/MTOR/PARP1/SIRT1
positive regulation of inflammatory response	4.18E-21	NLRP3/CASP1/CASP4/DHX9/NAIP/NLRP1/PYCARD/TREM2/ZBP1/IL1B/IL18/TNF/IL6/NFKBIA/PTGS2/TLR4
positive regulation of cytokine production	9.50E-21	NLRP3/CASP1/CASP8/DHX9/ELANE/GSDMD/NAIP/NLRP1/PYCARD/TREM2/IL1B/IL18/TNF/IL6/HMOX1/RELA/PTGS2/IL10/TLR4/EIF2AK3/SIRT1
regulation of inflammatory response	4.89E-19	NLRP3/CASP1/CASP4/DHX9/ELANE/NAIP/NLRP1/PYCARD/TREM2/ZBP1/IL1B/IL18/TNF/IL6/RELA/NFKBIA/PTGS2/IL10/TLR4
response to lipopolysaccharide	6.09E-19	CASP3/NLRP3/CASP1/CASP8/ELANE/PYCARD/TREM2/IL1B/IL18/TNF/IL6/RELA/MPO/NFKBIA/AKT1/PTGS2/IL10/TLR4
response to molecule of bacterial origin	1.52E-18	CASP3/NLRP3/CASP1/CASP8/ELANE/PYCARD/TREM2/IL1B/IL18/TNF/IL6/RELA/MPO/NFKBIA/AKT1/PTGS2/IL10/TLR4
positive regulation of defense response	3.75E-17	NLRP3/CASP1/CASP4/CASP6/DHX9/NAIP/NLRP1/PYCARD/TREM2/ZBP1/IL1B/IL18/TNF/IL6/RELA/NFKBIA/PTGS2/TLR4
intrinsic apoptotic signaling pathway	7.88E-17	CASP3/CASP4/CASP6/PYCARD/TREM2/TNF/NFE2L2/BAX/BCL2/HMOX1/AKT1/PTGS2/BECN1/EIF2AK3/PARP1/SIRT1
cellular response to biotic stimulus	4.05E-16	NLRP3/CASP1/PYCARD/TREM2/IL1B/IL18/TNF/IL6/RELA/NFKBIA/AKT1/HSPA5/IL10/TLR4/EIF2AK3
response to oxidative stress	7.01E-16	CASP3/TREM2/TNF/IL6/NFE2L2/BCL2/HMOX1/RELA/MPO/AKT1/PTGS2/BECN1/IL10/TLR4/CAT/PARP1/SIRT1
cellular response to oxidative stress	1.39E-15	TREM2/TNF/IL6/NFE2L2/BCL2/HMOX1/RELA/MPO/AKT1/BECN1/IL10/TLR4/CAT/PARP1/SIRT1
regulation of innate immune response	1.63E-15	NLRP3/CASP1/CASP6/CASP8/DHX9/NAIP/NLRP1/PYCARD/TREM2/ZBP1/TNF/NFE2L2/RELA/NFKBIA/TLR4/PARP1
regulation of response to biotic stimulus	1.63E-15	NLRP3/CASP1/CASP6/CASP8/DHX9/NAIP/NLRP1/PYCARD/TREM2/ZBP1/IL1B/TNF/NFE2L2/RELA/NFKBIA/TLR4/PARP1
interleukin-1 production	2.84E-15	NLRP3/CASP1/CASP8/GSDMD/NAIP/NLRP1/PYCARD/TREM2/TNF/IL6/IL10/TLR4
regulation of interleukin-1 production	2.84E-15	NLRP3/CASP1/CASP8/GSDMD/NAIP/NLRP1/PYCARD/TREM2/TNF/IL6/IL10/TLR4
positive regulation of interleukin-1 beta production	4.68E-15	NLRP3/CASP1/CASP8/GSDMD/NAIP/NLRP1/PYCARD/TNF/IL6/TLR4
response to tumor necrosis factor	6.55E-15	CASP3/CASP1/CASP4/CASP8/DHX9/NAIP/PYCARD/TNF/NFE2L2/RELA/NFKBIA/AKT1/PTGS2/SIRT1
positive regulation of interleukin-1 production	2.32E-14	NLRP3/CASP1/CASP8/GSDMD/NAIP/NLRP1/PYCARD/TNF/IL6/TLR4
interleukin-1 beta production	2.35E-14	NLRP3/CASP1/CASP8/GSDMD/NAIP/NLRP1/PYCARD/TREM2/TNF/IL6/TLR4

Table 4.

Top20 REACTOME pathways enriched by 40 TXL targets

Description	q-value	Gene_Name
Purinergic signaling in leishmaniasis infection	9.78E-13	NLRP3/CASP1/GSDMD/PYCARD/IL1B/IL18/HMOX1/RELA
Cell recruitment (pro-inflammatory response)	9.78E-13	NLRP3/CASP1/GSDMD/PYCARD/IL1B/IL18/HMOX1/RELA
Pyroptosis	1.29E-12	CASP3/CASP1/CASP4/ELANE/GSDMD/IL1B/IL18/BAX
Programmed Cell Death	4.04E-12	CASP3/CASP1/CASP4/CASP6/CASP8/ELANE/GSDMD/IL1B/IL18/BAX/BCL2/AKT1/TLR4
Nucleotide-binding domain leucine rich repeat containing receptor (NLR) signaling pathways	5.58E-12	NLRP3/CASP1/CASP4/CASP8/NLRP1/PYCARD/BCL2/HMOX1/RELA
Regulated Necrosis	7.58E-12	CASP3/CASP1/CASP4/CASP8/ELANE/GSDMD/IL1B/IL18/BAX
Inflammasomes	7.66E-12	NLRP3/CASP1/NLRP1/PYCARD/BCL2/HMOX1/RELA
Signaling by Interleukins	1.37E-11	CASP3/CASP1/CASP8/GSDMD/IL1B/IL18/TNF/IL6/BCL2/HMOX1/RELA/SQSTM1/NFKBIA/AKT1/PTGS2/IL10
Interleukin-4 and Interleukin-13 signaling	1.20E-09	IL1B/IL18/TNF/IL6/BCL2/HMOX1/AKT1/PTGS2/IL10
Leishmania infection	1.67E-09	NLRP3/CASP1/GSDMD/PYCARD/IL1B/IL18/IL6/HMOX1/RELA/IL10
Parasitic Infection Pathways	1.67E-09	NLRP3/CASP1/GSDMD/PYCARD/IL1B/IL18/IL6/HMOX1/RELA/IL10
The NLRP3 inflammasome	2.04E-08	NLRP3/CASP1/PYCARD/HMOX1/RELA
Interleukin-10 signaling	1.26E-07	IL1B/IL18/TNF/IL6/PTGS2/IL10
Intrinsic Pathway for Apoptosis	3.10E-07	CASP3/CASP8/GSDMD/BAX/BCL2/AKT1
Interleukin-1 family signaling	3.82E-07	CASP1/CASP8/GSDMD/IL1B/IL18/RELA/SQSTM1/NFKBIA
Apoptosis	1.27E-06	CASP3/CASP6/CASP8/GSDMD/BAX/BCL2/AKT1/TLR4
SARS-CoV-1 activates/modulates innate immune responses	2.05E-06	NLRP3/CASP1/PYCARD/RELA/NFKBIA
RIP-mediated NFkB activation via ZBP1	2.45E-06	DHX9/ZBP1/RELA/NFKBIA
ZBP1(DAI) mediated induction of type I IFNs	5.78E-06	DHX9/ZBP1/RELA/NFKBIA
SARS-CoV Infections	5.89E-05	NLRP3/CASP1/PYCARD/ZBP1/NFE2L2/RELA/NFKBIA/AKT1/BECN1

TXL improved the myocardial necrosis and the cardiac function injury after myocardial I/R

Following a 7-day administration of TXL via gavage, the LAD was ligated for a period of 45 min, and then subjected to 24 h of reperfusion. After 24 h of reperfusion, echocardiography was used to assess the performance of the mouse heart (Fig. 2A). A significant difference was noted in cardiac function between the sham operation group and the model group, showing a decrease in EF% and significant increases in both LVEDV and LVESV (P < 0.05). The group that received TXL pretreatment displayed an enhancement in cardiac function post-myocardial I/R injury, showcasing reductions in LVEDV and LVESV, as well as an increase in EF% (P < 0.05) (Fig. 2B). The M-mode echocardiographic data confirmed that TXL pretreatment significantly improved cardiac function following myocardial I/R injury, as evidenced by reduced LVEDD and LVESD, along with a marked increase in ejection fraction (EF%) (Fig. S1). These findings are consistent with the conclusion that TXL exerts a protective effect on cardiac function under I/R conditions. Analysis of myocardial enzyme levels revealed significant elevations in CK, CKMB, LDH and c-TnI within the model group. Interestingly, the TXL pretreatment group displayed notable reductions in levels of CK, CKMB, LDH and c-TnI (Fig. 2C).

Fig. 2.

TXL Improved the Myocardial Necrosis and the Cardiac Function injury After Myocardial I/R. A Echocardiography of cardiac function in mice 24 h after myocardial I/R and B analysis of LVESV, LVEDV and EF measurement data. C Serum myocardial enzyme levels of CK, CKMB, LDH, c-TNI. Data are shown as the mean ± SD, n = 3, **P < 0.01 vs. sham operation group; *P < 0.05 vs. sham operation group; ##P < 0.01 vs. model group; #P < 0.05 vs. model group

TXL pretreatment inhibits the penetration of inflammatory cells, decreases the secretion of inflammatory factors, and attenuates pyroptosis in myocardial tissue after MIRI

After I/R injury to the myocardium, the model group examined the mid-ventricular short-axis cross-section of mice using HE and TUNEL staining. Extensive myocardial necrosis was observed, with a substantial infiltration of neutrophils in the ischemic region, some of which migrated into the blood vessels (Fig. 3A). ELISA analysis showed a notable rise in IL-18 and IL-1β serum levels in the model group (Fig. 3B). TXL pretreatment significantly reduced the influx of inflammatory cells and the secretion of inflammatory mediators, thereby reducing the severity of the inflammatory reaction. Pyroptosis, a cell death mode that is pro-inflammatory and programmed, can be recognized in mouse myocardial tissue following I/R using the TUNEL method. Upon comparing the TXL pretreatment group in comparison to the model group, a notable reduction in the quantity of TUNEL-positive cells was observed (Fig. 3C). Immunofluorescence analysis indicated a rise in the expression of Caspase-3, a protein associated with apoptosis, aligning with past studies (Fig. 3D).

Fig. 3.

TXL Pretreatment Inhibits the Penetration of Inflammatory Cells, Decreases the Secretion of Inflammatory Factors, and Hinders Pyroptosis in Myocardial Tissue after MIRI. A Neutrophils infiltrated in the ischemic area, and the neutrophils migrating into the blood vessels are observed by the mid-ventricular short-axis cross-section of the mice (200x). B The serum IL-18 and IL-1β levels of the mice 24 h after myocardial I/R were detected by ELISA. C TUNEL staining pictures of the mice 24 h after myocardial I/R (scale bar: 20um). D Immunofluorescence staining pictures of Caspase-3 of the mice 24 h after myocardial I/R (scale bar: 25um). Nuclear staining with DAPI (blue). Data are shown as the mean ± SD. n = 3, **P < 0.01 versus sham operation group; *P < 0.05 vs. sham operation group; ##P < 0.01 vs. model group; #P < 0.05 vs. model group

TXL blocks pyroptosis by targeting the NLRP3/Caspase-1/GSDMD signaling pathway

To explore the connection between pyroptosis and MIRI, the levels of GSDMD, an important factor in pyroptosis, were examined in the heart tissues. Enhanced levels of GSDMD protein were observed in the model group. Additionally, NLRP3 and activated Caspase-1 exhibited elevated levels following the occurrence of MIRI. Our research indicates that the NLRP3 inflammasome signaling pathway plays a crucial role in triggering pyroptosis and contributing to MIRI. Additionally, we observed an increase in inflammatory molecules both before and after MIRI in this pathway, such as NF-κB p65, IL-1β, and IL-18 (Fig. 4A, B). Immunofluorescence staining showed a significant rise in NF-κB p65, Caspase-1, GSDMD, and IL-18 expression following myocardial ischemia/reperfusion (Fig. 4C–F), in line with the previous findings. The levels of pyroptosis-related proteins including NF-κB p65, NLRP3, cleaved-Caspase-1, GSDMD, IL-1β, and IL-18 were notably reduced in the TXL group compared to the sham group, as indicated by WB and histopathology results (Fig. 4G, P < 0.01). The flow cytometry results also confirmed this conclusion (Fig. 4H).

Fig. 4.

TXL Blocks Pyroptosis by Targeting the NLRP3/Caspase-1/GSDMD Signaling Pathway. A Western blot analysis of pyroptosis-related protein expression: NLRP3, pro-Caspase-1, cleaved-Caspase-1, GSDMD, NF-κB p65, IL-1β and IL-18 of the mice 24 h after myocardial I/R and B quantitative measurement of relative protein expression. C–G Immunofluorescence staining pictures of NF-κB p65, Caspase-1, GSDMD and IL-18 of the mice 24 h after myocardial I/R. Nuclear staining with DAPI (blue), scale bar: 25um. (H) The Annexin V/PI staining of pyroptosis rate in each group. Data are shown as the mean ± SD. n = 3, **P < 0.01 vs. sham operation group; *P < 0.05 vs. sham operation group; ##P < 0.01 vs. model group; #P < 0.05 vs. model group

The NLRP3/GSDMD/Caspase-1 pathway regulates the inflammatory response and pyroptosis in HUVECs induced by H/R

HUVECs showed significantly higher levels of pro-inflammatory cytokine IL-1β and pyroptosis-specific proteins NLRP3, cleaved-Caspase-1, and GSDMD after H/R induction, compared to the sham group (Fig. 5A, B). IL-18 and IL-1β mRNA levels were significantly increased as well (Fig. 5C). Prior exposure of HUVECs to 400 μg/ml TXL led to a notable reduction in the protein levels of IL-1β, NLRP3, cleaved-Caspase-1, and GSDMD, along with decreased mRNA levels of IL-18 and IL-1β. This may be explained by that TXL may reduce NLRP3 and cleaved-Caspase-1 protein levels through post-translational mechanisms, such as enhancing proteasomal or autophagic degradation, inhibiting inflammasome assembly, or modulating miRNA expression that targets their mRNAs, thereby suppressing translation without affecting transcription.

Fig. 5.

The NLRP3/GSDMD/Caspase-1 pathway regulates the inflammatory response and pyroptosis in HUVECs induced by H/R. A Western blot analysis of pyroptosis-related protein expression: NLRP3, cleaved-Caspase-1, GSDMD and IL-1β in HUVECs induced by H/R and B quantitative measurement of relative protein expression. C The expression of IL-18mRNA, IL-1βmRNA, Caspase-1mRNA, Caspase-3mRNA, and NLRP3mRNA are detected by RT-PCR. Data are shown as the mean ± SD. n = 3, *P < 0.05 vs. sham operation group; ##P < 0.01 vs. model group; #P < 0.05 versus model group

Rg3 alleviates myocardial ischemia–reperfusion injury by inhibiting the pyroptosis of endothelial cells via the NLRP3/Caspase-1/GSDMD signaling pathway

Ginseng is one of the main components of TXL, and ginsenoside Rg3 is an important active component in ginseng. Previous studies have shown that ginsenoside-Rg3 has a significant protective effect on MIRI. Its mechanism involves many aspects such as anti-oxidation, anti-inflammation, inhibition of apoptosis, ameliorate ferroptosis and regulation of energy metabolism (Zhang and Jiang 2016; Wang et al. 2015; Zhong et al. 2024; Hien et al. 2010). Therefore, in our study, Rg3 was used as the entry point to explore the cardioprotective mechanism of TXL in IRI. We found that the protein expression levels of IL-1β, NLRP3, cleaved-Caspase-1 and GSDMD in the model group were significantly up regulated than those in the control group. After pretreated HUVECs cells with Rg3 (10 μmol/L), the expression levels of IL-1β, NLRP3, cleaved-Caspase-1 and GSDMD were significantly decreased (Fig. 6A, B).

Fig. 6.

Ginsenoside Rg3 alleviates IRI via the NLRP3/Caspase-1/GSDMD signaling pathway. A Western blot analysis of pyroptosis-related protein expression: NLRP3, cleaved-Caspase-1, GSDMD and IL-1β in HUVECs induced by H/R and B quantitative measurement of relative protein expression. Data are shown as the mean ± SD. n = 3, *P < 0.05 vs. sham operation group; ##P < 0.01 vs. model group; #P < 0.05 vs. model group

Exploring the interaction mode between ginsenoside Rg3 and NLRP3, GSDMD

At the molecular level, molecular docking analysis revealed that ginsenoside Rg3 can directly interact with NLRP3 and GSDMD, but not with CASP3. Ginsenoside Rg3 has the lowest affinity for GSDMD, with a binding energy of − 17.7 kcal/mol. Analysis of the docking conformation of ginsenoside Rg3 with the JAK2 protein (Fig. 7A) indicates that ginsenoside Rg3 could successfully dock with the active pocket of the NLRP3 protein. This compound forms hydrogen bonds with the amino acids GLN624 and THR439, and engages in Alkyl or Pi- Alkyl interaction with amino acids VAL353, PRO352, ALA227, LEU628, TYR632, and PHE410. Figure 7B shows ginsenoside Rg3 situated within the GSDMD protein, forming Alkyl bonds with VAL364, LEU308, LEU358, and LEU367.

Fig. 7.

The interaction mode between ginsenoside Rg3 and A NLRP3, B GSDMD

Discussion

Our study demonstrates that TXL, a compound of traditional Chinese medicine, exhibits a multi-target therapeutic effect on myocardial ischemia–reperfusion injury (MIRI). Preliminary studies have confirmed that TXL can alleviate MIRI by inhibiting apoptosis (Xiang-Dong et al. 2013; Hehe Cui 2016; Hout et al. 2016). We found that TXL not only inhibits apoptosis but also suppresses pyroptosis in cardiac tissue. Pyroptosis was identified as a pivotal factor in the pathological process of MIRI, leading to myocardial necrosis and subsequent cardiac dysfunction. Pre-treatment with TXL significantly reduced heart tissue damage and improved cardiac performance. These protective effects were attributed to the ability of TXL to suppress the activation of GSDMD through the targeting of the NLRP3, Caspase-1, and GSDMD signaling pathway. Furthermore, both TXL and Rg3 pretreatment effectively decreased the release of inflammatory cytokines, thus attenuating pro-inflammatory pyroptosis. These findings provide novel perspectives on the cardioprotective effects of TXL in instances of MIRI.

In mice subjected to MIRI modeling, myocardial damage and impairment of left ventricular systolic function were observed. These are manifested by increased myocardial enzyme (CK, CKMB, cTnI, LDH), decreased LVEF, as well as enlarged LVEDV and LVESV. By TXL pretreating, these indexes are all significantly improved. Considering that the area of myocardial I/R injury was confirm by magnetic resonance technology to coincide with the area of increased vascular endothelial permeability (Ruder et al. 2013), protecting the microvascular endothelial barrier from injury is essential for the restoration of heart tissue following reperfusion injury. According to traditional Chinese medicine principles, the development of no-reflow in the heart muscle and the harm caused by MIRI after reperfusion treatment in patients with STEMI is considered a type of “vessel-collateral-vascular system disease”. This corresponds to microvascular obstruction and dysfunction happening in the area of the infarction. Therefore, if TXL can protect the heart's small blood vessels from damage and improve blood flow to the heart muscle, it is expected to prevent and treat heart muscle reperfusion and injury in patients with acute myocardial infarction. Meanwhile, protecting vascular endothelial cells is the core function of TXL (Chen et al. 2018, 2020; Chang et al. 2017; Kuang et al. 2022; Qi et al. 2020). Our study used network pharmacology methods to perform intersection analysis and enrichment analysis on TXL component targets, I/R injury gene set and endothelial dysfunction gene set, and found that TXL improves MIRI. The main biological processes and key pathways focus on pyroptosis and its related inflammatory responses. Hence, we utilized both the in vivo I/R injury model and the in vitro H/R injury model to validate if TXL can alleviate MIRI by inhibiting endothelial cell pyroptosis and its specific mechanism.

Earlier research has demonstrated that blocking NLRP3 inflammasome activation during early reperfusion after AMI can improve the inflammation response, and the injury of cardiac microvascular endothelial cells and cardiomyocytes, thereby alleviating cardiac I/R injury, which is a process involving NLRP3/Caspase-1/GSDMD induced pyroptosis (Bai et al. 2020; Wu et al. 2021). After the occurrence of AMI, cellular damage and death are the outcomes of acute myocardial ischemia affecting various components of myocardial tissue, such as cardiomyocytes, endothelial cells, fibroblasts, and stroma. The innate immune response is activated by cell necrosis, resulting in the initial acute inflammatory reaction. This process involves the release of fragments of mitochondrial DNA as DAMPs into tissues, complement activation, and the formation of inflammatory bodies (Liu et al. 2022), and so on. Necrotic cells trigger the immune response, resulting in the mobilization of immune cells to the damaged heart tissue, inducing a strong inflammatory reaction. Reperfusion after PCI aggravates the pro-inflammatory response, leading to myocardial cell death and myocardial injury, which occur 6–24 h after reperfusion. MIRI is primarily caused by this factor (Zhi-Qing et al. 2000, 2001). DAMPs released after an acute myocardial infarction trigger NF-κB, which then calls upon and activates Caspase-1 through the activation of the NLRP3 inflammasome, leading to the subsequent cleavage and activation of GSDMD, IL-1β, and IL-18. The creation of GSDMD membrane pores (10–15 nm) results in cell swelling and bursting, leading to the release of inflammatory cytokines IL-1β and IL-18 (Liu et al. 2022). The extensive damage to capillary endothelial cells caused by pyroptosis of vascular endothelial cells results in microcirculation impairment and obstructed myocardial reperfusion, which is a crucial factor in reperfusion-induced cardiomyocyte death following AMI (Ong et al. 2018). Our research found that following MIRI, a significant amount of neutrophils infiltrated the ischemic area and then moved into the blood vessels, leading to an increase in the levels of IL-1β and IL-18 in the bloodstream. Furthermore, the levels of IL-1β and IL-18 protein and mRNA were significantly increased in myocardial tissue and HUVECs. Moreover, the data that is accessible indicates that proteins associated with pyroptosis, including NF-κB, NLRP3, cleaved-Caspase1, IL-1β, IL-18, and GSDMD-N, showed a notable increase in expression in the mouse model of I/R injury and H/R HUVECs. Upon pretreatment with TXL, there was an observable decrease in inflammatory response, release and expression of inflammatory factors, as well as myocardial necrosis. Cardiac function also saw improvement, alongside a decrease in the expression of pyroptosis-specific proteins.

Ginseng is one of the main components of TXL, and ginsenoside Rg3 is an important active component in ginseng. Liping Zhang et al. found that Rg3 could significantly reduce the expression of TNF-α and IL-1β in the left ventricle of rats with myocardial ischemia–reperfusion, reduce inflammatory response, improve cardiac function (Li et al. 2012). Moreover, it can increase the expression of endothelial nitric oxide synthase (eNOS) and the production of nitric oxide (NO), inhibit oxidative stress and cell apoptosis through Akt/eNOS signaling pathway and Bcl-2/Bax pathway, and alleviate MIRI injury (Li et al. 2012; Zhang and Jiang 2016; Hien et al. 2010). Guofu Zhong and his colleagues have confirmed through their research that Rg3 inhibited ferroptosis and alleviated MIRI through the keap1/Nrf2/GPX4 signaling pathway (Zhong et al. 2024). In this study, we found that pretreatment of HUVECs with ginsenoside Rg3 inhibited NLRP3 activation, further blocked Caspase-1 and GSDMD activation, and inhibited pyroptosis and the release of downstream inflammatory factors. Meanwhile, molecular docking was used to explore the interaction mode between ginsenoside Rg3 and pyroptosis target proteins. The results also confirmed that Rg3 could successfully dock with the active sites of NLRP3 and GSDMD proteins, and had a potential intervention effect on the pyroptosis pathway.

In conclusion, TXL preconditioning can attenuate endothelial dysfunction and MIRI and enhance cardiac function by inhibiting NLRP3/Caspase-1/ GSDMD-mediated pyroptosis. Our study identifies ginsenoside Rg3, a key bioactive component of TXL, as a novel inhibitor of endothelial pyroptosis, a major contributor to microvascular dysfunction after reperfusion. By targeting the NLRP3/Caspase-1/GSDMD pathway, Rg3 helps preserve vascular integrity and may reduce microvascular obstruction—a common complication following PCI in AMI patients. These findings highlight its potential as a targeted therapy for improving myocardial perfusion and clinical outcomes. Furthermore, our integrated approach using network pharmacology, molecular docking, and experimental validation offers a valuable framework for studying complex herbal medicines and discovering other TCM-derived compounds with therapeutic potential. Our work provides a foundation for future preclinical and clinical evaluation of Rg3 as an adjunct in AMI treatment.

Although there are important discoveries revealed by the study, it only explored the whole phenomenon in the organism without further distinguishing the cell types involved. Considering vascular endothelial cells are the primary cells in the normal myocardial tissues, and the core function of TXL is protecting vascular endothelial cells, we select vascular endothelial cell for study. However, further research on the types of cells involved is still needed. In addition, while we identified ginsenoside Rg3 as a key component that may interact with NLRP3 and GSDMD reducing the pyroptosis in HUVECs through molecular docking, we did not evaluate its individual effects in the animal experiments, and the precise molecular targets and upstream mechanisms remain unclear. Future studies comparing the efficacy of Rg3 alone versus the full TXL formulation will help clarify its specific contribution, and the surface plasmon resonance (SPR), Co-IP and pull-down assays are necessary to determine whether ginsenoside Rg3 acts directly on these proteins or through intermediate regulators. More importantly, due to technical and resource constraints, we were unable to evaluate long-term outcomes beyond the acute phase (24 h post-reperfusion), such as cardiac remodeling, fibrosis, or survival rates. These endpoints are crucial for assessing the translational potential of Rg3 and will be explored in future studies.

Conclusions

Our findings support the idea that microcirculation I/R injury caused by myocardial I/R depends on the NLRP3/Caspase-1/GSDMD pathway for generating the pro-inflammatory cytokine IL-1β and triggering GSDMD to induce pyroptosis. TXL pretreatment can decrease the cardiac inflammatory cell infiltration, inflammatory cytokine release, and vascular endothelial cell pyroptosis following I/R injury by inhibiting the NLRP3/Caspase-1/GSDMD pathway. Further, exert the protective effect on the microcirculation endothelial barrier function.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Xuan Wu: specializes in methodology, software development, data curation, and writing original drafts. Yun-long Hou, Tong-xing Wang, Li-ping Chang, Hong-ru Zhou, Ming-ye Wang: Collecting-Assembling the data, Analyzing-Interpreting the data. Yi-ling Wu: Conceptualization, Writing- Reviewing and Editing.

Funding

The Scientific Research Project of the Hebei Provincial Administration of Traditional Chinese Medicine funded this study (grant number 2022216).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Conflicts of interest

The authors declare no competing interests.

Ethical approval and consent to participate

This study was conducted in accordance with the Declaration of Helsinki and approved by the ethics committee of Shijiazhuang Yiling Pharmaceutical Corporation (Approval No. N2020063). We obtained signed informed consent from the participants / legal guardians in this study.