Capturing avian somatic cells using feather pulp fibroblast culture as a non-invasive approach to biobanking endangered birds

Abstract

Avian cells biobanking is an essential tool to safeguard the biodiversity of rare or endangered species. Reproductive germ cells are especially useful for species conservation as they can either be used directly as functional gametes or differentiated into functional gametes in vitro. However, obtaining and preserving avian germ cells is difficult and usually the number of breeding individuals and available surplus eggs are limited. In contrast, avian fibroblast cells are readily obtained using minimally invasive biopsies which makes them ideal for the establishment of genetic cellular resource biobanks for species in need. Improvements in fibroblast culture conditions will enable more extensive studies in physiology and genetics, among others, which are not currently available for most bird species, in addition to providing material for induced pluripotent stem cell generation. Here, we tested different culture protocols to improve the recovery and proliferation rates of fibroblasts derived from feather follicles of Red-and-green Macaw (Ara chloropterus, Psittacidae). We found that feathers collected during their initial growth phase (< 10 days after plucking) have the best potential for culturing and biobanking. We also determined that the inclusion of FGF-2 and IGF-1 in the culture media was decisive for their proliferation and viability. Under these conditions we were able to integrate the reprogramming factors Nanog and Pou5f3, resulting the generation of several fibroblast cell lines immortalized. These findings validated the use of growing feathers as an effective and non-invasive approach to obtain genetic material for avian biobanks with a wide range of applications.

Introduction

Conservation efforts usually arrive too late for birds whose genetic losses exceed the species’ ability to recover. Over the past five centuries, about 200 bird species have become extinct and currently several bird species have little chance of recovery without proper management due to their small remaining populations (Lees et al. 2022). Although the creation of protected areas is the best action for conserving biodiversity, in many cases this alone is not enough to safeguard a species (Develey 2021). Consequently, about 2% of all mammals now have their sperm and oocytes collected and frozen as a way to safeguard their genetic diversity (Hildebrandt et al. 2021). Of these, 25 species have had live births from cryopreserved embryos (Hildebrandt et al. 2021; Blank et al. 2022). However, avian oocytes and embryos are still not efficiently preserved due to the large amount of yolk stored in the eggs. Furthermore, avian spermatozoa are highly susceptibility to damage from cryopreservation (Blank et al. 2020). In contrast, researchers dedicated to bird conservation are developing the use of primordial germ cells (PGC) (Hu et al. 2024) as well as spermatogonial and oogonia cells to contribute to germplasm biobanks (Meng et al. 2023; Blank et al. 2024a, b). Avian PGCs can be efficiently cryopreserved and transplanted into partially or fully sterilized recipients to create chimeric birds whose donor cells are incorporated into their gonads forming functional gametes (Nakamura et al. 2008, 2010; Woodcock et al. 2019; Ballantyne et al. 2021; Hu et al. 2022; Jung et al. 2023). Nevertheless, a large number of donor cells are required to successfully produce these chimeras, a circumstance that demands efficient germ cell culture systems for the application of this technology in the conservation of endangered birds. Furthermore, PGC collection entails embryo manipulation or, as a last resort, the isolation of gonads after the culling of the donor embryo. For these reasons, PGCs and gonadal germ cells have not yet been routinely used as a source of germplasm for wild bird biobanks.

Fibroblasts from adult feather pulp, on the other hand, can be isolated during molting or after scheduled feather removal, which makes this a more accessible and less invasive alternative. Although the culture of somatic cells from feather follicles (FF) has been reported for more than six decades (Sasaki et al. 1968; Payne et al. 1985; Kjelland and Kraemer 2012; Cardoso et al. 2020; Kroglund et al. 2022), their isolation and derivation are usually limited to a few thousand cells grown in 96 well plates even after long periods of culture. Fibroblasts can now be reprogrammed into induced pluripotent stem (iPS) cells and potentially into induced primordial germ cells (Takahashi and Yamanaka 2006; Yoshimatsu et al. 2021; Katayama et al. 2022), yet for cell reprogramming procedures (e.g. iPS cells) to be performed, large numbers of fibroblasts are needed, requiring an efficient avian cell culture system. Improvements in the culture of feather pulp fibroblasts (FPFs) may also provide valuable material from non-model avian species for a variety of studies ranging from molecular biology and genetics to comparative physiology and pathology (Jimenez et al. 2014; Madelaire et al. 2022).

Here, we demonstrate an efficient methodology for the isolation, cultivation, freezing and immortalizing of FPFs from Red-and-green Macaws (Ara chloropterus), which can be applied to many domestic and wild avian species. Red-and-green Macaw is one of the largest macaws, measuring almost one meter in length and weighing about one kilogram. It is a gregarious species, inhabiting mainly primary forests. Due to its wide range, the red-and-green Macaw is considered globally a “Low Concern” species. Although it is a fairly common species in the Amazon basin, this macaw is now extinct in the Atlantic Forest and is considered Critically Endangered (CR) in São Paulo state, eastern Brazil, where one tiny population survives in a conservation unit in the western part of this state.

Materials and methods

All experimental procedures were approved by the Ethics Committee on the Use of Animals of the Institute of Biosciences of the University of São Paulo. The collection and use of biological samples from red- and green- Macaws was previously authorized by Chico Mendes Institute for Biodiversity Conservation (ICMBio) under protocol number 28198-5.

Isolation of feather pulp fibroblasts (FPFs)

To ensure a significant number of feathers at the same stage of development, a small area near the neck and back was plucked from each bird. Follicles were collected and digested during three different growth phases (7–10; 14–20; and 30–40 days post-plucking) from twenty Red-and-green Macaw (Ara chloropterus) (Fig. 1). The Red-and-green Macaws were seized from illegal wildlife trade by Brazilian authorities, and their age was estimated to be 90 to 120 days old at the start of this study. At the time of collection, the largest pin feathers were gently plucked by grasping the tip of the sheath as far from the follicle as possible, taking care not to squeeze out the pulp. The feathers were sprayed with disinfectant (e.g. chlorhexidine 0.8%) and 70% ethanol, placed in a clean plastic bag and kept at 4 °C. In the laboratory, the feather sheaths were wiped with gauze soaked in 70% ethanol and pulps were squeezed out and placed in 2 mL microtubes. Four to six feathers were processed in a single tube. Pulps were washed three times with 0.5 mL of PBS (Gibco Cat. No. 14190144) or HBSS (Gibco Cat. No. 14025092) supplemented with 2% antibiotic/antimycotic (Gibco Cat. No. 15240062), for 2 min incubation for each wash. During disinfection and washing, great care was taken to remove debris and blood cells from the pulp tissue. Next, the wash solution was removed following centrifugation (1500 rpm, 5 min) and 0.15 mg/mL of collagenase IV (Sigma-Aldrich Cat. No. C5138) was added. Pulps were completely covered by collagenase solution (500 μL), and gently shaken during incubation for approximately 2–3 h (38 °C, 5% CO₂ and high humidity). Subsequently, the cell suspension was transferred to a conical tube (15 mL) and 1.5 mL of standard fibroblast culture medium (Standard Medium—SM) was added (total volume ~ 2 ml). SM contained DMEM high glucose (Gibco cat. no. 12800017) supplemented with 10% fetal bovine serum (FBS Gibco cat. no. 12657029), 2% chicken serum (CS Sigma-Aldrich cat.no. C5405), 1% l-glutamine (Gibco cat. no. A2916801) and 1% antibiotic–antimycotic). After centrifugation at 1500 rpm, 5 min, the SM was removed and the pellet resuspended in 6–12 mL of enriched fibroblasts culture medium (Enriched Medium—EM), which contained DMEM high glucose supplemented with 15% FBS, 2% CS, 1% l-glutamine, 1% antibiotic–antimycotic, 10 ng/mL of FGF-2 (R&D systems cat. no. 234-FSE) and 5 ng/mL of IGF-1 (R&D systems cat. no. 291-G1). The concentration of FBS and CS was achieved by previous experiments conducted in other avian species and volume of EM culture was adjusted to cell pellet size. Usually, 4–6 pulps will yield approximately 0.2—0.4 mL of cell pellet which is sufficient material for two to four wells of a 6-well plates.

Fig. 1.

Isolation and dissociation of fibroblasts from the feather pulp. a Image of the red-and-green Macaw enclosure and b their typical colorful plumage. c Example of feathers in the mid-growth phase (i.e. < 20 days). d Isolated feathers being washed in a decontamination solution. e Isolated feather pulps (white arrows) deposited in culture plates filled with tissue dissociation medium (DMEM supplemented with collagenase IV)

Culture of FPFs

The culture media was generally changed every 2 days (38 °C, 5% CO₂), however depending on the growth rate of the cells, media changes varied from every 1 to 4 days.

Cryopreservation of FPFs

FPF stocks were frozen after the third passage. The cryopreservation solution contained SM supplemented with 20% FBS (final concentration 30%) and 8% DMSO (Sigma-Aldrich Cat. No. 589569). Each cryogenic vial was filled with 2 × 10⁶ cells/mL, (1.0 ml average volume) placed in a freezing container (Mr. Frosty, Nalgene), and moved to a − 80° C freezer overnight. The next day, cryogenic vials were transferred to liquid nitrogen (− 196 °C) for long term storage. For thawing, cells were kept at room temperature for 2 min and later immersed in a water bath (38 °C, 3 min). For derived fibroblast cryosamples, fibroblasts were only washed once with SM for DMSO removal and cultured following the protocol above.

Assessment of derivation efficiency, cell proliferation, and metabolic activity of FPFs

Cells were passaged when they reached 80–90% confluency and were divided into two wells of a 6-well plates. Cells were evaluated using an inverted microscope (Zeiss Primovert, Oberkochen, Germany), gently detached from wells using accutase (Sigma-Aldrich Cat. No. A6964) and transferred to new wells. Primary cultures were evaluated using the following parameters: number of cultures with adherent cells after 24 h of culture, number of confluent cell cultures, the day on which cell number reached confluency, number of passages that each cell culture took to stop growing, and total duration of the culture.

The proliferative activity of FPFs was determining by population doubling time (PDT) over 7 days (168 h) of culture. In brief, cells (1 × 10⁴ cells/well) were plated in 24-well dishes, cultured for 7 days, detached using accutase, and counted. PDT was estimated according to following equation: $\text{PDT}=T\ast \text{ln}(2)/\text{ln}(\text{Cb}/\text{Ce}),$ in which PDT is the doubling time of the culture (in hours), T is the incubation time (duration of culture), Cb is the number of cell at the beginning of the incubation period, Ce is the number of cell at the end of the incubation period, and ln is the Natural logarithm. Cell viability was performed using the trypan blue assay following the resuspension of the cells, staining aliquots (20 μL) with 0.4% of trypan blue (Sigma-Aldrich cat. no. T8154) at a 1:1 ratio. Cell numbers were determined using a Neubauer chamber, whereas unstained and stained cells were considered viable and non-viable cells, respectively. The percentage of viable cells was estimated by dividing the number of viable cells by the total number of cells multiplied by 100.

FPF metabolic activity was assessed by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. The MTT is a mono-tetrazolium salt that pass through the cell membrane as well as the mitochondrial inner membrane of viable cells and reduced to formazan by oxidoreductase and dehydrogenase enzymes (Ghasemi et al. 2021). Briefly, cells (10 × 10³ cells/well) were cultured overnight (38 °C, 5% CO₂) and then incubated with 2.5 mg/mL of MTT (Invitrogen cat. no. M6494) for 3 h (38 °C, 5% CO₂). The MTT solution was carefully aspirated and DMSO was added as a solubilization solution for MTT, and readings were taken at 590 nm after 5 min of incubation. Considering that our culture media has serum and phenol red, we set up background controls: (1) untreated cells seeded in the well; (2) MTT solution diluted with culture media without cells in the well; and (3) a solvent control in parallel with the same volume (300 μL) of solvent used for the treated cells. All samples and controls were evaluated in duplicate.

Imaging and Immunostaining

Morphological characteristics were observed under a light microscope (Axiovert 5, Carl Zeiss) throughout the culture period to trace cellular and nuclear shapes as well as cytoplasmic extensions. During this period, pulp feather fibroblasts were subjected to F-actin immunostaining (Phalloidin) according to the manufacturer’s protocol. In brief, cells were fixed in 4% paraformaldehyde (Sigma-Aldrich Cat. No. 158127) for 10 min at room temperature, washed three times with PBS, and permeabilized for 20 min using 0.1 Triton X-100 (Sigma-Aldrich cat. no. T8787). Cells were then washed twice with PBS and incubated with blocking solution (DPBS supplemented with 0.05% of Tween 20—Sigma-Aldrich Cat. No. P1379, 1% of BS—Sigma-Aldrich Cat. No. A1470) for 30 min at room temperature. Cells were washed twice with PBS and stained with 0.5 μL/mL (0.01 μM) of rhodamine phalloidin (Invitrogen Cat. No. R415) in TPBS (PBS supplemented with 0.05% of Tween 20) for 1 h at room temperature. Following incubation, cells were washed twice with PBS, and nuclei were counter-stained with 1 μg/mL of DAPI (Invitrogen cat. no. D1306) in TPBS for 4 min at room temperature. Reprogramed feather pulp fibroblasts were also immunostained using pluripotency markers EMA-1 and SSEA-1 (Developmental Studies Hybridoma bank—DSHB Cat. No. AB531885 and AB528475, respectively) with minor modifications of the protocol above-mentioned. Primary antibody incubation was overnight (4 °C) followed by a second incubation (2 h at room temperature) with anti-mouse IgM Alexa-Fluor 488 (Invitrogen Cat. No. A-10680) and anti-mouse IgM Alexa-Fluor 594 (Invitrogen Cat. No. A-21044). Reprogrammed FPFs expressing GFP were fixed, permeabilized and counter-stained with DAPI.

Feather follicle histology

Follicles from three different feather growing stages (i.e., 7–10; 14–20; and 30–40 days after plucking) were fixed in 4% paraformaldehyde, embedded in paraffin, and longitudinally cut into 5 μm serial sections. Sections were stained using hematoxylin–eosin-safranin (HES) staining method and systematically analyzed for changes in tissues and cells.

Reprograming of FPFs

Red-and-green Macaw cells were submitted to a reprogramming procedure as described by Fuet and Pain (Fuet and Pain 2017) using vectors for Pou5f3 (https://benchling.com/s/z60IWjqp/edit) and Nanog (https://benchling.com/s/fcjxDu3U/edit) kindly provided by Dr. Bertrand Pain (Stem cell and Brain Research Institute–University of Lyon, France). Briefly, fibroblasts were seeded in six-well culture plates (250,000 cells/well) one day prior transfection in 3 mL of SM or EM. On the next day, culture medium was removed, cells were rinsed with 0.5 mL of PBS, and then 3 mL of the fresh medium supplemented with 300 μL of the reprogramming solution (Opti-MEM (Gibco cat. no. 31985962) containing 1.6 μg/DNA of transposase (Hybase PiggyBac), 0.8 μg/DNA of each reprogramming factor (Nanog and Pou5f3) and 3 μL of lipofectamine 2000 (Invitrogen cat. no. 11668030)) were added to each well. Following an initial incubation period (37 °C, 5% CO2 for 20 h), culture medium was replaced with SM or EM. Three days after transfection, cells were rinsed with PBS and 3 mL of selective medium (SM or EM supplemented with cSCF (1 ng/mL), cLIF (10 ng/mL), and 75 μg/mL of hygromycin B) was added. These cytokines were obtained from Kingfisher Biotech (cat no. RP1395C and RP1555C) and were dissolved in sterile PBS with 0.1% BSA. Ten to sixteen days after the beginning of the selection, colonies were picked individually and transferred to 48-well plates coated with bovine gelatin (0.1% in sterile H₂O) and filled with 500 μL of proliferation medium (selective medium without hygromycin B). Proliferation medium was replaced every two days and confluent colonies were successively split (1:3) to new wells in which aliquots were collected for RNA isolation.

RNA isolation and RT-qPCR

Gene expression quantification was carried out on FPFs at different growth phases to assess the dermal papilla and feather pulp growth, differentiation, and apoptosis. We also performed reverse transcription of the reprogramming factors (Nanog and Pou5f3), followed by PCR and sequencing of the PCR products, to verify the integration of the plasmid DNA into the endogenous FPF DNA after long-term culture. Control FF pulps were carefully isolated after collection, quickly submerged in RNAprotect tissue solution (Qiagen cat. no. 76104) and incubated overnight (2–8 °C). The solution was removed, and tissue was stored at – 80 °C. All samples were lysed by adding 600 μL of RLT lysis buffer (Qiagen) supplemented with 1% of β-mercaptoethanol (Sigma-Aldrich cat. no. 63689) and agitating until the disappearance of the biological material. RNAs were next extracted from the supernatant using RNeasy Mini Kit (Qiagen cat. no. 74104) following the manufacturer’s recommendations. RNAs were treated with 80 μL of RDD buffer supplemented with DNase I stock solution (Qiagen Cat. No. 79254) and RNAs concentrations were measured with Nanodrop spectrophotometer. The cDNA was synthetized using AffinityScript Kit (Agilent Technologies cat. no. 600559) according to manufacturer’s instruction using 1 μg of pure RNA (260/280 nm ration around 2.0). After synthesis, cDNA was amplified using Phusion High-Fidelity PCR kit with HF buffer (New England Biolabs cat. no. M0531S) following a standard protocol for the final volume of 25 μL. The primers used for the transcript of interest were taken from literature or designed using Primer3 with sequences obtained from NCBI GenBank (Table 1). A dissociation melt curve was performed first to verify that a single product has been amplified. Expression quantification was measured using Fast SYBR Green Dye (invitrogen Cat. No. 11762–100) and PCR reaction was carried out in a thermal cycler (Mastercycler, Eppendorf) with an initial denaturation step at 95 °C for 5 min, followed by thirty cycles of denaturation (95 °C for 30 s), annealing (60 °C for 30 s) and extension (72 °C for 30 s), and a final extension step at 72 °C for 5 min. The Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as housekeeping and the mRNA level of each gene analyzed in early feather pulps was normalized according to the expression of housekeeping gene by 2^−ΔΔCt method being it arbitrarily defined as 0. PCR products also were separated by electrophoresis on 1% agarose gels (110 V for 50 min) and extracted and purified using quick gel extraction kit (Invitrogen Cat. No. K210012) and sent for sequencing.

Table 1.

Quantitative real-time PCR primer information

Gene	Oligonucleotide	Sequence (5′–3′)	Source
Nanog	Forward primer	AGAGCCAGAAGTACCTCAGC	NM_001146142.2
	Reverse primer	GGTATCTTCTGCCTGCAAGC
Pou5f3	Forward primer	GGCTCAATGAGGCAGAGAAC GGACTGGGCTTCACACATTT	Whyte et al. (2015)
	Reverse primer
Wnt6	Forward primer	GGCTATTCCTGTGAGTGCGT	Mallet et al. (2022)
	Reverse primer	CTTGAGTTCCTCTGGGGCAG
Bmp4	Forward primer	GCTGATATGCCTTGCTTGCT	Mallet et al. (2022)
	Reverse primer	ACTTTCTTCCTGCCGGTCTC
Fgf10	Forward primer	CTTGGTGTCTTCCGTCCCTG	Zhang et al. (2018)
	Reverse primer	GCTTTCTCCAGCGGACATCT
Bcl2L11	Forward primer	AGGCCGTCAGCCACTACCT	Reno et al. (2022)
	Reverse primer	TCTTCTGCAAGCGAGTGAGATC
GAPDH	Forward primer	CAGATCAGTTTCTATCAGC	Blank et al. (2024b)
	Reverse primer	TGTGACTTCAATGGTGACA

Statistical analysis

All data are presented as the mean ± standard error of the mean and were analyzed using the SAS System for Windows (SAS Institute Inc., Cary, NC, USA). Data was initially tested to determine variance homogeneity and data normality (Guided Data Analysis—SAS) and when these assumptions were not met, data were transformed using a logarithmic scale. The interaction effect of PDT and Metabolic activity data among tissue type (fresh versus cryopreserved), feather growth phase (early and middle), and culture media condition (enriched versus standard) were evaluated by general linear models’ procedures (PROC GLM—SAS). Differences between groups were analyzed using a t-test (PROC TTEST–SAS) to compare two groups and Fisher’s test (LSD) for multiple groups. The significance level used for a given response variable was P < 0.05.

Results

FPF cultures grow more efficiently from early phase feathers

To assess different culture media for the derivation of Macaw FPFs, feather cell suspensions were cultured using standard medium (SM) or enhanced medium (EM) in control and treatment groups, respectively. SM was used as a control medium because it was previously used in our laboratory for the derivation of embryo fibroblasts from other avian species (chicken, quail and budgerigar). EM was formulated to improve FPF proliferation using FGF-2 and IGF1 ligands to activate the RAS-MAPK (ERK1/2) and PI3K-AKT pathways.

1,200 feather follicles from 20 individual birds were collected at three different growth phases and cultured either before or after freezing using standard or enriched culture medium. Typically, 4 feathers generated sufficient pulp cells for plating into 2 wells of a 6 well plate. These cultures were observed for initial survival at 24 h and then assayed for achieving initial confluency. We found that 75–90% of fresh FPF for early and middle stages survived the initial plating and 15–65% attained initial outgrowth to confluency. That the EM substantially improved the percentage of confluent samples, with cells isolated from early feather pulps exhibiting the best growth (65% EM versus 20% SM) (Table 2).

Table 2.

Assessment of primary culture quality of the red-and-green Macaw feather pulps cells cultured under different conditions

Variables	*Follicle age	Pulp condition	Standard medium	Enriched medium
Number of cultures with attached cells after 24 h	Early	Fresh	85 17/20 (85%)	18/20 (90%)
		Frozen thaw	11/20 (60%)	11/20 (55%)
	Middle	Fresh	14/20 (70%)	15/20 (75%)
		Frozen thaw	6/20 (30%)	7/20 (35%)
	Advanced	Fresh	9/20 (45%)	8/20 (40%)
		Frozen thaw	3/20 (15%)	3/20 (15%)
Number of cultures reaching initial confluencya	Early	Fresh	4/20 (20%)	13/20 (65%)
		Frozen thaw	3/20 (15%)	11/20 (55%)
	Middle	Fresh	3/20 (15%)	9/20 (45%)
		Frozen thaw	1/20 (5%)	4/20 (20%)
	Advanced	Fresh	1/20 (5%)	4/20 (20%)
		Frozen thaw	0/20 (0%)	0/20 (0%)

*Follicle age: Early (7–10 days post-plucking); Middle (14–20 days post-plucking); Advanced (30–40 days post-plucking)

^aPrimary cultures were grown in one well of a 6 well plate for 5–25 days and assessed for attaining confluency

We found that advanced follicular growth phases hindered both the initial establishment and expansion of primary FPF cultures. Cryopreservation also inhibited the initial establishment and expansion of primary FPF cultures, with the worst results obtained when both conditions were combined regardless of the medium used (Table 2).

For both early and middle stage feathers, we obtained a total of 65% of the feather lines from fresh pulps cultured with enriched media reached confluency with growth rates 1.92 times faster (Fig. 2A; 3.25 days versus 6.25 days) and passage numbers 1.35 times higher than any other group (Fig. 2B). Besides, primary cultures of both fresh and frozen feather pulps exhibited typical fibroblast morphologies (Fig. 2D–G) with a uniform distribution of actin filaments (Fig. 3).

Fig. 2.

Assessment of Red-and-green Macaw Feather Pulp Fibroblast (FPF) cultures. a Days needed to reach first confluency, b total passage number attained c total days of growth in culture. d, e Morphological aspect of fresh FPFs after 24 h of culture and at confluency. f, g Morphological aspect of frozen-thawed FPFs after 24 h of culture and at confluency respectively. The symbols (i) in the insets indicate a 2× zoom of an image field. EMF enriched media fresh, SMF standard media fresh, EMC enriched media cryopreserved, SMC standard media cryopreserved. Images are depicted at × 10 of magnification and insets at ×20 of magnification (scale bar 50 μm)

Fig. 3.

F-actin staining of cultures of fresh feather pulp fibroblasts (FPFs) derived from feathers at different stages of growing: early (7–10 days); middle (14–20 days) and advanced (30–40 days) and imaged after 6 days in culture. Scale bar 50 μm

As soon as we had confirmation of a homogeneous cell population free of keratinocytes or other undesirable cells (e.g. melanocytes, fat cells, blood cells), the FPFs were frozen (usually at the third passage) for cell reprogramming tests. However, an aliquot of each cell line was kept in culture to assess its lifespan. These cells maintained their fibroblast morphology after prolonged periods of culture, and apoptotic signs were only observed after 50–70 days in vitro. Surprisingly, cryopreservation did not affect the lifespan of the cells, although we did notice a decline in survival, growth curve and cell division, which culminated in an increase in the time for the sample to reach confluence, followed by a reduction in the number of passages (Fig. 2). High percentages of cell viability were recorded in confluent cultures regardless of the feather growth phase or whether pulps were frozen (Fig. 4A). Nevertheless, fresh cells and cells cultured in enriched medium exhibited greater metabolic and proliferative activity when compared to frozen cells and cells cultured in standard medium, particularly in FPFs from early and middle phase feathers (Fig. 4B, C).

Fig. 4.

Characteristics of fresh and cryopreserved feather pulp fibroblasts (FPFs) assayed after passage two. a Cell viability; b population double time; and c metabolic activity. SM standard media, EM enriched media. B′ and C′ illustrate differences between fresh and cryopreserved FPFs in terms of population double time and metabolic activity, respectively, regardless of the feather growth phase (early and middle). B″ and C″ illustrate differences between standard (SM) and enriched (EM) culture media for the same parameters, also regardless of the feather growth phase. The advanced feather growth phase (i.e., < 40 days post-plucking) is not shown because of the low number of confluent cultures. Asterisks indicate statistically significant differences (P < 0.05) d FPFs following 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. White, pink and purple triangles represent cells with no, low and high metabolic activity, respectively

Feather follicle structure and gene expression changes during regrowth

Due to the low derivation efficiency of FPFs from the middle and advanced growth phases, follicle structures and gene expressions were checked for each follicular stage. The lack of primers specific for scarlet- and green-winged macaws led us to test several heterologous primer pairs targeting different regions of the target gene based on the chicken gene sequence. Even so, several genes intended for evaluation, such as NOTHC, SHH, BMP2, and FGF16, due to their role in feather development (Foth and Rauhut 2020; Chen et al. 2019; Mallet et al. 2022), did not function or showed nonspecific amplification of the DNA product and were ignored. Therefore, after optimising the PCR conditions and using chicken DNA as a control, only Wnt6, BMP4, FGF10, and Bcl2 were considered. These markers are associated with the development and morphogenesis of the feather follicle and subsequent tissue apoptosis to induce branch formation and feather keratinisation (Yu et al. 2002). Consequently, differences in their expression over follicle development (Fig. 5) converged with the morphological aspect of the follicles observed in the tissue histology (Fig. 6). During the feather development, a gradual decline in feather pulp tissue (FP) and degeneration of the dermal papilla (DP) were noted. The basal and intermediate layers of the proliferative zone underwent structural alterations, where the mesenchymal tissue was progressively substituted by keratinized barbules.

Fig. 5.

The mRNA expression of genes linked to cell growth and apoptosis during feather growth in vivo in Red-and-green Macaw. Values are expressed as arbitrary units of mRNA normalized against the expression levels of early feather pulp (arbitrarily defined as 0) amplified from the same target. Asterisks indicate statistically significant differences among feather growth phases

Fig. 6.

Histological structure of feather follicles from red-and-green macaw at different growth phases. a, b Early (< 10 days post-plucking); c, d middle (< 20 days post-plucking); and e, f Advanced (> 40 days post-plucking). Overview of a typical feather follicle focused on the dermal papilla (DP) and proliferation zone (unfilled rectangles) showing the follicular wall (fw), feather sheath (fs), intermediate layer (Inl), basal layer (bal), and feather pulp (fp). Note the fp reduction over the feather development with gradual substitution of mesenchymal tissue to keratinized barb ridges (br). b, d, f Scale bars represent 200 μm (a, c, e) and 100 μm (b, d, f)

Generating immortalized cells from FPFs

The application of biobanked Red-and-green Macaw FPFs was evaluated through transfection of cell reprogramming factors that, ultimately, attributed an immortalized-like status into these cells. FPFs were transfected with transposon vectors carrying Nanog and Pou5f3 reprogramming factors. A GFP PiggyBac transposon vector was used as experimental control in which the transfection efficiency was also compared between chicken embryo fibroblasts (CEFs) and FPFs using EM (Fig. 7). Initially, we have compared the transfection efficiency using the standard medium, but no FPF survived for more than one week after transfection. However, FPFs were present in the wells > 120 days post-transfection and antibiotic selection (Hygromycin) when an enriched medium (EM) was used. Following selection, colonies were picked up and seeded in new wells to expand, and only positive Nanog and Pou5f3 colonies remained alive after more than 2 weeks of antibiotic selection. These cells proliferated in long-term EM culture and exhibited continuous cell duplication and a changed cell morphotype (as fish scale) in comparison with non-transfected cells and GFP-positive transfected cells which did not surpass 40 days in culture post thawing. Consequently, the lifespan and growth rate of these cells: control cell (non-transfected) and immortalized cells (Nanog and Pouf5f3 positive), is shown in Fig. 8. Immortalised cells expanded at least 8 generations beyond what was observed in non-transfected cells, while all GFP-positive cells died a few weeks post-transfection. The PDT was performed in immortalised cells 125 days post transfection and compared to pre-transfected cells (Fig. 8b). Expression of the pluripotency markers like EMA-1 and SSEA-1 was not detected in the immortalized cells by immunofluorescence.

Fig. 7.

Reprogramming of chicken embryonic fibroblast (CEF) and Red-and-green Macaw feather pulp fibroblast (FPF). a, b Transfection efficiency of FPF cells compared to CEFs using a GFP transposon approach. c, d mRNA expression of NANOG and POU5f3 in chicken blastoderm cells (CB, as positive controls), non-transfected FPF cells (FPF, as negative control) and transfected FPF cells (Samples 1, 2 and 3). e FPF morphotype before transfection and f–k after transfection (reprogrammed cell lines positive for NANOG and POU5f3). Scale bar 50 μm

Fig. 8.

Characteristics of the red-and-green macaw immortalised cells. a Cell growth curve with number of passages performed in immortalised cells and control cells (non-transfected cells) cultured in parallel. b Population doubling time (PDT) of immortalised cells (125 days post-transfection) and control cells (1 day pre-transfection), respectively

Discussion

The use of fibroblasts as a biological resource for genetic, functional, reproductive and genomic approaches is of paramount importance. However, their cultivation and cryopreservation in non-model organisms is still very limited. Here, we demonstrate that fibroblasts collected non-invasively from feather pulps of red-and-green Macaws can be efficiently isolated, frozen, and cultured. Our data showed that better cell survival and proliferation are achieved when FPFs come from early feather follicles (< 10 days post-plucking) and with the use of media enriched with FGF-2 and IGF-1.

As the feathers grew, we noticed that the reduction of the pulp and dermal papilla was accompanied by the gradual development of keratinized barbules, factors which possibly led to a decrease in FPFs adhered to the culture plates and increase in the number of keratinocytes during the first days of culture. During most of feather growth (anagen), the dermal papilla promotes the formation of rachis and barbules through the differentiation of epidermal mesenchymal cells into keratinocytes (Yu et al. 2004). This cornification process is marked by structural alterations and pulp reabsorption due to the reduction of tissue vascularization and nutrition (Alibardi 2009). Thus, feather cornification in late stages of anagen is closely linked to the decline of follicle cells through apoptosis (Chang et al. 2004; Yu et al. 2004; Alibardi 2017). In this regard, our results on gene expression over the course of feather development showed downregulation and upregulation of Wnt6, Fgf10 and Bcl2l11, respectively, which may explain why FPFs from advanced feather pulps exhibited a weak culture performance after freezing. Nevertheless, it seems that programmed cell death was partially circumvented by the addition of growth factors and FBS in the culture medium. Increases in FBS concentration above 10% improved fibroblast viability and metabolism in peccaries (another non-model species) leading to a reduction in the population doubling time (Santos et al. 2016), whereas they also proved beneficial for chicken fibroblasts in terms of lifespan (Ryan 1979). Together, these findings indicate that the composition of the culture medium influences intracellularly, stimulating cell proliferation and circumventing programmed cell death. Although we found no interactions between culture medium, feather growth phase and tissue condition (fresh versus frozen), we confirmed the effects of growth phase and tissue condition on cell metabolism and population double time.

In general, pulp tissue susceptibility to cryopreservation corresponded to the feather growth phase, with advanced follicles so sensitive to freezing that culturing their cells was practically impossible. During the cryopreservation process, cell damage can occur in various ways, the main ones being dehydration and the formation of intracellular ice (Murray and Gibson 2022). Under these circumstances, the phospholipid bilayer can be altered and more susceptible to the action of reactive oxygen species (ROS) produced by mitochondrial metabolism. Several studies attribute the low culture efficiency to oxidative stress induced by overproduction of ROS during cryopreservation (Magalhães et al. 2017; Praxedes et al. 2021; Silva et al. 2021). Furthermore, cell susceptibility to oxidative stress in different species can occur proportionally to cell lifespans (Jimenez 2018), indicating that tissue/cell aging can be a strong reason for the culture inefficiency observed in FPFs from advanced follicles to freezing.

The generation of immortalized or iPSc cells has the potential to overcome one of the main constraints of long-term fibroblast culture systems, programmed cell death or senescence. In practice, primary fibroblast cultures from endangered or non-model species are finite due to their limited proliferative capacity. Immortalization of primary cultures can therefore be extremely advantageous as it allows the number of cells to expand without the limitations caused by cell death, in addition to allowing the establishment of fast-growing cell cultures that are useful for experimental use. Here, we demonstrate that reprogrammed FPFs acquired an immortalized-like status without a proto-oncogenes factor as myc by the integration of two pluripotent factors (NANOG and POU5f3). Historically, primary cells have been immortalised through the integration of oncogenes like MYC, RAS, and SV40 that often involve the inactivation of tumour suppressor genes like P53 and RB, which normally regulate cell cycling progression and prevent an uncontrolled proliferation (Smith et al. 2016). However, alternative pathways to immortalise cells exist, such as reactivation of telomerase and epigenetic reprogramming. Telomerase activation is commonly achieved by overexpression of TERT, the catalytic subunit of telomerase, while some genes, such as Nanog and Oct4, can play a significant role in epigenetic reprogramming factors, particularly during the transition to a pluripotent state. Studies have demonstrated that NANOG and OCT4 can induce epigenetic modification, such as DNA methylation and histone modification (Freberg et al. 2007), which are key regulatory regions of genes involved in cell cycling and self-renewal. Although no pluripotency markers were identified by immunofluorescence assays, transfected cell lines were resistant to hygromycin b (indicating that cells had successfully integrated the transposon) and exhibited some features of embryonic stem cells (ESCs) such as stable phenotype (e.g. spherical cells with regular boundaries, expanded nucleus and reduced cytoplasm), long-term survival and constant proliferating doubling time. Consequently, the expression of factors such as SSEA-1 and EMA may be associated with a molecular network involving the expression of multiple pluripotency factors and not just NANOG and POU5f3.

On the other hand, although mammalian somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by expression of certain transcription factors (Oct4, Sox2, Klf-4 and c-Myc also known as the OSKM cocktail), long-term proliferation capacity in avian reprogrammed cells appears to depend on the inclusion of Nanog in the canonical OSKM cocktail (Fuet et al. 2018). This has become more evident with the recent results of Katayama et al. (Katayama et al. 2022), who generated robust iPSCs from three species of endangered birds using an all-in-one vector with seven reprogramming factors, including a modified Oct3/4 (M3o) and Klf-2, lin-28 and Nanog for the canonical OSKM cocktail. However, they also reported that these three iPSCs from endangered birds had different cellular performances under culture conditions, whereas a fourth iPSC derived from the Japanese golden eagle was only possible be stablished after the inclusion of the Yap gene to the all-in-one reprogramming vector. Nonetheless, the condition of the culture medium has been shown to be an essential element for cells to maintain their stem-like condition in vitro. In avian primordial germ cells (PGCs), the inclusion of FGF2 and insulin was sufficient for the cells to maintain long-term self-renewal competence (Whyte et al. 2015), whereas supplementation of the culture medium with FGF2 during reprogramming was beneficial for long-term maintenance as well as for the differentiation of iPSCs to germ cells in pigs (Pieri et al. 2022; Katayama et al. 2022). Taken together, these observations and findings indicate that somatic reprograming is feasible in birds; however, there are specie-specific differences associated to the gene function and culture conditions for those cells acquire their stemness.

In summary, we demonstrate through a minimally invasive approach that somatic cells from feathers at early development stage can be efficiently cultured and immortalized in vitro for a macaw species. We hope with progress of avian reprogramming system FPFs can be integrated as a routine assisted reproductive technology (ARTs) in endangered birds.

Author contributions

MHB designed the experiment, analyzed and interpreted the data, and wrote the manuscript. LFS provided financial support to the study and revised the manuscript. JMBD designed the experiment, provide analysis support and revised the manuscript. MJM provided analysis support and revised the manuscript. RJGP provided financial support and revised the manuscript.

Funding

MHB acknowledges The São Paulo Research Foundation (FAPESP) through grants 2020/11479–9 and 2022/03780–6. LFS acknowledges the FAPESP through grant 2017/23548–2 and the National Council for Scientific and Technological Development (CNPq) through grant 308337/2019–0. JMBD acknowledges the CNPq through grant 302495/2022–3. RJGP acknowledges the FAPESP through grant 2016/17158–4.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare that they have no known competing financial interest or personal relationship that could have appeared to influence the work reported in this paper.