Abstract
Avian pathogenic Escherichia coli (APEC) is a widespread bacterial pathogen that poses a significant threat to the poultry industry globally. It is of great significance to control APEC infections by investigating the molecular mechanisms that regulate APEC's adaptation to new environments and its survival. APEC possesses a series of regulation systems to sense and quickly and appropriately respond to extracellular environmental changes, and causes the host infection. Two-component system (TCS) and second messenger (SM) are important regulation systems ubiquitous in APEC and play vital roles in regulating a variety of bacterial functions, such as biofilm formation, H2O2 stress response, and virulence. Among them, BasS/BasR is a typical TCS, and c-di-GMP is a widely utilized intracellular SM. The metabolism of c-di-GMP is inversely controlled by diguanylate cyclase (DGC) and phosphodiesterase (PDE). However, the connection between BasS/BasR and c-di-GMP in regulating the biological functions of APEC has not yet been clarified. This study aims to investigate the cross-regulation between BasS/BasR and YfgF in biofilm formation, H2O2 stress response, and APEC virulence, and to elucidate the underlying molecular mechanisms. In this study, we first demonstrated that BasS/BasR inhibits the transcription of yfgF (encoding a c-di-GMP phosphodiesterase YfgF) by directly binding to its promoter and resulted in increased intracellular c-di-GMP levels in response to extracellular signals. This, in turn, results in increased biofilm formation, promotes APEC adhesion, and reduces resistance to H2O2. Furthermore, BasS/BasR also directly facilitates biofilm formation, enhances APEC virulence, and increases sensitivity to H2O2 by specifically binding to the promoters of csgD, ais, fepA, and yciFE, respectively. Taken together, this study suggests that the cross-regulation between BasS/BasR and c-di-GMP plays important roles in controlling biofilm formation, H2O2 stress response, and APEC virulence, thereby providing valuable insights into bacterial pathogenicity.
Keywords: Avian pathogenic Escherichia coli, BasS/BasR, c-di-GMP, Biofilm formation, H2O2 stress response
Introduction
Avian pathogenic Escherichia coli (APEC) is a significant bacterial pathogen that is responsible for various local and systemic infections in poultry, presenting symptoms including respiratory infections, salpingitis, perihepatitis, airsacculitis, pericarditis, cellulitis, peritonitis, and septicemia, known as avian colibacillosis (Dong et al., 2025; Li et al., 2025; Norambuena et al., 2025; Ye et al., 2025). This disease leads to reduced feed conversion efficiency, decreased live weight, lower egg production, and increased costs of treatment and prevention, significantly impacting global poultry health and economic losses (Norambuena et al., 2025; Rahimian et al., 2025; Ye et al., 2025). APEC infects the host involving many virulence factors, including (but being not limited to) colicins, toxins, lipopolysaccharide (LPS), adhesins, invasins, iron acquisition systems, and capsule polysaccharide (Fu et al., 2023; Yu et al., 2020b; Yu et al., 2025). Additionally, APEC also develops various regulation systems to sense and respond to bacterial extracellular conditions that lead to adaptation to the new environments and its survival (Fu et al., 2023; Piattelli et al., 2020; Yu et al., 2020b). These regulation systems include two-component system (TCS), secretion system (SS), quorum sensing (QS), small regulatory RNAs (sRNAs), and second messenger (SM) (Fu et al., 2023; Yu et al., 2024a). Among these regulation systems, TCS and SM play important roles in signal transduction pathways in bacterial pathogen and regulate their various biological functions, including biofilm formation, stress resistance, and virulence (Ahmad et al., 2020; Feng et al., 2025; Lai et al., 2025).
BasS/BasR is a typical TCS that is composed of a sensor kinase (also known as histidine kinase, HK, BasS) that monitors external signals and a response regulator (RR, BasR) that activates or represses downstream gene expression, thereby controlling the physiological activities in pathogens, such as antibiotic resistance, acidic resistance, biofilm formation, and virulence (Hagiwara et al., 2004; Liu et al., 2022; Ogasawara et al., 2012; Sayed et al., 2022; Yu et al., 2020b). In BasS/BasR, BasS autophosphorylates its conserved His residue in response to signals from the extracellular environment, including temperature, metal ions, quorum signals, pH, O2, and antibiotics (Liu et al., 2022; Su et al., 2024; Yu et al., 2020b). Subsequently, the phosphoryl group of BasS is transferred from a His residue to a conserved Asp residue on the cognate BasR for its activation (Yu et al., 2020b; Yu et al., 2025). The activated BasR regulates the expression of a set of downstream genes that respond to extracellular signals, thereby enabling bacterial pathogens to form biofilms, acquire resistance to various stresses, evade host immune responses, establish infections, and exhibit pathogenicity (Liu et al., 2022; Sayed et al., 2022; Yu et al., 2020b).
The critical SM, bis-(3′-5′)-cyclic dimeric guanosine monophosphate (c-di-GMP), acts as a global signaling molecule that regulates many important biological functions in bacterial pathogens, such as biofilm formation, antibiotic resistance, and virulence (Feng et al., 2025; Ghasemi et al., 2025; Khan et al., 2016; Römling et al., 2013; Yu et al., 2023). c-di-GMP is synthesized from two GTP monomers by diguanylate cyclases (DGCs) that contain a GGDEF domain and is degraded by c-di-GMP-specific phosphodiesterases (PDEs) that contain an EAL or HD-GYP domain, producing the linear pGpG or two molecules of GMP in a one-step reaction, respectively (Jenal et al., 2017; Junkermeier and Hengge, 2023; Khan et al., 2016). c-di-GMP serves as a versatile ligand that participates in the signal transduction pathways by directly binding to various effectors, including PilZ domain proteins, degenerate GGDEF or EAL domain proteins, and RNA riboswitches, to regulate downstream functions (Ghasemi et al., 2025; Hengge, 2021; Yu et al., 2023). This enables bacterial pathogens to adapt to changing environments and initiate responses. The YfgF protein is a c-di-GMP-specific PDE in E. coli K-12, which possesses a trans-membrane MASE1 (membrane-associated sensor 1) domain, a catalytically inactive GGDEF domain and a catalytically active EAL domain (Lacey et al., 2013; Lacey et al., 2010). The c-di-GMP PDE activity of YfgF is inhibited by the product of the reaction, pGpG, but it is enhanced by the YfgF GGDEF domain in the presence of physiological concentrations of Mg2+. Additionally, YfgF also plays a role in remodelling the cell surface of E. coli K-12 and in the response to H2O2 stress (Lacey et al., 2010).
In our previous work, we confirmed that BasS/BasR in APEC induces the upregulation of genes related to biofilm formation in vitro and contributes to bacterial virulence and colonization in vivo. Additionally, our transcriptomic analysis revealed that the absence of basS/basR in APEC significantly upregulated the transcription levels of yfgF (Yu et al., 2020b). However, it is not fully understood how BasS/BasR and c-di-GMP are connected to regulate the biological functions of APEC, such as biofilm formation, H2O2 stress response, and virulence. We assumed that BasS/BasR may function by regulating the concentrations of c-di-GMP; hence, we aimed to study the underlying mechanisms of BasS/BasR and YfgF in regulating the biological functions. In this study, we first confirmed that BasS/BasR inhibited the transcription of yfgF by directly binding to its promoter, which resulted in increased intracellular c-di-GMP levels, ultimately affecting biofilm formation, H2O2 resistance, and APEC adhesion. Furthermore, BasS/BasR also directly regulated biofilm formation, H2O2 resistance, and APEC virulence. Taken together, our findings contribute to the understanding of the cross-regulation between BasS/BasR and c-di-GMP in biofilm formation, H2O2 resistance, and the pathogenicity of APEC.
Materials and methods
Ethics statement
All experiments involving animals were conducted according to the ethical policies and procedures approved by the institutional animal care and use committee (IACUC) of Linyi University, China (Approval Number LYU20250107). Additionally, the procedures adhered to the ARRIVE guidelines (https://arriveguidelines.org) and the regulations for the Administration of Affairs Concerning Experimental Animals as mandated by the State Council of the People’s Republic of China regarding euthanasia. After the experiments, these chicks were euthanatized by intravenous injection of pentobarbital sodium (100 mg/kg) into the wing vein. Subsequently, the loss of consciousness was rapid, followed by cessation of respiration and heartbeat, and then exsanguination were performed to confirm euthanasia.
Bacterial strains, plasmids, and growth conditions
The E. coli strains and plasmids used in this study are described in Table 1. The APEC X40 strain was isolated from a pigeon diagnosed with air sacculitis. Most of E. coli strains were routinely cultured at 37°C under aeration, with shaking at 200 rpm or without shaking, in Luria-Bertani (LB) medium, which includes LB broth and LB agar containing 2.0% agar powder. However, the E. coli strains containing the temperature-sensitive plasmids pKD46 or pCP20 were cultured at 30°C. The growth of the E. coli strains was monitored by measuring the cell turbidity at 600 nm using a UV/Vis spectrophotometer (DU730, Beckman Coulter, Miami, FL). The appropriate antibiotics such as chloramphenicol, kanamycin and ampicillin were added to the medium for plasmid selection and maintenance, and their final concentrations were 16 µg/mL, 50 µg/mL and 100 µg/mL, respectively. All E. coli strains were frozen at -80°C in LB broth with 25% (v/v) glycerol.
Table 1.
Strains and plasmids used in this study.
| Strains or plasmids | Relevant genotype | Source |
|---|---|---|
| Strains | ||
| E. coli | ||
| DH5α | Clone host strain, supE44 ∆lacU169(ϕ80 lacZ∆M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 | Invitrogen |
| BL21 (DE3) | Expression strain, F-ompT hsdS(rB- mB-) gal dcm (DE3) | Invitrogen |
| APEC X40 | Avian pathogenic E. coli (APEC) X40, wild-type | Laboratory stock |
| ΔbasSR | APEC X40 basSR-deletion mutant | This study |
| ΔyfgF | APEC X40 yfgF-deletion mutant | This study |
| ΔbasSR&yfgF | APEC X40 basSR&yfgF-deletion mutant | This study |
| Plasmids | ||
| pKD46 | Expresses λ Red recombinase Exo, Bet and Gam, temperature sensitive, Ampr | Addgene |
| pKD3 | cat gene, template plasmid, Ampr Cmr | Addgene |
| pCP20 | FLP+ λcI857+ λpRRep(Ts), temperature sensitive, Ampr Cmr | Addgene |
| pET28a(+) | Expression vector, Kanr | Novagen |
| pCbasR | pET28a(+) with basR gene, Kanr | This study |
Construction of the isogenic mutants
The isogenic mutants ΔbasSR, ΔyfgF, and ΔbasSR&yfgF of APEC X40 were constructed using the lambda-Red recombinase mutagenesis method as previously described (Yu et al., 2020b). And ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were confirmed by PCR using primers check-basSR-f/check-basSR-r and check-yfgF-f/check-yfgF-r, and further confirmed by DNA sequencing. All primers were designed using Vector NTI Advance 11 software. The nucleotide sequences of primers are listed in Table 2.
Table 2.
Oligonucleotide primers used in this study.
| Primer name | Oligonucleotide (5′-3′)a |
|---|---|
| basSR-f | GGATTTAGGGTTACCCGACG |
| basSR-r | AGACGCTCTCCATCATCTGA |
| knockout-basSR-f | TCTGATTGTTGAAGACGATACGCTGTTATTGCAGGGAC TGTGTAGGCTGGAGCTGCTT |
| knockout-basSR-r | ACCGCTCCGTCATCTTCTTGCAGCTTAATCATAATGTTGCTGAATATCCTCCTTAGTTC |
| check-basSR-f | GCGGATGATATTCTGCAAAC |
| check-basSR-r | GGAGGAGAGTGCAATGAAAA |
| yfgF-f | ATGAAACTGAATGCAACTT |
| yfgF-r | TCAGGCACTTTCGCGAAT |
| knockout-yfgF-f | ATAAAAATACGTGATAAATGGTGGGGGCTTCCGCTGTTCCTGTAGGCTGGAGCTGCTT |
| knockout-yfgF-r | CGTTTTCAACGTACTCTGCCACTACCCGCATTTTCTTCATTGAATATCCTCCTTAGTTC |
| check-yfgF-f | TCATCATTCGAAGTCAGGTG |
| check-yfgF-r | GGATCTCTTCGTTTTCAACG |
| CM-f | TGTAGGCTGGAGCTGCTT |
| CM-r | CATATGAATATCCTCCTTAGTTC |
| basR-NdeI-f | CGCCATATGAAAATTCTGATTGTTGA |
| basR-XhoI-r | CCCTCGAGTTAGTTTTCCTCATTTGCGA |
| rt-16S-f | TTTGAGTTCCCGGCC |
| rt-16S-r | CGGCCGCAAGGTTAA |
| rt-yfgF-f | TGATGAACTGATCAGCCC |
| rt-yfgF-r | AAACGAGCCTGACATACC |
| rt-yciE-f | GGAAAAGCAAGCCGAATC |
| rt-yciE-r | GCGCAGCCATTTTACTCA |
| rt-yciF-f | GCTTTTCATGCGCACCTC |
| rt-yciF-r | TGTGCAGCGGCAATCAGT |
| rt-csgD-f | CCGTACCGCGACATTGAA |
| rt-csgD-r | GGCTGATTCCGTGCTGTT |
| rt-ais-f | ATGGTTTGCCACGTATCG |
| rt-ais-r | CACTAAAAGCGTTGCCCA |
| rt-fepA-f | CTGGGTGCCACCTGAAAT |
| rt-fepA-r | GGTGGCACCTTCCTCTTT |
| p-opgC-biotin-f | GCAACCGTTTTCACTTTCC |
| p-opgC-r | GGAAATATTCACGTTGCGC |
| p-csgD-biotin-f | GTAATGGCTAGATTGAAATC |
| p-csgD-r | GATGAAACCCCGCTTTTT |
| p-yciF-biotin-f | CCGTAAAGGCGGTCAGCATA |
| p-yciF-r | ATTTTTCTCCAGTGAAATCAC |
| p-yfgF-biotin-f | AGATGCTCAGCAGAATCC |
| p-yfgF-r | CATGATAAACGTAATAAT |
The sequences with the underline refer to the restriction endonuclease recognition sites.
Bacterial growth curves, biofilm formation assays and scanning electron microscopy
The growth curves of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were monitored, as described previously (Yu et al., 2019). For biofilm formation assays, we used the sterile polystyrene tubes in accordance with a previously described procedure (Yu et al., 2019). Additionally, the structural modifications of biofilms were detected using the scanning electron microscopy (SEM, XL20, Philips, Amsterdam, Netherlands), as described in our previous work (Yu et al., 2018; Yu et al., 2025). All samples were performed in triplicate.
H2O2 stress assays
H2O2 stress assays were performed as described previously, with modifications as follows (Yu et al., 2019; Yu et al., 2024b). The overnight cultures of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were each inoculated into the sterile polystyrene tubes containing 3 mL of fresh LB broth at a final concentration of 1.0 × 106 CFU/mL. An aliquot (5 μL) was carefully loaded onto LB agar plates with 2.0 mmol/L or 1.5 mmol/L H2O2 and air-dried (n=3). The plates were placed in the constant temperature incubators and incubated overnight at 37°C, after which the colony morphology was photographed. Additionally, the bacterial colonies of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were counted after treatment with 6 μL of a 30% solution of H2O2. The survival rates of APEC X40 were designated as 100%, and the experiments were repeated 3 times with similar results.
Animal infection experiments in vivo
One-day-old Langya chicks were obtained from Rizhao Langya Chicken Co. Ltd., Shandong, China and housed at 28-30°C with adequate food and water (a complete diet without antibiotics) and a 12 h illumination period per day. Healthy 7-day-old chicks were selected for animal infection experiments. The experiments were carried out to determine the pathogenic abilities of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF during systemic infections according to the following methods. The bacterial cells of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were scraped from LB agar plates, washed three times, resuspended in sterile 0.9% NaCl, and adjusted to 1.0 × 109 CFU/mL, respectively. In addition, healthy 7-day-old chicks were divided randomly into five groups, with ten chicks in each group. Chicks from four of the groups were infected via intramuscular injection with 0.5 mL of 1.0 × 109 CFU/mL of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF, respectively. The last group was intramuscularly injected with 0.5 mL of sterile 0.9% NaCl, which was the negative control. At 24 h post-infection, chicks from each group were euthanized and dissected. The hearts, livers, spleens and kidneys of the chicks were collected and fixed in 4% paraformaldehyde for histological observation.
Total RNA isolation, cDNA generation, and real-time PCR processing
Total RNA of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF was extracted using Trizol reagent (Transgen), cDNA was synthesized using the EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit (Transgen), and real-time PCR (qPCR) was performed with rt-primers (Table 2) using the TransStart® Tip Green qPCR SuperMix kit (Transgen) on the CFX96TM Real-Time System (Bio-Rad, Hercules, California, USA), according to the manufacturer’s instructions. Relative gene expressions were calculated using the 2-∆∆Ct (where Ct = cycle threshold) method, and normalized by subtracting the Ct value of the housekeeping gene 16S rRNA from that of the target genes. These target genes include csgD (encoding biofilm master transcriptional regulator), yciF (encoding stress protein YciF), yciE (encoding stress protein YciE, with yciE and yciF as paralogues), ais (encoding LPS core heptose (II)-phosphate phosphatase), and fepA (encoding ferrienterobactin and colicin outer membrane transporter protein). Real-time RT-PCR experiments were repeated at least 3 times with similar results.
Purification of the BasR protein and electrophoretic mobility shift assays
The His6-tagged BasR was expressed and purified according to previously described methods (Yu et al., 2020a; Yu et al., 2020b). The highly purified BasR was preserved in 10% glycerol and stored at -80°C until use in electrophoretic mobility shift assays (EMSA). The biotin-labeled DNA fragments were amplified by PCR using p-primers (Table 2) from the genomic DNA of APEC X40, and then incubated with various amounts of purified BasR protein to assess the binding ability of BasR to the promoters of target genes, as described in our previous work (Yu et al., 2020a). The band shifts were detected and analyzed according to the manufacturer’s instructions of chemiluminescent EMSA kit (Beyotime, Shanghai, China).
Statistical analysis
All data were analyzed using the statistical software SPSS (ver. 19.0, IBM Corp., Armonk, NY) by a one-way ANOVA method; the test results were shown as mean ± SD. The level of statistical significance was set at a p-value of ≤0.05.
Results
Inactivation of basS/basR and yfgF does not affect bacterial growth
The isogenic mutants ΔbasSR, ΔyfgF, and ΔbasSR&yfgF of APEC X40 were constructed based on lambda-Red recombinase system and confirmed by PCR amplification (Fig. 1A-B) and DNA sequencing (data not shown). The colony morphologies of ΔbasSR, ΔyfgF, and ΔbasSR&yfgF on the LB agar plates were in accordance with those of APEC X40; they were circular, convex, moist, smooth, and 1 to 2 mm in diameter (data not shown). And the growth curves of ΔbasSR, ΔyfgF, and ΔbasSR&yfgF in LB broth were similar to that of APEC X40 (Fig. 1C). These data indicate that the inactivation of basS/basR and yfgF does not affect bacterial growth.
Fig. 1.
The molecular determination and growth curves of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF. (A) Confirmation of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF using primers check-basSR-f/check-basSR-r. M: 5000 bp DNA marker; Lane 1: a 1880 bp band was amplified from APEC X40; Lane 2: a 500 bp band was amplified from ΔbasSR; Lane 3: a 1880 bp band was amplified from ΔyfgF; Lane 4: a 500 bp band was amplified from ΔbasSR&yfgF. (B) Confirmation of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF using primers check-yfgF-f/check-yfgF-r.. M: 5000 bp DNA marker; Lane 1: a 2000 bp band was amplified from APEC X40; Lane 2: a 2000 bp band was amplified from ΔbasSR; Lane 3: a 300 bp band was amplified from ΔyfgF; Lane 4: a 300 bp band was amplified from ΔbasSR&yfgF. (C) The growth curves of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF grown in LB broth at 37°C for 24 h with shaking. The growth curves were determined by measuring the cell density (OD) at 600 nm, and the data represent the means of 3 independent assays. Abbreviation: LB, Luria-Bertani. Error bars indicate standard deviations.
BasS/BasR and YfgF influence biofilm formation of APEC
The solid surface-associated biofilms of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF formed on the polystyrene tubes were measured using crystal violet (CV) staining assays. As shown in Fig. 2, the biofilms of ΔbasSR formed on the polystyrene tubes were reduced by approximately 1.80-fold compared to that of APEC X40, whereas the biofilms of ΔyfgF were increased by approximately 1.40-fold, and the biofilms of ΔbasSR&yfgF were increased by approximately 1.31-fold. Additionally, SEM experiments were performed to further investigate the effect of BasS/BasR and YfgF on the biofilm integrity of APEC. As shown in Fig. 3A-B, the biofilms of APEC X40 exhibited cracks on the surface with slight folds, while the biofilms of ΔbasSR were severely damaged and only contained sparse bacterial cells. Although the biofilms of ΔyfgF exhibited surface cracks, the adhesion among bacteria was tight (Fig. 3C). The biofilms of ΔbasSR&yfgF displayed severe folds and slight cracks on the surface (Fig. 4D). These results indicate that BasS/BasR and YfgF play vital roles in biofilm formation of APEC.
Fig. 2.
The measurement of biofilm mass of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF by CV staining formed on polystyrene tubes. (A) Photographs of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF adhering to the polystyrene tubes. (B) Biofilms of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF that adhered to the polystyrene tubes after staining with 0.1% CV and dissolving in 33% glacial acetic acid, were measured by optical density at 492 nm. Error bars indicate standard deviations. The results represent the mean of three independent experiments; **P < 0.01, indicating the extremely significant difference.
Fig. 3.
The biofilm morphologies of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were monitored by SEM. (A) The morphological observation of APEC X40. (B) The morphological observation of ΔbasSR. (C) The morphological observation of ΔyfgF. (D) The morphological observation of ΔbasSR&yfgF.
Fig. 4.
The survival ability of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF under H2O2 stress condition. (A, B) Strains APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF were loaded onto LB agar plates with 2.0 mmol/L and 1.5 mmol/L H2O2, respectively. The plates were incubated at 37°C overnight before the images were taken: (A) 2.0 mmol/L H2O2, (B) 1.5 mmol/L H2O2. (C) The survival rates of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF. The survival rates of APEC X40 were designated as 100%. Error bars indicate standard deviations. **P < 0.01, indicating the extremely significant difference.
BasS/BasR and YfgF affect the survival of APEC under H2O2 stress
The survival ability of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF under H2O2 stress were compared to evaluate the effects of BasS/BasR and YfgF on APEC. As shown in Fig. 4A-B, compared to APEC X40, ΔbasSR was resistant to H2O2, while ΔyfgF and ΔbasSR&yfgF were sensitive to H2O2. Meantime, the survival rates of ΔbasSR under H2O2 stress were increased by almost 1.67-fold compared to that of APEC X40, whereas the survival rates of ΔyfgF and ΔbasSR&yfgF were decreased by almost 2.10-fold and 2.00-fold, respectively (Fig. 4C). These results indicate that BasS/BasR and YfgF play important roles in the survival of APEC under H2O2 stress, suggesting that they may participate in APEC’s evasion from the host immune system.
BasS/BasR and YfgF are necessary for the pathogenicity of APEC in vivo
The virulence of APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF was evaluated in a chick infection model. The histopathological analysis of the APEC X40-infected group of chicks showed that the myocardial fibers of the heart exhibited degeneration, with slight haemorrhage, the myocardial interstitium was widened, and the granular blue stains were observed (Fig. 5B); the hepatocytes showed slight steatosis in the liver (Fig. 5G); the lymphocytes were slightly lost in the white pulp of the spleen (Fig. 5L); the local tubular epithelial cells were degenerated and necrotic in the kidney (Fig. 5Q). In the chicks infected with ΔbasSR, the myocardial fibers exhibited degeneration, the myocardial interstitium was widened, and the granular blue stains were observed, with slight hemorrhage (Fig. 5C); there was infiltration in the local lymphocytes of the liver (Fig. 5H); the loss of lymphocytes in the white pulp were observed in the spleen, with congestion and haemorrhage (Fig. 5M); the tubular epithelial cells were degenerated in the kidney, with haemorrhage (Fig. 5R). In the ΔyfgF-infected group, the myocardial fibers exhibited degeneration, the myocardial interstitium was widened, and the granular blue stains were observed, with slight hemorrhage (Fig. 5D); the local blood vessels were congested, with a few inflammatory cells infiltration in the liver (Fig. 5I); the lymphocytes were sparse in the spleen, with a large number of heterophil granulocytes infiltration (Fig. 5N); the local tubular epithelial cells exhibited vacuolar degeneration (Fig. 5S). The local myocardial fibers exhibited granular degeneration, the myocardial interstitium was widened, and the granular blue stains were observed, with slight congestion and hemorrhage in the group infected with ΔbasSR&yfgF (Fig. 5E); the hepatocytes showed slight steatosis, with the focal infiltration in the local lymphocytes (Fig. 5J); the lymphocytes were slightly lost in the white pulp of the spleen (Fig. 5O); the tubular epithelial cells exhibited granular degeneration, with significant hemorrhage (Fig. 5T). These results suggest that BasS/BasR and YfgF are necessary for the pathogenicity of APEC in chickens in vivo.
Fig. 5.
BasS/BasR and YfgF are necessary for the pathogenicity of APEC. Histological observation of chick lesions (400 ×). (A-E) The hearts of chick were intramuscularly injected with NaCl, APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF, respectively. (F-J) The livers of chick were intramuscularly injected with NaCl, APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF, respectively. (K-O) The spleens of chick were intramuscularly injected with NaCl, APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF, respectively. (P-T) The kidneys of chick were intramuscularly injected with NaCl, APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF, respectively.
BasS/BasR and YfgF regulate the transcription of target genes
Real-time RT-PCR experiments were conducted to detect the transcription levels of target genes in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF, and the results were showed in Fig. 6. As shown in Fig. 6A, the mRNA levels of csgD were reduced by 4.03-fold in ΔbasSR compared to that in APEC X40, while the mRNA levels of csgD in ΔyfgF were increased by 3.69-fold, and the mRNA levels of csgD in ΔbasSR&yfgF had no significant changes. Compared to APEC X40, the mRNA levels of yciF and yciE were upregulated 2.71-fold and 2.73-fold in ΔbasSR, respectively; whereas the mRNA levels of yciF and yciE were downregulated 2.44-fold and 2.27-fold in ΔyfgF, respectively, and the mRNA levels of yciF and yciE had no significant changes in ΔbasSR&yfgF (Fig. 6B-C). Moreover, the mRNA levels of ais were decreased by 2.64-fold in ΔbasSR compared to that in APEC X40, while the mRNA levels of ais in ΔyfgF were increased by 3.24-fold, and the mRNA levels of ais in ΔbasSR&yfgF had no significant changes (Fig. 6D). As shown in Fig. 6E, the mRNA levels of fepA in ΔbasSR had no significant changes compared to that in APEC X40, whereas the mRNA levels of in ΔyfgF and ΔbasSR&yfgF were increased by 4.12-fold and 1.81-fold, respectively.
Fig. 6.
Relative mRNA expressions of target genes by real-time RT-PCR in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF. (A) Relative transcription levels of csgD were determined by real-time RT-PCR in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF cultured in LB broth. (B) Relative transcription levels of yciF were determined by real-time RT-PCR in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF cultured in LB broth. (C) Relative transcription levels of yciE were determined by real-time RT-PCR in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF cultured in LB broth. (D) Relative transcription levels of ais were determined by real-time RT-PCR in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF cultured in LB broth. (E) Relative transcription levels of fepA were determined by real-time RT-PCR in APEC X40, ΔbasSR, ΔyfgF, and ΔbasSR&yfgF cultured in LB broth. (F) Relative transcription levels of yfgf were determined by real-time RT-PCR in APEC X40 and ΔbasSR cultured in LB broth. Error bars indicate standard deviations. The relative gene expressions were calculated using the 2-ΔΔCt method. The target gene expression levels of APEC X40 were normalized to designate as 1. **P < 0.01, indicating the extremely significant difference; *P < 0.05, indicating the significant difference.
BasR directly binds to the promoters of target genes
EMSA were carried out to determine whether BasR directly regulates the transcription of csgD, yciF, and yfgF. The purified His6-tagged BasR protein was used to bind the putative promoters of csgD, yciF, and yfgF, respectively. As shown in Fig. 7A-D (Fig. S1-4), the clearly shifted bands of the protein-DNA complex were detected at BasR concentrations of 2, 4, 8, and 16 μmol/L; the intensities of the shifted bands were enhanced as the amount of BasR increased, while the shifted band disappeared in the presence of an approximately 10-fold excess of an unlabeled DNA fragment used as a specific competitor (Ctrl). Fig. 7A (Fig. S1) was the positive control in Fig. 7. Additionally, the binding ability of BasR to the promoters of ais and fepA had been confirmed in our previous study. These results confirm that BasR specifically binds to the promoters of csgD, yciF, yfgF, ais, and fepA, indicating that BasS/BasR regulates biofilm formation, H2O2 stress response, and the pathogenicity of APEC.
Fig. 7.
The binding ability of BasR to target gene promoters was determined by EMSA. (A) The positive control, the binding ability of BasR to the opgC promoter; (B) the csgD promoter; (C) the yciF promoter; (D) the yfgF promoter. Increasing amounts of BasR were incubated with Biotin-labeled opgC, csgD, yciF, and yfgF (Biotin-opgO, Biotin-csgD, Biotin-yciF, and Biotin-yfgF). In each panel, from lanes 1 to 6, the concentrations of BasR were 16, 0, 2, 4, 8, and 16 µmol/L, respectively; the amount of Biotin-labeled probes in all lanes was 100 fmol. In lane 1, besides the labeled probes, 1 pmol of unlabeled probe was added as the competitive control (Ctrl).
BasR directly inhibits the transcription of the yfgF gene
Real-time RT-PCR experiments and EMSA were performed to confirm the regulatory relationship between BasS/BasR and YfgF. As shown in Fig. 6F, the mRNA levels of yfgF were upregulated 2.30-fold in ΔbasSR compared to that in APEC X40. In addition, the regulatory mechanism of BasR on yfgF was determined using EMSA, showing that BasR specifically bound to the promoter of yfgF (Fig. 7D, Fig. S4). Taken together, these results indicate that BasR directly inhibits the expression of the yfgF gene, suggesting that BasS/BasR regulates the changes in the concentration of c-di-GMP.
Discussion
The underlying mechanisms of regulation systems modulating the biological functions of APEC in response to extracellular signals have been a hot topic in the field of pathogen-host interactions (Ahmed et al., 2022; Mitrophanov and Groisman, 2008). A deeper investigation of the regulatory network of TCS and c-di-GMP is requisite to comprehend how APEC senses the host and environmental signals. Here, our results indicated that BasS/BasR inhibited the expression of yfgF by specifically binding to the promoter of yfgF, which resulted in increased intracellular c-di-GMP levels that ultimately affected biofilm formation, H2O2 resistance, and the pathogenicity of APEC. Furthermore, BasS/BasR also directly regulated biofilm formation, H2O2 resistance, and the pathogenicity of APEC.
Biofilms are critical factors contributing to persistent and recurrent infections caused by APEC and other bacteria in poultry (Sivaranjani et al., 2022; Yu et al., 2025). They serve as physical barriers that protect the embedded bacterial cells from the detrimental effects of antibiotics, disinfectants, and the host immune system, making them difficult to prevent, control, or eradicate (Benyoussef et al., 2022; Sivaranjani et al., 2022). Our previous research demonstrated that BasS/BasR promotes biofilm formation of APEC in vitro and contributes to APEC virulence and colonization in vivo (Yu et al., 2020b). In this study, we first confirmed that the inactivation of basS/basR induced the expression of yfgF (Fig. 6F) by directly binding to its promoter (Fig. 7D, Fig. S4), and resulted in reduced biofilm formation (Fig. 2, Fig. 3). The inactivation of yfgF increased biofilm formation, which is consistent with the results of Lacey et al (Lacey et al., 2010); while the inactivation of basS/basR directly resulted in decreased biofilm formation by inhibiting the expression of csgD (Fig. 6A) through specifically binding to its promoter (Fig. 7B, Fig. S2), which is consistent with a previous study that demonstrated that the deletions of basS and basR resulted in a significant reduction in biofilm formation in Edwardsiella piscicida (Sayed et al., 2022). csgD encodes the master transcription regulator of biofilm formation, which controls curli fimbriae by regulating csgBA and csgDEFG operons (Leesombun et al., 2023; Ogasawara et al., 2020). Curli fimbriae are a main component of the matrix of biofilms that facilitate APEC to evade host immune responses, which in turn promotes the pathogenicity of APEC (Rathi et al., 2022; Yu et al., 2025). Moreover, these results from this study, along with our previous study (Yu et al., 2020b), demonstrated that BasS/BasR directly increases APEC virulence by upregulating the transcription of ais (encoding LPS core heptose(II)-phosphate phosphatase) and fepA (encoding ferric enterobactin and colicin outer membrane transporter), both of which are involved in toxins (Lee et al., 2005; Yu et al., 2020b). Collectively, BasS/BasR and YfgF play important roles in biofilm formation and the pathogenicity of APEC.
Oxidative stress is considered a mechanism for killing bacteria because it can cause oxidative damage to proteins, lipids, and DNA, leading to bacterial cell death (Gao et al., 2019; Kim et al., 2021; Yu et al., 2024b). The ability to survive oxidative stress is vital for APEC’s survival in the host, therefore, APEC has evolved antioxidant proteins to protect its bacterial cells against oxidative damage, including superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), and stress protein (Chiang and Schellhorn, 2012; Yu et al., 2024a; Yu et al., 2024b). We used H2O2 in this study as an extracellular stimulant for oxidative stress to investigate the effects of BasS/BasR and YfgF on H2O2-induced oxidative stress response using H2O2 stress assays. Combining real-time RT-PCR experiments and EMSA, these results from this study indicated that the deletion of yfgF increased sensitivity to H2O2, which is consistent with the results of Lacey et al (Lacey et al., 2010); while the deletion of basS/basR increased resistance to H2O2 by directly binding to the promoter of yciFE (encoding stress protein), which is not consistent with the results of a previous study that both of mutants (△basS and △basR) exhibited significantly delayed growth of Edwardsiella piscicida during the exponential phase under 0.2% H2O2 stress (Sayed et al., 2022). This is probably because the strain used in this study is an APEC isolated strain, which differs from Edwardsiella piscicida, and their mechanisms in response to H2O2 stress are different. Additionally, the double deletion of basS/basR and yfgF also resulted in increased sensitivity to H2O2. Taken together, we first confirmed that the inactivation of BasS/BasR induced the expression of yfgF (Fig. 6F) by directly binding to its promoter (Fig. 7D, Fig. S4) and resulted in increased H2O2 resistance (Fig. 4). This indicates that the cross-regulation between BasS/BasR and YfgF has a vital role in the APEC response to H2O2 stress.
Collectively, our investigation revealed, for the first time, a strategic role of BasS/BasR in regulating biofilm formation, H2O2 stress response, and the pathogenicity of APEC via cross-regulation with YfgF (Fig. 8). In response to H2O2 stress, BasS senses H2O2 and autophosphorylates its conserved His residue. Subsequently, the phosphoryl group of BasS is transferred to a conserved Asp residue of BasR for its activation. The activated BasR inhibits the expression of YfgF by directly binding to its promoter, resulting in increased intracellular c-di-GMP levels and a reduced resistance to H2O2. Meanwhile, the activated BasR also inhibits the expression of YciFE by directly binding to its promoter, which also leads to a reduced resistance to H2O2 (Fig. 8A). Additionally, in response to other extracellular signals, BasS senses these extracellular signals and then activate BasR, which directly binds to the promoters of csgD, ais, and fepA, leading to an increase in biofilm formation and APEC virulence; while BasR increases intracellular c-di-GMP levels by inhibiting the expression of YfgF, eventually indirectly resulting in increased biofilm formation and promoting APEC adhesion (Fig. 8B).
Fig. 8.
Schematic diagram of the cross-regulation of BasS/BasR and YfgF in APEC controlling biofilm formation and H2O2 resistance under extracellular signal stimuli. See the text for detail description.
The limitations of this study should be recognized. How does the extracellular H2O2 enter bacterial cells? Does the passage of H2O2 through the bacterial cell membrane require specific carrier proteins? If so, how do these protein function? The questions mentioned above remain unclear. Therefore, it is necessary to investigate the mechanism by which H2O2 passes through the bacterial cell membrane in future experiments.
In conclusion, BasS/BasR is first confirmed to directly bind to the promoter of yfgF, inhibiting the expression of yfgF and causing increased intracellular c-di-GMP levels. This, in turn, results in increased biofilm formation, promotes APEC adhesion, and reduces resistance to H2O2. Furthermore, BasS/BasR also directly enhances biofilm formation, APEC virulence, and sensitivity to H2O2 by specifically binding to the promoters of csgD, ais, fepA, and yciFE, respectively.
Funding
This work was supported by the National Natural Science Foundation of China (Grant Number 32202810) and the Natural Science Foundation of Shandong Province, China (Grant Number ZR2022QC115).
CRediT authorship contribution statement
Lumin Yu: Writing – review & editing, Writing – original draft, Methodology, Funding acquisition, Data curation. Hui Wang: Software, Methodology, Investigation, Formal analysis. Xinglin Zhang: Visualization, Supervision. Ting Xue: Writing – review & editing, Visualization, Supervision, Resources, Conceptualization.
Disclosures
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Footnotes
Immunology, Health and Disease
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2025.105726.
Appendix. Supplementary materials
References
- Ahmad B., Azeem F., Ali M.A., Nawaz M.A., Nadeem H., Abbas A., Batool R., Atif R.M., Ijaz U., Nieves-Cordones M., Chung G. Genome-wide identification and expression analysis of two component system genes in Cicer arietinum. Genomics. 2020;112:1371–1383. doi: 10.1016/j.ygeno.2019.08.006. [DOI] [PubMed] [Google Scholar]
- Ahmed M.A.H., Cai J., Zhang Y., Yin K., Wang Q., Shao S. The cross-regulation between two-component system BasS-BasR and ferric uptake regulator fur in virulence gene expression in Edwardsiella piscicida. Aquaculture. 2022;559 [Google Scholar]
- Benyoussef W., Deforet M., Monmeyran A., Henry N. Flagellar motility during E. coli biofilm formation provides a competitive disadvantage which recedes in the presence of co-colonizers. Front. Cell Infect. Microbiol. 2022;12 doi: 10.3389/fcimb.2022.896898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chiang S.M., Schellhorn H.E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Arch. Biochem. Biophys. 2012;525:161–169. doi: 10.1016/j.abb.2012.02.007. [DOI] [PubMed] [Google Scholar]
- Dong H., Zhu S., Zheng D., Fei C., Wu Z., Wu S., Wang A., Yu S. Antibiotic resistance and molecular typing of duck-derived Escherichia coli isolates. Comp. Immunol. Microbiol. Infect. Dis. 2025;118 doi: 10.1016/j.cimid.2025.102321. [DOI] [PubMed] [Google Scholar]
- Feng Q., Dai X., Wu Q., Zhang L., Yang L., Fu Y. c-di-GMP phosphodiesterase ProE interacts with quorum sensing protein PqsE to promote pyocyanin production in Pseudomonas aeruginosa. mSphere. 2025;10 doi: 10.1128/msphere.01026-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fu D., Zheng Q., Wu X., Wu J., Shao Y., Wang Z., Tu J., Song X., Qi K. The transcriptional regulator EtrA mediates ompW contributing to the pathogenicity of avian pathogenic Escherichia coli. Vet. Microbiol. 2023;283 doi: 10.1016/j.vetmic.2023.109775. [DOI] [PubMed] [Google Scholar]
- Gao Q., Xia L., Wang X., Ye Z., Liu J., Gao S. SodA contributes to the virulence of avian pathogenic Escherichia coli O2 strain E058 in experimentally infected chickens. J. Bacteriol. 2019;201 doi: 10.1128/JB.00625-18. -18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ghasemi A., Yuan X., Yang C.H. A novel transcriptional regulator, CdeR, modulates the type III secretion system via c-di-GMP signaling in Dickeya dadantii. Microbiol. Spectr. 2025;13 doi: 10.1128/spectrum.02655-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hagiwara D., Yamashino T., Mizuno T. A genome-wide view of the Escherichia coli BasS-BasR two-component system implicated in iron-responses. Biosci. Biotechnol. Biochem. 2004;68:1758–1767. doi: 10.1271/bbb.68.1758. [DOI] [PubMed] [Google Scholar]
- Hengge R. High-specificity local and global c-di-GMP signaling. Trends Microbiol. 2021;29:993–1003. doi: 10.1016/j.tim.2021.02.003. [DOI] [PubMed] [Google Scholar]
- Jenal U., Reinders A., Lori C. Cyclic di-GMP: second messenger extraordinaire. Nat. Rev. Microbiol. 2017;15:271–284. doi: 10.1038/nrmicro.2016.190. [DOI] [PubMed] [Google Scholar]
- Junkermeier E.H., Hengge R. Local signaling enhances output specificity of bacterial c-di-GMP signaling networks. Microlife. 2023;4:uqad026. doi: 10.1093/femsml/uqad026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khan M., Harms J.S., Marim F.M., Armon L., Hall C.L., Liu Y.P., Banai M., Oliveira S.C., Splitter G.A., Smith J.A. The bacterial second messenger cyclic di-GMP regulates Brucella pathogenesis and leads to altered host immune response. Infect. Immun. 2016;84:3458–3470. doi: 10.1128/IAI.00531-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim S., Kim M., Kang M.C., Lee H.H.L., Cho C.H., Choi I., Park Y., Lee S.H. Antioxidant effects of Turmeric leaf extract against hydrogen peroxide-induced oxidative stress in vitro in Vero cells and in vivo in Zebrafish. Antioxidants. 2021;10:112. doi: 10.3390/antiox10010112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lacey M., Agasing A., Lowry R., Green J. Identification of the YfgF MASE1 domain as a modulator of bacterial responses to aspartate. Open Biol. 2013;3 doi: 10.1098/rsob.130046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lacey M.M., Partridge J.D., Green J. Escherichia coli K-12 YfgF is an anaerobic cyclic di-GMP phosphodiesterase with roles in cell surface remodelling and the oxidative stress response. Microbiology. 2010;156:2873–2886. doi: 10.1099/mic.0.037887-0. [DOI] [PubMed] [Google Scholar]
- Lai X., Yu M., Cheng C.P., Lai E.M. Distinct strategies of diguanylate cyclase domain proteins on inhibition of virulence and interbacterial competition by agrobacteria. mBio. 2025;16 doi: 10.1128/mbio.00039-25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee L.J., Barrett J.A., Poole R.K. Genome-wide transcriptional response of chemostat-cultured Escherichia coli to zinc. J. Bacteriol. 2005;187:1124–1134. doi: 10.1128/JB.187.3.1124-1134.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leesombun A., Sungpradit S., Sariya L., Taowan J., Boonmasawai S. Transcriptional profiling of the effect of Coleus amboinicus L. essential oil against Salmonella typhimurium biofilm formation. Antibiotics. 2023;12:1598. doi: 10.3390/antibiotics12111598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li F., Li M., Nie L., Zuo J., Fan W., Lian L., Hu J., Chen S., Jiang W., Han X., Wang H. Molecular epidemiology and antibiotic resistance associated with avian pathogenic Escherichia coli in Shanxi province, China, from 2021 to 2023. Microorganisms. 2025;13:541. doi: 10.3390/microorganisms13030541. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Y., Wang Y., Chen X., Jin J., Liu H., Hao Y., Zhang H., Xie Y. BasS/BasR two-component system affects the sensitivity of Escherichia coli to Plantaricin BM-1 by regulating the tricarboxylic acid cycle. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.874789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mitrophanov A.Y., Groisman E.A. Signal integration in bacterial two-component regulatory systems. Genes Dev. 2008;22:2601–2611. doi: 10.1101/gad.1700308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Norambuena R., Rojas-Martínez V., Tobar-Calfucoy E., Aguilera M., Sabag A., Zamudio M.S., Lara P., Martín D.S., Zabner M., Tichy D., Camejo P., Rojas F., León L., Pino M., Mora P., Ulloa S., Cifuentes P., Pieringer H., Muñoz N.C. Development of a bacteriophage cocktail with high specificity against high-risk avian pathogenic Escherichia coli. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogasawara H., Ishizuka T., Hotta S., Aoki M., Shimada T., Ishihama A. Novel regulators of the csgD gene encoding the master regulator of biofilm formation in Escherichia coli K-12. Microbiology. 2020;166:880–890. doi: 10.1099/mic.0.000947. [DOI] [PubMed] [Google Scholar]
- Ogasawara H., Shinohara S., Yamamoto K., Ishihama A. Novel regulation targets of the metal-response BasS-BasR two-component system of Escherichia coli. Microbiology. 2012;158:1482–1492. doi: 10.1099/mic.0.057745-0. [DOI] [PubMed] [Google Scholar]
- Piattelli E., Peltier J., Soutourina O. Interplay between regulatory RNAs and signal transduction systems during bacterial infection. Genes. 2020;11:1209. doi: 10.3390/genes11101209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rahimian M., Deyhim H., Shirazi-Zavaragh S., Zeynali M., Bonabi E., Zarghami N. Phage isolation, characterization, and antibiotic resistance profiling in avian pathogenic Escherichia coli: integrating data for a possible novel AMR surveillance model. Microb. Pathog. 2025;203 doi: 10.1016/j.micpath.2025.107506. [DOI] [PubMed] [Google Scholar]
- Rathi B., Gupta S., Kumar P., Kesarwani V., Dhanda R.S., Kushwaha S.K., Yadav M. Anti-biofilm activity of caffeine against uropathogenic E. coli is mediated by curli biogenesis. Sci. Rep. 2022;12 doi: 10.1038/s41598-022-23647-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Römling U., Galperin M.Y., Gomelsky M. Cyclic di-GMP: the first 25 years of a universal bacterial second messenger. Microbiol. Mol. Biol. Rev. 2013;77:1–52. doi: 10.1128/MMBR.00043-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sayed M., Griffin M., Ware C., Ozdemir O., Tekedar H.C., Essa M., Karsi A., Lawrence M.L., Abdelhamed H. Evaluation of Edwardsiella piscicida basS and basR mutants as vaccine candidates in catfish against edwardsiellosis. J. Fish Dis. 2022;45:1817–1829. doi: 10.1111/jfd.13703. [DOI] [PubMed] [Google Scholar]
- Sivaranjani M., McCarthy M.C., Sniatynski M.K., Wu L., Dillon J.R., Rubin J.E., White A.P. Biofilm formation and antimicrobial susceptibility of E. coli associated with colibacillosis outbreaks in broiler chickens from Saskatchewan. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.841516. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Su H.L., Lai S.J., Tsai K.C., Fung K.M., Lung T.L., Hsu H.M., Wu Y.C., Liu C.H., Lai H.X., Lin J.H., Tseng T.S. Structure-guided identification and characterization of potent inhibitors targeting PhoP and MtrA to combat mycobacteria. Comput. Struc. Biotechnol. J. 2024;23:1477–1488. doi: 10.1016/j.csbj.2024.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ye X., Hsu C.Y., Jia L., Zhang X., Magee C., Whitham S., Leigh S., Evans J.D., Zhang L., Robinson K. Dynamic immune response to avian pathogenic Escherichia coli infection in broiler chickens: insights into pro-inflammatory and anti-inflammatory cytokine regulation: cytokine regulation in APEC infected broilers. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2025.105029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu L., Li W., Liu Z., Yu J., Wang W., Shang F., Xue T. Role of McbR in the regulation of antibiotic susceptibility in avian pathogenic Escherichia coli. Poult. Sci. 2020;99:6390–6401. doi: 10.1016/j.psj.2020.09.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu L., Li W., Qi K., Wang S., Chen X., Ni J., Deng R., Shang F., Xue T. McbR is involved in biofilm formation and H2O2 stress response in avian pathogenic Escherichia coli X40. Poult. Sci. 2019;98:4094–4103. doi: 10.3382/ps/pez205. [DOI] [PubMed] [Google Scholar]
- Yu L., Shang F., Chen X., Ni J., Yu L., Zhang M., Sun D., Xue T. The anti-biofilm effect of silver-nanoparticle-decorated quercetin nanoparticles on a multi-drug resistant Escherichia coli strain isolated from a dairy cow with mastitis. PeerJ. 2018;6:e5711. doi: 10.7717/peerj.5711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu L., Wang H., Han X., Li W., Xue M., Qi K., Chen X., Ni J., Deng R., Shang F., Xue T. The two-component system, BasSR, is involved in the regulation of biofilm and virulence in avian pathogenic Escherichia coli. Avian Pathol. 2020;49:532–546. doi: 10.1080/03079457.2020.1781791. [DOI] [PubMed] [Google Scholar]
- Yu L., Wang H., Zhang X., Xue T. Oxidative stress response in avian pathogenic Escherichia coli. Res. Vet. Sci. 2024;180 doi: 10.1016/j.rvsc.2024.105426. [DOI] [PubMed] [Google Scholar]
- Yu L., Wang H., Zhang X., Xue T. Two-component system UhpAB facilitates the pathogenicity of avian pathogenic Escherichia coli through biofilm formation and stress responses. Avian Pathol. 2025;54:359–370. doi: 10.1080/03079457.2024.2442704. [DOI] [PubMed] [Google Scholar]
- Yu L., Zhao Y., Zhang S., Xu L., Tang S., Geng Y., Xue C., Zhang X. The transcription factor YbdO attenuates the pathogenicity of avian pathogenic Escherichia coli by regulating oxidative stress response. BMC Microbiol. 2024;24:544. doi: 10.1186/s12866-024-03715-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu Z., Zhang W., Yang H., Chou S.H., Galperin M.Y., He J. Gas and light: triggers of c-di-GMP-mediated regulation. FEMS Microbiol. Rev. 2023;47:fuad034. doi: 10.1093/femsre/fuad034. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








