Skip to main content
NCBI home page
Biochemistry and Biophysics Reports logoLink to Biochemistry and Biophysics Reports
. 2025 Aug 20;43:102186. doi: 10.1016/j.bbrep.2025.102186

miR-628-3p exerts a carcinogenic effect on hepatocellular carcinoma

Lele Liu a,1, Ziyi Cheng a,1, Dina Liu b, Mingang Pan a, Muyu Luo a, Yunmeng Chen a, Jie Xia a,c,⁎
PMCID: PMC12420519  PMID: 40937327

Abstract

Hepatocellular carcinoma (HCC) is associated with the highest mortality rate among various types of liver tumors. miR-628-3p, a microRNA, has been identified as a tumor suppressor in multiple cancer types, yet its function in hepatocellular carcinoma has not been investigated. This study aimed to examine the effect of miR-628-3p on the occurrence and development of HCC and its specific molecular mechanism. Here, we evaluated the effect of miR-628-3p on HCC proliferation by using in vitro proliferation assays and a xenograft tumor model. Flow cytometry was used to monitor the cell cycle and apoptosis of HCC cells. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) and Western blot (WB) were used to determine the expression of each gene. Our study showed that miR-628-3p levels decrease in HCC, and its overexpression can enhance cell proliferation and cell cycle progression while suppressing apoptosis. Examination of the gene expression profiles of MHCC9H cells with miR-628-3p overexpression shows that cancer-promoting pathways like hypoxia and Notch signaling are upregulated. Meanwhile, miR-628-3p overexpression inhibits tumor suppressor pathways such as apoptosis and p53 signaling. miR-628-3p affects the cell cycle and apoptosis of HCC through the p53 pathway. Moreover, the expression of miR-628-3p is regulated by p53 to some extent. Our findings suggest that miR-628-3p has a tumor-promoting effect on HCC and that miR-628-3p inhibitors may be a new therapeutic approach for HCC.

Keywords: Apoptosis, Cell cycle, HCC, miR-628-3p, Proliferation, p53

Graphical abstract

Image 1

Open in a new tab

Highlights

  • •

    Our study revealed that miR-628-3p overexpression activated Notch/hypoxia and inhibited p53/apoptosis signaling pathways.

  • •

    Moreover, miR-628-3p can both inhibit p53 and the cell cycle arrest and apoptosis it induces.

  • •

    Targeting miR-628-3p or its downstream targets might offer new therapeutic strategies for HCC treatment.

Abbreviations

ATCC

American Type Culture Collection

BCA

Bicinchoninic Acid

Ct values

cycle times

DMEM

Dulbecco's modified Eagle medium

EdU

Ethynyl-2-deoxyuridine;

FITC

Fluorescein Isothiocyanate

h

hour

HCC

Hepatocellular carcinoma

min

minute

miRNA

microRNA

mRNA

messenger RNA

nm

nanometer

NSCLC

non-small cell lung cancer

PBS

phosphate buffered saline;

PCR

Polymerase Chain Reaction

PVDF

Polyvinylidene

RISC

RNA-induced silencing complex

RNA-seq

RNA sequencing

RT-qPCR

Reverse Transcription-Quantitative Polymerase Chain Reaction

SncRNA

small noncoding RNA

STR

short tandem repeat

TCGA

The Cancer Genome Atlas

ug

microgram

ul

microliter

WB

Western blot

1. Introduction

Based on the most recent global cancer statistics, liver cancer is ranked sixth in terms of global incidence [[1], [2], [3]]. Primary liver cancer encompasses various types, including HCC, intrahepatic cholangiocarcinoma, and etc [4,5]. HCC is the predominant type, representing approximately 75 %–85 % of all cases [[6], [7], [8]]. In the management of HCC, early-stage disease can be addressed through liver transplantation or resection, whereas patients with advanced-stage disease typically require pharmacological interventions [9,10]. The drug treatment for patients with HCC remains unfavorable at present. Therefore, it is imperative to elucidate the underlying mechanisms responsible for the onset and progression of HCC and to discover novel targets for pharmacological intervention.

Nonmutational epigenetic reprogramming has been identified as one of the fourteen hallmarks of cancer [[11], [12], [13]]. Epigenetics is a regulatory mechanism that change the phenotype of an organism without alterations in the genetic sequence, encompassing three primary categories: DNA methylation, histone modifications, and regulation facilitated by small noncoding RNA(SncRNA) [[14], [15], [16]]. MicroRNA (miRNA), are SncRNAs that are typically 17–22 nucleotides in length and can target more than 30 % of the human genome [[17], [18], [19]]. miRNAs are initially transcribed by RNA polymerase II within the nucleus, giving rise to primary miRNAs. Primary miRNAs are subsequently cleaved by the enzyme Drosha ribonuclease III to generate precursor miRNAs, which are then transported to the cytoplasm via the Exportin-5. Once in the cytoplasm, the precursor miRNA is further processed by Dicer 1 ribonuclease III to yield mature miRNA duplexes, one of which is typically degraded, and one additional strand binds to the Argonaute proteins to aid in the formation of the RNA-induced silencing complex (RISC) [[20], [21], [22]]. Within the RISC, specific messenger RNA (mRNA) is targeted by miRNA, leading to either the inhibition of translation or the degradation of the mRNA [[23], [24], [25]].

miR-628-3p, a member of the miR-628 miRNA family, has been reported to be downregulated in some cancer types, is associated with tumor suppressive activities and functions as a tumor suppressor in these cancers. According to the established literature, miR-628-3p has been reported to inhibit c-myc by downregulating BPTF, leading to the suppression of proliferation and migration in pancreatic cancer [26]. In lung cancer, miR-628-3p has been demonstrated to promote apoptosis and inhibit migration in A549 cells by negatively regulating HSP90 [27]. However, the specific function of miR-628-3p in HCC has yet to be definitively determined. The Cancer Genome Atlas (TCGA) data reveal that miR-628-3p is low-expressed in liver cancer, yet patients with lower miR-628-3p expression have longer survival, which seems contradictory. Hence, we aim to explore the role of miR-628-3p in liver cancer and its underlying molecular mechanism.

TP53, an important tumor-suppressor gene, encodes the p53 protein. p53 mainly functions involve regulating the cell cycle, inducing apoptosis, and maintaining genome stability [[28], [29], [30]]. The p53 is frequently mutated in numerous cancers, and the mutated protein loses its normal tumor-suppressing ability [31]. Otherwise, p53 is closely linked to miRNA. Some miRNAs can directly regulate the expression of the p53. For example, miR-125b can suppress the translation of the p53 by binding to the 3′-UTR of the p53. When miR-125b expression is upregulated, the p53 protein level decreases, affecting the cell's response to stress signals like DNA damage [32]. Additionally, p53 can function as transcription factors that directly bind to the promoter regions of certain miRNA genes to regulate their transcription. For instance, p53 can activate the transcription of miR-34a through binding to the p53 binding site of miR-34a when cells are under DNA damage or stress [33]. In lung cancer, p53 has also been reported to activate the transcription of miR-628-3p by binding the promotor of miR-628-3p [34].

2. Materials and methods

2.1. Bioinformatics analysis

The Cancer MiRNome dataset from TCGA (https://oncomir.org/, accessed on April 10, 2023) was utilized to analyze the expression of miR-628-3p across a range of cancer types. Survival analysis of miR-628-3p in HCC patients was performed by using Kanplan-Meier Plotter (https://kmplot.com). Enrichment analysis of genes was performed by gene set enrichment analysis software (GSEA, v4.1.0).

2.2. Clinical patient specimens

RNAextraction and RT-qPCR was performed on 21 pairs of HCC and adjacent tissues from the First Affiliated Hospital of Chongqing Medical University.

2.3. Cell culture and siRNA transfection

L02, PLC/PRF/5, HCC97H, Huh7, HCCLM3 and HepG2 cell lines were obtained from American Type Culture Collection (ATCC). Authentication of all cell lines was conducted through short tandem repeat (STR) profiling. STR testing was last carried out on all cells in January 2023. In this study, cultured cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10 % fetal bovine serum and 1 % penicillin/streptomycin. The cells were cultured in an environment containing 5 % carbon dioxide at 37 °C. The mimic or inhibitor (Generay, Shanghai, China) was transfected at concentrations ranging from 20 to 125 nM via the Lipo8000 reagent (Beyotime, Shanghai, China).

2.4. Extraction of RNA and RT-qPCR

All RNAs, including miRNAs, were isolated via TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) and subsequently reverse transcribed via a Takara reverse transcription kit (Takara, Kusatsu, Shiga, Japan). Polymerase Chain Reaction (PCR) was conducted with a Bio-Rad CFX Connect real-time PCR system (Hercules, CA, USA) along with SYBR Green mix from Bimake (Houston, TX, USA). In an identical sample, the cycle times (Ct values) of genes were standardized by utilizing either the ACTB or U6 value as a reference. Gene expression levels were assessed through the 2-ΔΔCt method, and the detailed information of the primers are provided in Supplementary Table S1.

2.5. Mimic/inhibitor

The mimic included a control and the miR-628-3p mimic UCUAGUAAGAGUGGCAGUCGA (Generay, Shanghai, China). The inhibitor also included a control and the miR-628-3p inhibitor UCGACUGCCACUCUUACUAGA (Generay, Shanghai, China).

2.6. Immunohistochemistry

Immunohistochemical staining was conducted via the ABC Peroxidase Staining Kit (Thermo, Waltham, USA). The paraffin-embedded tissues were subjected to an ethanol-xylene deparaffinization procedure following their sectioning into 4 μm sections. The pressure cooker was used for antigen retrieval, and 3 % hydrogen peroxide was used to deactivate endogenous peroxidase activity. Each section was subsequently blocked with goat serum and incubated overnight at room temperature with the specific antibody. After incubation with the secondary antibody, the Ki67 primary antibody was used to stain the cells with DAB staining solution (ZhongShanJinQiao, Beijing, China), and the nuclei were stained with hematoxylin staining solution (Beyotime, Shanghai, China). Immunohistochemistry images were quantified via ImageJ software. H score = 1 × percentage contribution of low positive +2 × percentage contribution of positive +3 × percentage contribution of high positive.

2.7. Colony formation assay

A total of 1000 cells were evenly distributed into individual wells of a 6-well plate, followed by incubation at 37 °C for more than two weeks. When the number of individual clone cells exceeded 50, the cells were washed with PBS, subsequently fixed with 5 % paraformaldehyde, and stained with crystal violet solution (Beyotime, Shanghai, China). Ultimately, the total number of clones was determined.

2.8. RNA sequencing (RNA-seq)

The samples were individually subjected to RNA extraction via TRIzol reagent (Invitrogen). The cDNA libraries were constructed for each RNA sample via the VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina (Vazyme, Inc.). The libraries were quality controlled with an Agilent 2200 and sequenced via DNBSEQ-T7 on a 150 bp paired-end run.

2.9. 5-Ethynyl-2-deoxyuridine (EdU) incorporation assay

The EdU cell proliferation assays were conducted in accordance with the manufacturer's instructions using an EdU kit containing Alexa Fluor 488 (Epizyme, Shanghai, China). The cells were subsequently inoculated on slides. After 2 h of exposure to EdU, the cells were fixed with 4 % paraformaldehyde for 20 min (min), incubated in the dark with click solution for 30 min, and subsequently stained with Hoechst 33,342 staining solution for 12 min to visualize the nuclei. Images of the cells were captured via a laser scanning confocal microscope (Leica, Wetzlar, Germany), and the cell proliferation was evaluated by EdU positive rate.

2.10. CCK-8 assay

Cell proliferation was quantified via a Cell Counting Kit (TargetMoi, Shanghai, China). HCC cells were seeded in 96-well plates at a density of 3000 cells per well and incubated for 12 h (h). Then, adding 10 μL (ul) of CCK-8 to the culture medium. Cell proliferation was assessed every 24 h following the instructions. The CCK-8 Kit was subsequently added to each well of a 96-well plate, which was subsequently incubated at 37 °C for 30min to 2h in the dark. Then, absorbance of culture medium at 450 nm (nm) was measured through microplate reader (Bio-Tek, USA).

2.11. Cell cycle analysis

The HCC cells are washed three times with cold phosphate buffered saline (PBS) after being transfected for 48 h. The cells were subsequently resuspended in 300 μl PBS and treated with 700 μl 70 % ethanol at 4 °C. Following fixation for 10 h. Then, the cells were washed three times in PBS and stained with propidium iodide (Dojindo, Shanghai, China) for 30 min in the dark. The distribution of cells across different phases in cell cycle was determined via flow cytometry (Beckman, California, USA).

2.12. Apoptosis assay

The cells were subjected to apoptosis detection using the apoptosis kit (BD, Biosciences, Franklin Lakes, NJ, USA). The cells were diluted with binding buffer and then, PI and Fluorescein Isothiocyanate (FITC) were added. After 15 min of incubation in the dark, the ratio of apoptotic cells was detected by flow cytometry sorter (Beckman, California, USA).

2.13. Protein extraction and WB

Tissue or cell is lysed via protein lysate (CWBIO, Beijing, China) containing protease inhibitors and phosphatase inhibitors. The protein concentration is determined by the Bicinchoninic Acid (BCA). Proteins are separated by electrophoresis and then transferred to a Polyvinylidene (PVDF) membrane. The PVDF membrane is blocked with 5 % skim milk. A specific antibody is incubated with the PVDF membrane overnight, followed by washing with TBST. Subsequently, a secondary antibody was incubated for 90 min. Finally, exposure was performed. All antibodies and reagents are available in S2 Table2.

2.14. Plasmid DNA construction and lentivirus packaging

The lentiviral packaging plasmid pMD2.G/psPAX2 was graciously supplied by Professor Ni Tang of Chongqing Medical University. The pGreen-miR-628 plasmid was procured from LeapWal (Hunan, China). The negative control plasmid was obtained from Generay (Shanghai, China). Subsequently, HEK293T cells were co-transfected with 2 μg (ug) psPAX2 and 1 μg pMD2.G, followed by packaging 3 μg of either the control plasmid or the overexpression plasmid with Lipo8000 (Beyotime, Shanghai, China).

2.15. Animal experiments

The male BALB/c nude mice were provided by ENSIWEIER Corporation (Chongqing, China). Each cohort of six nude mice was administered subcutaneous injections containing either 5 × 106 pGreen-628 or NC cells, and their progress was monitored thrice weekly. After 28 days, the dimensions and masses of the tumors present in the nude mice were quantified.

2.16. Statistical analysis

Statistical analysis and graphical representation of the measurement data were conducted via GraphPad Prism 8.0, with the mean ± standard deviation values reported.

3. Results

3.1. Expression pattern and prognostic analysis of miR-628-3p in HCC

Initially, we examined the expression of miR-628-3p in all kinds of cancers. The results showed that the expression of miR-628-3p was generally lower in various cancers compared to normal tissues (Fig. 1A). Compared with normal liver tissues, the level of miR-628-3p decrease significantly in HCC tissues (Fig. 1B). Total RNA containing miRNA was isolated from 21 pairs of liver cancer and adjacent tissues of HCC patients at the First Affiliated Hospital of Chongqing Medical University. The RT-qPCR findings revealed a significant decrease in miR-628-3p expression in liver cancer tissues compared with adjacent tissues (Fig. 1C). In an experiment examining endogenous expression, miR-628-3p was significantly downregulated in liver cancer cells compared with normal liver L02 cells (Fig. 1D). Survival analysis revealed a significant correlation between increased levels of miR-628-3p and a negative prognosis, whereas decreased levels were associated with a more favorable outcome (Fig. 1E). These findings suggest that miR-628-3p may have a significant effect on the initiation and progression of liver cancer.

Fig. 1.

Fig. 1

Open in a new tab

Expression pattern and prognostic analysis of miR-628-3p in HCC. (A)The expression of miR-628-3p in pan-cancer is showed. (B)The analysis of the expression of has-miR-628-3p is conducted utilizing HCC data from TCGA. (C)The relative miR-628-3p expression of twenty-one pairs of HCC clinical samples are detected via RT-qPCR. (D)The expression of miR-628-3p is quantified in various HCC cell lines and normal liver cells L02 through RT-qPCR analysis. (E)The relationship between miR-628-3p expression and overall survival of HCC patients is represented. For (C, D), three independent experiments are conducted, ∗∗∗∗P < 0.0001.

3.2. The proliferation of HCC cells is promoted by the overexpression of miR-628-3p in vitro

To clarify the impact of miR-628-3p on HCC, miR-628-3p mimics were used to upregulate its expression in MHCC97H and Huh7 cells (Fig. 2A). Liver cancer cells were subsequently subjected to proliferation testing via CCK8 assays, with the absorbance at a wavelength of 450 nm serving as an indicator of the number of proliferating cells. The results indicated that compared with negative control cells, MHCC97H and Huh7 cells treated with miR-628-3p mimics exhibited a significantly greater rate of proliferation (Fig. 2B). The findings of EdU assay indicated a significant increase in the proportion of EdU-positive HCC cells following the overexpression of miR-628-3p (Fig. 2C). The result of colony formation showed that the number of clones in miR-628-3p-overexpressing cells is more than in negative control cells (Fig. 2D). In conclusion, the above results prove that miR-628-3p promote the growth in HCC in vitro.

Fig. 2.

Fig. 2

Open in a new tab

The proliferation of HCC cells is promoted by overexpression of miR-628-3p in vitro. (A)miR-628-3p mimics are transfected into HCC cells at a concentration of 20 nM. (B)The proliferative capacity of Huh7 and MHCC97H cells was assessed by CCK8 assay. (C)The proliferative capacity of HCC is showed by the proportion of EdU-positive cells. (D)The colony formation ability of HCC cells is assessed using the colony formation assay. For (A–D), three replicates are conducted for each experiment. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.

3.3. In vitro, the silence of miR-628-3pinhibits HCC proliferation

To further validate the function of miR-628-3p in enhancing liver cancer growth, the miR-628-3p inhibitors were used and its efficacy was confirmed through RT-qPCR assays (Fig. 3A). The results of CCK-8 assays revealed a decrease in the proliferation ability of HepG2 and PLC/PRF cells when the miR-628-3p level was reduced (Fig. 3B). Comparable outcomes were observed via both EDU staining and colony formation assays, indicating that the silence of miR-628-3p led to significant inhibition of HCC cell proliferation (Fig. 3C–D). The above results show that the silence of miR-628-3p can inhibit the proliferation of HCC in vitro.

Fig. 3.

Fig. 3

Open in a new tab

In vitro, the silence of miR-628-3p inhibits HCC proliferation. (A)concentration of 125 nM miR-628-3p inhibitors are transfected into HepG2 and PLC/PRF cells. (B)The CCK8 assay was employed to monitor the proliferation of HCC cells. (C)The proliferative capacity of HepG2 and PLC/PRF/5 cells is showed by the proportion of EdU-positive cells. (D)Colony formation assays are conducted to assess the colony formation capacity of HCC cells. Three replicates of each experiment from A to E are conducted. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.

3.4. Impact of miR-628-3p on the cell cycle and apoptosis

Cell cycle and apoptosis are vital biological processes related to tumor proliferation. We intended to investigate whether miR-628-3p affects the cell cycle and apoptosis of HCC cells. The miR-628-3p overexpression were discovered to prolong the S phase and decrease the apoptosis rate of HCC cells (Fig. 4A–C). On the contrary, miR-628-3p silence led to the arrest of the G1/S phase in the HCC cell cycle and increased the apoptosis rate (Fig. 4B–D). These results suggested that miR-628-3p was capable of facilitating the HCC cell cycle and suppressing cell apoptosis.

Fig. 4.

Fig. 4

Open in a new tab

Impact of miR-628-3p on the cell cycle and apoptosis. (A)The cell cycle of Huh7 and MHCC97H cells is detected by flow cytometry. (B)The cell cycle of PLC/PRF/5 and HepG2 cells is detected by flow cytometry. (C)The apoptotic ratio of Huh7 and MHCC97H is detected by flow cytometry. (D) The apoptotic ratio of PLC/PRF/5 and HepG2 cells is detected by flow cytometry. For (A–D), each experiment is run independently three times. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.

3.5. miR-628-3p promotes hypoxia/notch and inhibits apoptosis/p53 signaling pathways

To further investigate the specific molecular mechanism through which miR-628-3p promotes the progression of liver cancer, a plasmid was constructed to facilitate the overexpression of mature miR-628-3p. Subsequently, lentivirus was used to infect MHCC97H cells, leading to the formation of stable cell lines with elevated levels of miR-628-3p (Fig. 5A). A series of different expressed genes were identified via RNA-seq of HCC cells overexpressing miR-628-3p (Fig. 5B). GSEA was subsequently conducted on the identified different expressed genes, revealing alterations in the expression of signaling pathway molecules associated with liver cancer proliferation following the overexpression of miR-628-3p. Several signaling pathways that promote liver cancer proliferation, including the hypoxia, Notch, glycolysis, and adipogenesis pathways, were activated. Conversely, pathways that inhibit liver cancer proliferation, such as the apoptosis and p53 signaling pathways, were inhibited (Fig. 5C–D, S1A-C). The result of heatmap revealed the upregulation of core molecules associated with hypoxia and the Notch signaling pathway, including TP53, SLC2A1, NOTCH1, and NOTCH2 mRNAs, whereas the downregulation of molecules related to apoptosis and the p53 signaling pathway, such as BAX, CASP3, TP53 and GADD45A mRNAs (Fig. 5E). Four representative core molecules from each enriched pathway were subsequently chosen for validation through RT-qPCR analysis, yielding results that aligned with the findings depicted in the heatmap (Fig. 5F).

Fig. 5.

Fig. 5

Open in a new tab

miR-628-3p promotes hypoxia/Notch and inhibits apoptosis/p53 signaling pathways. (A)The expression of miR-628-3p in MHCC97H cells is detected through RT-qPCR. (B)The heatmap displays the differential expression of genes in cells overexpressing miR-628-3p. (C)Bubble plot displays the GSEA enrichment pathways in cells overexpressing miR-628-3p. (D)The correlation between miR-628-3p and the four signaling pathways is displayed by line chart. (E)The expression of core genes within four GSEA pathways is displayed. (F)The mRNA expression of key core genes within the four GSEA pathways is assessed via RT-qPCR. For (A–F), each experiment is run independently three times. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.

3.6. miR-628-3p promotes HCC proliferation in vivo

To investigate the impact of miR-628-3p on the proliferation of HCC in vivo, a subcutaneous tumor formation model was established in nude mice. At the beginning of the experiment, the nude mice were subcutaneously injected with MHCC97H-Vector/pGreen-628 cells, with six mice allocated to each experimental group. The subcutaneous tumor volume was subsequently measured every three days, and on the 21st day, the tumors in the nude mice were excised, and their weights were recorded. The results indicated that nude mice in the miR-628-3p overexpression group presented significantly greater tumor volume and weight than did those in the control group (Fig. 6A–B). The efficacy of miR-628-3p overexpression in the xenograft tumors was validated through RT-qPCR assay (Fig. 6C). The results of HE and Ki67 staining of xenograft tumors in nude mice revealed that, the proportion of Ki67-positive cells in the miR-628-3p overexpressing group was greater than those in control group (Fig. 6D). In addition, the results of RT-qPCR of xenograft tumors revealed that the hypoxia, Notch, glycolysis and adipogenesis signaling pathways are activated, whereas the apoptosis and p53 signaling pathways are inhibited in the miR-628-3p overexpression group (Fig. 6E–S1D). These results further confirmed that miR-628-3p promote the proliferation of HCC cells by promoting the Notch, hypoxia, glycolysis and adipogenesis signaling pathways, as well as inhibiting the apoptosis and p53 signaling pathways. All above findings confirm that miR-628-3p enhances the proliferation of HCC in an in vivo.

Fig. 6.

Fig. 6

Open in a new tab

miR-628-3p promotes HCC proliferation in vivo. (A)The xenograft tumors are arranged according to the group and the line chart shows the changes in the volume of the xenograft tumors with time. (B)The dot plot shows the weight of tumor in the two groups. (C)The expression of miR-628-3p in xenograft tumors is detected by RT-qPCR. (D)Immunohistochemical staining for HE/Ki67 is conducted on xenograft tumor tissues, the histogram shows the Ki67 H-score of tumor tissues. (E)The mRNA level of core genes in the four GSEA signaling pathways is detected via RT-qPCR. For (A-C, E), each experiment is performed 3 times independently. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.

3.7. miR-628-3p affects the cell cycle and apoptosis relying on the p53 signaling pathway

p53, a renowned tumor suppressor molecule, can restrain the proliferation of cancer cells and facilitate cancer cell death by influencing the cell cycle and apoptosis. Based on our previous finding that miR-628-3p can affect the cell cycle and apoptosis of HCC, we hypothesized that the p53 pathway is the important pathway by which miR-628-3p affect HCC cell cycle and apoptosis.

First, we verified if miR-628-3p impact the p53 signaling pathway. We found that the mRNA levels of p53 and its downstream molecules Fas and p21 are upregulated by the silence of miR-628-3p. WB experiment yielded similar results (Fig. S2A and 7A). We also employed the p53 inhibitor PFTα to further explore the connection between miR-628-3p and the p53 pathway. It was discovered that PFTα eliminated the activation of the p53 pathway induced by the silence of miR-628-3p. (Fig. 7A). Moreover, PFTα also abolished the effect of miR-628-3p silencing on the cell cycle and apoptosis in HCC cells (Fig. 7B and C). In conclusion, miR-628-3p affects HCC cell cycle and apoptosis relying on the p53 signaling pathway.

Fig. 7.

Fig. 7

Open in a new tab

miR-628-3p affects the cell cycle and apoptosis relying on the p53 signaling pathway. (A)The expression of p53 pathway-related proteins in PLC/PRF/5 cells and HepG2 cells is detected by WB assay. (B)The cell cycle of HCC cells was detected by flow cytometry (C)The apoptotic ratio of PLC/PRF/5 cells and HepG2 cells is detected by flow cytometry.

3.8. p53 regulates the expression of miR-628-3p

We have shown that miR-628-3p is oncogenic in HCC. However, a significant unresolved question is the decreased expression of miR-628-3p in HCC. A previous study reported that the transcription of miR-628-3p is activated by p53 in non-small cell lung cancer (NSCLC), which binds to the promoter of miR-628-3p host gene [34]. To determine whether p53 regulates miR-628-3p expression, we utilized the p53 agonist Nutilin-3a and the p53 inhibitor PFTα to modulate the activity of p53. Our results indicated that the miR-628-3p expression is upregulated after activating the p53 and miR-628-3p level is downregulated after inhibiting the p53 (Fig. 8A–B). According to the findings above, p53 plays a role in the regulation of miR-628-3p expression to some degree, thereby contributing to the reduced expression of miR-628-3p in HCC.

Fig. 8.

Fig. 8

Open in a new tab

p53 regulates the expression of miR-628-3p. (A)The relative expression of TP53 and miR-628-3p in MHCC97H/Huh7 cells is assessed through RT-qPCR. (B)The relative expression of TP53 and miR-628-3p in PLC/PRF/5 and Huh7 cells is assessed through RT-qPCR. For (A–B), each experiment is run independently three times. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.

4. Discussion

Liver transplantation and surgical resection remain the cornerstone therapies for early-stage HCC, while molecularly targeted agents constitute the primary treatment modality for advanced-stage disease. However, the current therapeutic arsenal for advanced-stage HCC remains limited, with existing targeted therapies demonstrating suboptimal efficacy in clinical practice. Consequently, the discovery and validation of novel therapeutic targets represents a critical unmet need in HCC treatment [35,36]. Our research revealed that the expression of miR-628-3p is commonly decreased in HCC, and the miR-628-3p upregulation is positively correlated with poor prognosis. The silence of miR-628-3p has been shown to inhibit the progression and proliferation of HCC, indicating that therapeutic intervention targeting miR-628-3p may hold promise for the treatment of HCC.

miR-628-3p has been reported to inhibit c-myc by downregulating BPTF, leading to the suppression of proliferation and migration in pancreatic cancer [26]. In lung cancer, miR-628-3p has been demonstrated to promote apoptosis and inhibit migration in A549 cells by negatively regulating HSP90 [27]. However, our study verified that miR-628-3p play a tumor-promoting role in HCC. Our study demonstrates that miR-628-3p can promote HCC proliferation, facilitate cell cycle and inhibit apoptosis. Besides, elevated miR-628-3p expression correlated with poorer survival outcomes in HCC patients. In addition, we find that the overexpression of miR-628-3p could activate the Notch, hypoxia, glycolysis, adipogenesis signaling pathway and inhibitor the apoptosis and p53 pathway. Moreover, miR-628-3p affects the cell cycle and apoptosis of HCC through p53 pathway. All these results indicate that miR-628-3p is an oncogene in HCC.

To clarify the potential mechanism that the miR-628-3p is low expression in HCC, we investigated the potential molecule of governing miR-628-3p. The p53 has been reported to promote the transcription of miR-628-3p by binding to its promoter region in NSCLC [34]. We confirmed that the p53 can indeed promote the expression of miR-628-3p via RT-qPCR. Using both p53 agonists and inhibitors to modulate p53 expression and activity, we observed that miR-628-3p expression decreased upon p53 inhibition, while p53 activation led to corresponding upregulation of miR-628-3p. Therefore, we hypothesize that the downregulation of miR-628-3p in HCC may result from impaired transcriptional activation induced by suppressed p53 function or expression in HCC.

We have explored the effect and mechanism of miR-628-3p on HCC proliferation, however, the direct interaction between miR-628-3p and p53, the effect of miR-628-3p on other biological processes in HCC, the clinical efficacy of miR-628-3p inhibitors need to be further explored.

In summary, our study demonstrates that miR-628-3p boost the growth and progression of HCC cells by activating the hypoxia/Notch pathway and inhibiting the apoptosis/p53 pathway. Moreover, miR-628-3p can regulate the cell cycle and apoptosis via p53 signaling pathway, and its expression is elevated by p53-driven transcriptional activation. Our study uncovered the mechanism of how miR-628-3p promote HCC progression. Targeting miR-628-3p or its downstream targets might offer new therapeutic strategies for HCC treatment.

CRediT authorship contribution statement

Lele Liu: Data curation, Writing – original draft, Software. Ziyi Cheng: Data curation, Investigation. Dina Liu: Resources, Software. Mingang Pan: Conceptualization, Methodology. Muyu Luo: Data curation. Yunmeng Chen: Software. Jie Xia: Conceptualization, Writing – review & editing, Supervision, Funding acquisition.

Ethics approval and consent to participate

Animal experiments were carried out according to the Guide for the Care and Use of Laboratory Animals and all animal procedures to be employed in the project were approved by the Institutional Animal Care and Use Committee of Chongqing Medical University (approval number: IACUC-CQMU-2024-0390). The human studies used in this study were approved by the Ethics Committee of Chongqing Medical University (approval number: 2024049). Informed consent was obtained from all the subjects for the collection of clinical samples for this study.

Consent for publication

The informed consent obtained from study participants.

Data availability statement

The RNA sequencing data used in this study are available from the GEO database: GSE269312.

Funding

This research was supported by the Science and Technology Research Project of the Chongqing Education Commission (Approval number: KJQN202000424) and the Chongqing Postdoctoral Science Foundation Project (grant number: CSTB2023NSCQ-BHX011).

Declaration of competing interest

On behalf of all the authors, I declare no competing interests here and the work described was original research that has not been published previously, and not under consideration for publication elsewhere. All the authors listed have approved the manuscript and agree with its submission to Biochemistry and Biophysics Reports.

Acknowledgments

We thank Ni Tang (Key Laboratory of Molecular Biology on Infectious Diseases, Chongqing Medical University) for supplying the pMD2.G, and psPAX2.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrep.2025.102186.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.docx (408.8KB, docx)

References

  • 1.Nadarevic T., Giljaca V., Colli A., Fraquelli M., Casazza G., Miletic D., Štimac D. Computed tomography for the diagnosis of hepatocellular carcinoma in adults with chronic liver disease. Cochrane Database Syst. Rev. 2021;10 doi: 10.1002/14651858.CD013362.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Nadarevic T., Colli A., Giljaca V., Fraquelli M., Casazza G., Manzotti C., Štimac D., Miletic D. Magnetic resonance imaging for the diagnosis of hepatocellular carcinoma in adults with chronic liver disease. Cochrane Database Syst. Rev. 2022;5:CD014798. doi: 10.1002/14651858.CD014798.pub2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wang B., Tang C., Lin E., Jia X., Xie G., Li P., Li D., Yang Q., Guo X., Cao C., et al. NIR-II fluorescence-guided liver cancer surgery by a small molecular HDAC6 targeting probe. EBioMedicine. 2023;98 doi: 10.1016/j.ebiom.2023.104880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.J C., A B., H D., S R., B P., Sm K., M F., Y P., V B., N L., et al. Common molecular subtypes among asian hepatocellular carcinoma and cholangiocarcinoma. Cancer Cell. 2017;32 doi: 10.1016/j.ccell.2017.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hong T.S., Wo J.Y., Yeap B.Y., Ben-Josef E., McDonnell E.I., Blaszkowsky L.S., Kwak E.L., Allen J.N., Clark J.W., Goyal L., et al. Multi-institutional phase II study of high-dose hypofractionated proton beam therapy in patients with localized, unresectable hepatocellular carcinoma and intrahepatic cholangiocarcinoma. J. Clin. Oncol. 2016;34:460–468. doi: 10.1200/JCO.2015.64.2710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021;71:209–249. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
  • 7.Song H., Sun N., Lin L., Wei S., Zeng K., Liu W., Wang C., Zhong X., Wang M., Wang S., et al. Splicing factor PRPF6 upregulates oncogenic androgen receptor signaling pathway in hepatocellular carcinoma. Cancer Sci. 2020;111:3665–3678. doi: 10.1111/cas.14595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhao X., Tang D., Chen X., Chen S., Wang C. Functional lncRNA-miRNA-mRNA networks in response to baicalein treatment in hepatocellular carcinoma. BioMed Res. Int. 2021 doi: 10.1155/2021/8844261. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Li Y.-M., Xu C., Sun B., Zhong F.-J., Cao M., Yang L.-Y. Piezo1 promoted hepatocellular carcinoma progression and EMT through activating TGF-β signaling by recruiting Rab5c. Cancer Cell Int. 2022;22:162. doi: 10.1186/s12935-022-02574-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li S.-Q., Su L.-L., Xu T.-F., Ren L.-Y., Chen D.-B., Qin W.-Y., Yan X.-Z., Fan J.-X., Chen H.-S., Liao W.-J. Radiomics model based on contrast-enhanced computed tomography to predict early recurrence in patients with hepatocellular carcinoma after radical resection. World J. Gastroenterol. 2023;29:4186–4199. doi: 10.3748/wjg.v29.i26.4186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hanahan D. Hallmarks of cancer: new dimensions. Cancer Discov. 2022;12:31–46. doi: 10.1158/2159-8290.CD-21-1059. [DOI] [PubMed] [Google Scholar]
  • 12.Wang Z., Yang B., Zhang M., Guo W., Wu Z., Wang Y., Jia L., Li S., Xie W., Yang D. LncRNA epigenetic landscape analysis identifies EPIC1 as an oncogenic lncRNA that interacts with MYC and promotes cell cycle progression in cancer. Cancer Cell. 2018;33:706–720.e9. doi: 10.1016/j.ccell.2018.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lu C., Wei Y., Wang X., Zhang Z., Yin J., Li W., Chen L., Lyu X., Shi Z., Yan W., et al. DNA-methylation-mediated activating of lncRNA SNHG12 promotes temozolomide resistance in glioblastoma. Mol. Cancer. 2020;19:28. doi: 10.1186/s12943-020-1137-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yamamuro C., Zhu J.-K., Yang Z. Epigenetic modifications and plant hormone action. Mol. Plant. 2016;9:57–70. doi: 10.1016/j.molp.2015.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tsai H.-C., Baylin S.B. Cancer epigenetics: linking basic biology to clinical medicine. Cell Res. 2011;21:502–517. doi: 10.1038/cr.2011.24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.De Carvalho D.D., Sharma S., You J.S., Su S.-F., Taberlay P.C., Kelly T.K., Yang X., Liang G., Jones P.A. DNA methylation screening identifies driver epigenetic events of cancer cell survival. Cancer Cell. 2012;21:655–667. doi: 10.1016/j.ccr.2012.03.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhang Y., Gao L., Wang Y., Niu D., Yuan Y., Liu C., Zhan X., Gai S. Dual functions of PsmiR172b-PsTOE3 module in dormancy release and flowering in tree peony (Paeonia suffruticosa) Hortic. Res. 2023;10 doi: 10.1093/hr/uhad033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Cai C., Lin J., Li J., Wang X.-D., Xu L.-M., Chen D.-Z., Chen Y.-P. miRNA-432 and SLC38A1 as predictors of hepatocellular carcinoma complicated with alcoholic steatohepatitis. Oxid. Med. Cell. Longev. 2022;2022 doi: 10.1155/2022/4832611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wei F., Cao C., Xu X., Wang J. Diverse functions of miR-373 in cancer. J. Transl. Med. 2015;13:162. doi: 10.1186/s12967-015-0523-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sun W., Li Y., Ma D., Liu Y., Xu Q., Cheng D., Li G., Ni C. ALKBH5 promotes lung fibroblast activation and silica-induced pulmonary fibrosis through miR-320a-3p and FOXM1. Cell. Mol. Biol. Lett. 2022;27:26. doi: 10.1186/s11658-022-00329-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hassan A.A., Artemenko M., Tang M.K.S., Shi Z., Chen L.-Y., Lai H.-C., Yang Z., Shum H.-C., Wong A.S.T. Ascitic fluid shear stress in concert with hepatocyte growth factor drive stemness and chemoresistance of ovarian cancer cells via the c-Met-PI3K/Akt-miR-199a-3p signaling pathway. Cell Death Dis. 2022;13:537. doi: 10.1038/s41419-022-04976-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Campbell A.M., De La Cruz-Herrera C.F., Marcon E., Greenblatt J., Frappier L. Epstein-Barr Virus BGLF2 commandeers RISC to interfere with cellular miRNA function. PLoS Pathog. 2022;18 doi: 10.1371/journal.ppat.1010235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kleaveland B. SnapShot: target-directed miRNA degradation. Cell. 2023;186:5674–5674.e1. doi: 10.1016/j.cell.2023.11.020. [DOI] [PubMed] [Google Scholar]
  • 24.Song X., Li Y., Cao X., Qi Y. MicroRNAs and their regulatory roles in plant-environment interactions. Annu. Rev. Plant Biol. 2019;70:489–525. doi: 10.1146/annurev-arplant-050718-100334. [DOI] [PubMed] [Google Scholar]
  • 25.Szabo G., Bala S. MicroRNAs in liver disease. Nat. Rev. Gastroenterol. Hepatol. 2013;10:542–552. doi: 10.1038/nrgastro.2013.87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lin J., Wang X., Zhai S., Shi M., Peng C., Deng X., Fu D., Wang J., Shen B. Hypoxia-induced exosomal circPDK1 promotes pancreatic cancer glycolysis via c-myc activation by modulating miR-628-3p/BPTF axis and degrading BIN1. J. Hematol. Oncol. 2022;15:128. doi: 10.1186/s13045-022-01348-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pan J., Jiang F., Zhou J., Wu D., Sheng Z., Li M. HSP90: a novel target gene of miRNA-628-3p in A549 cells. BioMed Res. Int. 2018 doi: 10.1155/2018/4149707. 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang H., Guo M., Wei H., Chen Y. Targeting p53 pathways: mechanisms, structures, and advances in therapy. Signal Transduct. Targeted Ther. 2023;8:92. doi: 10.1038/s41392-023-01347-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhang H., Zhang W., Hu B., Qin X., Yi T., Ye Y., Huang X., Song Y., Yang Z., Qian J., et al. Precise pancreatic cancer therapy through targeted degradation of mutant p53 protein by cerium oxide nanoparticles. J. Nanobiotechnol. 2023;21:117. doi: 10.1186/s12951-023-01867-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Makino Y., Hikita H., Fukumoto K., Sung J.H., Sakano Y., Murai K., Sakane S., Kodama T., Sakamori R., Kondo J., et al. Constitutive activation of the tumor suppressor p53 in hepatocytes paradoxically promotes non–cell autonomous liver carcinogenesis. Cancer Res. 2022;82:2860–2873. doi: 10.1158/0008-5472.CAN-21-4390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.J H., J C., W T., S J., S L., B Z., J S., L C., X C., M C. Targeting mutant p53 for cancer therapy: direct and indirect strategies. J. Hematol. Oncol. 2021;14 doi: 10.1186/s13045-021-01169-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wu N., Lin X., Zhao X., Zheng L., Xiao L., Liu J., Ge L., Cao S. MiR-125b acts as an oncogene in glioblastoma cells and inhibits cell apoptosis through p53 and p38MAPK-independent pathways. Br. J. Cancer. 2013;109:2853–2863. doi: 10.1038/bjc.2013.672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yang Y., Yuan H., Zhao L., Guo S., Hu S., Tian M., Nie Y., Yu J., Zhou C., Niu J., et al. Targeting the miR-34a/LRPPRC/MDR1 axis collapse the chemoresistance in P53 inactive colorectal cancer. Cell Death Differ. 2022;29:2177–2189. doi: 10.1038/s41418-022-01007-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pan J., Li M., Yu F., Zhu F., Wang L., Ning D., Hou X., Jiang F. Up-regulation of p53/miR-628-3p pathway, a novel mechanism of shikonin on inhibiting proliferation and inducing apoptosis of A549 and PC-9 non-small cell lung cancer cell lines. Front. Pharmacol. 2021;12 doi: 10.3389/fphar.2021.766165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yarchoan M., Agarwal P., Villanueva A., Rao S., Dawson L.A., Llovet J.M., Finn R.S., Groopman J.D., El-Serag H.B., Monga S.P., et al. Recent developments and therapeutic strategies against hepatocellular carcinoma. Cancer Res. 2019;79:4326–4330. doi: 10.1158/0008-5472.CAN-19-0803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Brown Z.J., Tsilimigras D.I., Ruff S.M., Mohseni A., Kamel I.R., Cloyd J.M., Pawlik T.M. Management of hepatocellular carcinoma: a review. JAMA Surg. 2023;158:410–420. doi: 10.1001/jamasurg.2022.7989. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (408.8KB, docx)

Data Availability Statement

The RNA sequencing data used in this study are available from the GEO database: GSE269312.

Articles from Biochemistry and Biophysics Reports are provided here courtesy of Elsevier

RESOURCES