Sperm tRNA-derived fragments expression is potentially linked to abstinence-related improvement of sperm quality

Abstract

Recent studies have shown that shorter periods of ejaculatory abstinence may enhance certain sperm parameters, but the molecular mechanisms underlying these improvements are still unclear. This study explored whether reduced abstinence periods could improve semen quality, particularly for use in assisted reproductive technologies (ART). We analyzed semen samples from men with normal sperm counts (n = 101) and those with low sperm motility or concentration (n = 53) after 3–7 days of abstinence and then after 1–3 h of abstinence, obtained from the Reproductive & Genetic Hospital of CITIC-Xiangya (Changsha, China). Physiological and biochemical sperm parameters were evaluated, and the dynamics of transfer RNA (tRNA)-derived fragments (tRFs) were analyzed using deep RNA sequencing in five consecutive samples from men with normal sperm counts. Our results revealed significant improvement in sperm motility and a decrease in the DNA fragmentation index after the 1- to 3-h abstinence period. Additionally, we identified 245 differentially expressed tRFs, and the mitogen-activated protein kinase (MAPK) signaling pathway was the most enriched. Further investigations showed significant changes in tRF-Lys-TTT and its target gene mitogen-activated protein kinase kinase 2 (MAP2K2), which indicates a role of tRFs in improving sperm function. These findings provide new insights into how shorter abstinence periods influence sperm quality and suggest that tRFs may serve as biomarkers for male fertility. This research highlights the potential for optimizing ART protocols and improving reproductive outcomes through molecular approaches that target sperm function.

INTRODUCTION

In a study on male fertility and infertility published in 1952, semen samples from fertile men showed better semen quality after <4 days of ejaculatory abstinence than after longer periods.1 Another study reported that semen characteristics showed variability within subjects, with abstinence being the key determinant.2 The period of abstinence is pivotal to ensuring good spermatozoa quantity and quality, which are both necessary for successful natural or assisted conception.3 The 5^th edition of the World Health Organization (WHO) Laboratory Manual for the Examination and Processing of Human Semen recommends 2–7 days as an optimal abstinence period for fertile men.4

Nonetheless, recent findings challenge this guideline, with superior semen quality in both oligoasthenospermic5 and normozoospermic men6 after shorter abstinence periods (1–3 h) compared with the traditional 2–7 days. Notably, semen samples collected after 2 h of abstinence showed an increased percentage of motile spermatozoa, with higher velocity and progressive motility. Additionally, previous studies reported that sperm DNA fragmentation index (DFI) can be efficiently reduced by short-term recurrent ejaculation.5,7 A proteomic study by Shen et al.8 revealed differential expression of fertility-related proteins after varying abstinence durations, which indicated a biological basis for these observations. Despite these advancements, the molecular mechanisms that contribute to enhanced sperm quality following shorter abstinence periods remain unclear.

Sperm contains approximately 10–20 fg of various types of RNA that play critical roles in spermatogenesis and sperm function.9 Recent research has highlighted the enrichment of small RNA segments, particularly transfer RNA (tRNA)-derived fragments (tRFs), in mouse, rat, and human sperm.10 tRFs are increasingly recognized for their multifaceted roles, including associations with sperm maturation11 and sperm quality,12 mirroring the function and size of microRNAs by potentially repressing target genes globally. Additionally, Chen et al.13 demonstrated that dietary changes can influence sperm tRF levels, triggering transcriptional cascade shifts and reprogramming gene expression.

On the basis of those findings, we compared the physiological and biochemical parameters of sperm collected from men after short (1–3 h) and long (3–7 days) abstinence periods. Furthermore, we determined the tRF expression profiles in mature human sperm from these distinct abstinence intervals using next-generation sequencing, and candidate tRFs and associated mRNAs were subsequently validated using residual RNA samples. With Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, we revealed the potential underlying molecular mechanisms involved in sperm tRF functions after reduced periods of ejaculatory abstinence.

PARTICIPANTS AND METHODS

Study design and participants

We enrolled 154 adult men as potential sperm donors at the Hunan Province Human Sperm Bank (Changsha, China) from 1 April 2020 to 31 July 2021. Participants were categorized into one of the two groups: those with normozoospermia (normo-group; n = 101) and those with either oligozoospermia or asthenozoospermia (O/A-group, n = 53). The normo-group included donors who met or exceeded all conventional sperm parameters according to the WHO guidelines.4 Asthenozoospermia was characterized by sperm motility less than 40%, and oligozoospermia was defined as a sperm concentration less than 15 × 10⁶ ml⁻¹.

No significant differences in age or body mass index (BMI) were observed between the two groups (both P > 0.05; Table 1). All participants signed informed consent forms during their first visit to the sperm bank, agreeing to the use of their semen samples and related data for scientific research purposes. This study was approved by the Ethics Committee of the Central South University (Changsha, China; Approval No. 2020-KT59). The study design is shown in Figure 1. Donors were excluded if they had a medical history of significance or urogenital surgeries (vasectomy or unilateral orchiectomy), used hormone drugs (e.g., clomifene or FSH), or had cardiovascular disease, medically treated psychological illness, previous chemotherapy or radiation therapy, ejaculatory disorders, varicocele, cryptorchidism, or orchitis.

Table 1.

The age and body mass index of two groups

Demographic	Normo-group	O/A-group	P
Age (year), mean±s.d.	22.8±0.4	24.0±0.7	0.18
BMI (kg m−2), mean±s.d.	22.50±0.30	21.60±0.30	0.08

Normo-group: paticipants with normozoospermia; O/A-group: participants with either oligozoospermia or asthenozoospermia; BMI: body mass index; s.d.: standard deviation

Figure 1.

A flowchart depicting our study design. tRNA: transfer RNA; tRF: tRNA-derived fragments; tRF-seq: tRNA-derived fragments sequencing; qRT-PCR: quantitative real-time reverse transcription polymerase chain reaction; DFI: DNA fragmentation index.

Sperm samples

Sperm samples were obtained from participants via masturbation after 3–7 days of sexual abstinence and then again after 1–3 h of abstinence. The samples were allowed to liquefy at 37°C for 30 min and then immediately processed. All samples were analyzed for primary parameters, such as semen volume and sperm concentration, sperm motility, total sperm count (TSC), and total motile sperm count (TMC), according to the WHO guidelines.4 All analyses were performed by the same well-trained technicians. Sperm motility and concentration were evaluated using a Makler counting chamber (magnification, 400×; Sefi Medical Instruments, Haifa, Israel) at 37°C. We assessed 400 spermatozoa per replicate to classify the samples on the basis of motility differences.

Chromatin structure assay

Sperm DFI was evaluated using the Sperm Chromatin Structure Assay (SCSA) Kit (Ruikemei Medical Technology Co., Ltd., Chengdu, China), which is the most precise and repeatable method.14 Measurements were made using a previously reported protocol15 using the BD Accuri C6 flow cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, USA).

Reactive oxygen species (ROS)

Intracellular ROS levels were measured with the Sperm Reactive Oxygen Species Detection Kit (Anke Institute of Biotechnology, Hefei, China) following the manufacturer’s instructions, using the 2’,7’-dichlorofluorescin diacetate fluorescent probe, as previously described by Bass et al.16

Acrosome reaction (AR) assay

AR assay was performed using the Sperm Acrosin Detection Kit (Anke Institute of Biotechnology) following the manufacturer’s instructions.

Sperm RNA extraction

Semen samples were initially washed three times with 1 ml of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (Boke Biological, Shanghai, China) and centrifuged at 600g (Eppendorf 5810; Eppendorf, Hamburg, Germany) for 10 min. Subsequently, the pellets were then suspended in somatic cell lysis buffer on ice for 30 min to eliminate somatic cells. Total RNA extraction from the purified spermatozoa was then performed according to the manufacturer’s instructions using TRI Reagent RNA Isolation Reagent (T9424; Sigma-Aldrich, St. Louis, MO, USA). Before sequencing, we assessed the quality and quantity of each RNA sample using agarose gel electrophoresis and a Nanodrop™ device (NanoDropONE/ONEC; Thermo Scientific, Waltham, MA, USA).

tRF sequence processing and target tRF validation

To characterize the tRF profiles after 3–7 days and 1–3 h of abstinence, tRF expression was compared between samples collected after short (1–3 h) and long (3–7 days) abstinence periods from five normozoospermic men using transfer RNA-derived fragment sequencing (tRF-seq). Total RNA was pretreated to remove RNA modifications that could interfere with small RNA-seq library construction using the rtStar™ tRF Pretreatment Kit (AS-FS-005; Arraystar, Rockville, MD, USA). Pretreated RNA was then used for tRF-seq library preparation using the rtStar™ First-strand cDNA Synthesis Kit (3’ and 5’ adaptor; AS-FS-003; Arraystar) following the manufacturer’s instructions.17

Sequencing was performed on the NextSeq system using the NextSeq 500/550 V2 Kit (#FC-404-2005; Illumina, San Diego, CA, USA). Raw sequence data were generated as clean reads from Illumina NextSeq 500 that passed the Illumina chastity filter. The sequencing reads were trimmed for both 5’- and 3’-adapter sequences, and reads of <14 nucleotides or >40 nucleotides were discarded with cutadapt.18 Differentially expressed (DE) tRFs were screened on the basis of the count value with R package edgeR.19

To preliminarily investigate the potential biological functions of the DE tRFs, we performed KEGG analysis using the KEGG database (http://www.genome.jp/kegg/, last accessed on April 1, 2022), and a significantly enriched pathway was defined by false discovery rate (FDR) < 0.05.

Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) validation

To verify the tRF-seq result accuracy, we screened and validated three tRFs by qRT-PCR with additional elevated standards: P < 0.001 and fold change >2.0. tRFs of each sample in one group should be expressed higher or lower than those in the other group. On the basis of these stringent standards, three tRFs (tRF-Lys-TTT, tRF-Gln-CTG, and tRF-Met-CAT), strongly associated with sperm quality,12,20,21,22 were selected for validation. For the remaining complementary DNA (cDNA), we used 2× PCR master mix (AS-MR-006-5; Arraystar) to quantify the selected tRFs following the manufacturer’s instructions.23 After adding forward primers and reverse primers, the reaction mixtures were incubated at 95°C for 10 min, followed by 40 cycles of 95°C for 2 s, 60°C for 20 s, and 70°C for 10 s in ViiA 7 Real-time PCR System (Applied Biosystems, Thermo Fisher Scientific). U6 small nuclear RNA was used as an internal control. The 2^−ΔΔCt and ΔΔCt methods were used to analyze tRF expression in sperm.

To predict tRF target genes, we used algorithms that combined the advantages of miRanda24 and TargetScan.25 We validated the tRF-Lys-TTT-targeted gene expression that was enriched in the mitogen-activated protein kinase (MAPK) pathways for the remaining RNA after reduced abstinence periods. RT-PCR was performed with the LightCycler 480 Real-Time PCR System using LightCycler® 480 SYBR® Green I Master Mix (Roche, Indianapolis, IN, USA). The real-time PCR conditions were 95°C for 15 s followed by 55 cycles of 95°C for 5 s, 61°C for 15 s, and 72°C for 6 s. Negative controls were performed without cDNA in the reaction mixture. The results were normalized against β-actin gene expression. The relative quantification of target genes was performed with the standard curve or comparative cycle threshold (CT) method. The primers used in qPCR are presented in Supplementary Table 1.

Supplementary Table 1.

Primers used for quantitative real-time reverse transcription polymerase chain reaction

Primer	Primer sequence	Temperature (°C)	Amplicon (bp)
U6	Forward: 5’GCTTCGGCAGCACATATACTAAAAT3’ Reverse: 5’CGCTTCACGAATTTGCGTGTCAT3’	60	89
tRF-Lys-TTT-043	Forward: 5’AGTCCGACGATCTCCCTGTTC3’ Reverse: 5’TGTGCTCTTCCGATCTTGGC3’	60	45
tRF-Met-CAT-032	Forward: 5’AGTCCGACGATCTCCTCACAC3’ Reverse: 5’GTGCTCTTCCGATCTTGGTG3’	60	45
tRF-Gln-CTG-002	Forward: 5’CGATCGGTTCCATGGTGTAAT3’ Reverse: 5’ACGTGTGCTCTTCCGATCTCA3’	60	53
SOS1	Forward: 5’GCAATGTGTGCTGACAAGGT3’ Reverse: 5’GTGGAAGGCTCTTCGTCAGT3’	57.4	92
MAP2K2	Forward: 5’TGTGAACGAGCCACCTCCTA3’ Reverse: 5’TTGTGAGCATCTTCAGGTCCG3’	57.4	119
β-Actin	Forward: 5’TTCCAGCCTTCCTTCCTGGG3’ Reverse: 5’TTGCGCTCAGGAGGAGCAAT3’	60	224

SOS1: son of sevenless homolog 1; MAP2K2: mitogen-activated protein kinase kinase 2

Statistical analyses

The semen samples collected after short versus long abstinence periods were treated as paired samples; a paired t-test was used for comparing parameters between the samples. Values are presented as mean ± standard deviation (s.d.). P < 0.05 indicated statistical significance. DE tRF analysis was performed with the R package edgeR. Fold change ≥ 1.5, P < 0.05 was used for screening DE tRFs. The Wilcoxon signed-rank test was used to evaluate the statistical differences in the expression levels of three validated tRFs and their target genes.

RESULTS

Evaluation of sperm quality parameters

In the normo-group, semen volume (Figure 2a), sperm concentration (Figure 2b), and TMC and TSC (Figure 2c) decreased significantly after 1–3 h of abstinence; nevertheless, sperm motility significantly improved (Figure 2d). In the O/A-group, semen volume (Figure 2a) significantly decreased, but sperm concentration (Figure 2b) and sperm motility (Figure 2d) were significantly higher.

Figure 2.

Analyses of semen samples collected from normozoospermia (normo-group; n=101) and oligo-astheno-spermic (O/A-group; n=53) men. The following semen parameters were compared between the two ejaculates. (a) The total volume of semen was measured and compared. (b) The sperm concentration was analyzed. (c) The total number of sperm present in the ejaculate was evaluated. (d) The number of sperm capable of progressive motility was assessed and compared. Results are expressed as mean ± s.d., with significant differences observed (^*P < 0.05). Normo-group: participants with normozoospermia; O/A-group: participants with either oligozoospermia or asthenozoospermia; Ejaculate 1: 3–7 days of abstinence; Ejaculate 2: 1–3 h of abstinence; s.d.: standard deviation.

After 1–3 h of abstinence, DFI (Figure 3a and 3b) were dramatically reduced in both groups; however, in the O/A-group, ROS levels (Figure 3c and 3d) were significantly higher, and AR levels were markedly reduced (Figure 3e and 3f) in both groups. As expected, compared with the O/A-group, DFI significantly decreased in the normo-group after 3–7 days of abstinence (Figure 3b). All sperm parameters are provided in Supplementary Table 2.

Figure 3.

Assessing biochemical parameters of sperms collected from normozoospermia and oligo-astheno-spermic men. (a) DFI. Green vs red scattergram (cytogram), showing 5000 dots. Red dots represent fragmented DNA sperm, and green ones represent native DNA sperm. SCSAsoft^® was used to obtain a much more accurate DFI. (b) Comparison of DFI parameters between Ejaculate 1 and Ejaculate 2 (mean ± s.d.). (c) ROS. Green dots represent ROS-positive sperms, showing green fluorescence; all other dots represent ROS-negative sperms. The upper left histogram was converted from the scattergram. (d) Comparison of ROS parameters between Ejaculate 1 and Ejaculate 2 (mean ± s.d.). (e) Acrosome reaction. Blue indicates sperm nucleus, and green indicates acrosome. (f) Comparison of acrosome reaction parameters between Ejaculate 1 and Ejaculate 2 (mean ± s.d.). Significant differences (^*P < 0.05) were observed for DFI, ROS, and acrosome reaction parameters between the two ejaculate conditions. Normo-group: participants with normozoospermia (n=101); O/A-group: participants with either oligozoospermia or asthenozoospermia (n=53); Ejaculate 1: 3–7 days of abstinence; Ejaculate 2: 1–3 h of abstinence; DFI: DNA fragmentation index; ROS: reactive oxygen species; s.d.: standard deviation; AI: acrosome-intact sperm; AR: acrosome-reacted sperm; FL1-H: fluorescence channel 1-height; SSC-H: side scatter-height.

Supplementary Table 2.

Physiologic and biochemical parameters of two consecutive semen in two groups

Sperm parameters	Normo-group			O/A-group
	EA 1	EA 2	P	EA 1	EA 2	P
Volume (ml), mean±s.d.	3.13±1.32	1.61±0.83	<0.001	2.91±1.48	1.62±0.96	<0.001
Concentration (ml), mean±s.d.	50.79±19.30	39.84±20.26	<0.001	12.75±15.65	17.97±14.07	<0.001
Total motility (%), mean±s.d.	49.69±8.94	58.62±12.82	<0.001	36.11±18.06	49.87±20.25	<0.001
TSC (ml), mean±s.d.	156.7±94.16	58.90±35.84	<0.001	35.01±38.43	26.35±22.22	0.09
TMC (ml), mean±s.d.	76.00±4.69	34.17±2.11	<0.001	12.40±1.55	13.01±1.35	0.42
DFI (%), mean±s.d.	10.28±5.39	7.57±4.59	<0.001	22.00±18.32	17.70±16.81	<0.001
ROS (%), mean±s.d.	24.79±10.06	23.65±8.80	0.36	21.37±7.09	28.71±9.36	<0.001
AR (%), mean±s.d.	9.59±3.24	6.36±2.62	<0.001	9.14±4.04	5.27±1.81	<0.001

Data are expressed as mean±s.d. EA 1: 3–7 days of abstinence; EA 2: 1–3 h of abstinence. EA: ejaculate; TSC: total sperm count; TMC: total motile sperm count; DFI: sperm DNA fragmentation index; ROS: reactive oxygen species; AR: acrosome reaction; s.d.: standard deviation; Normo-group: participants with normozoospermia; O/A-group: participants with either oligozoospermia or asthenozoospermia

Identification of DE tRF profiles after long and short abstinence periods

A heat map revealed systematic differences in tRF expression between the long and short abstinence periods (Figure 4a). By comparing these two groups, we identified 245 DE tRFs, of which 146 were upregulated and 99 were downregulated after 1–3 h of abstinence (Figure 4b). According to the KEGG analyses, the top 10 terms were mainly enriched in the MAPK, AMP-activated protein kinase (AMPK), and insulin pathways (all P < 0.05; Figure 4c), which are important for energy metabolism, sperm capacitation, AR, and cell proliferation and apoptosis. MAPK was the most significantly enriched signaling pathway in KEGG annotation, containing a total of 295 DE genes (Supplementary Figure 1 ^{(132.1KB, tif)} ), and it reportedly plays an important role in regulating sperm flagellar activity, hyperactivation and acrosome reaction,26 and normal spermatogenesis.27

Figure 4.

Expression tRF profiles after long and short periods of abstinence. (a) Hierarchical clustering heatmap for tRFs. The color in the panel represents relative expression levels (log₂-transformed). Blue and red represent expression levels below and above the mean value, respectively. The colored bar at the top shows the sample group, and the colored bar at the right indicates the divisions that were performed using K-means. (b) The volcano plot of tRFs. X and Y axes represent log₂-transformed fold change and −log₁₀-transformed P values between the two groups, respectively. Red and green dots indicate statistically significant differentially expressed tRFs with a fold change of ≥1.5 and P ≤ 0.05. Red: upregulated; green: downregulated. Gray circles indicate non-differentially expressed tRFs, with fold change and/or P value not meeting the cut-off thresholds. (c) Pathway bar plot of EnrichmentScore (−log₁₀[P value]). KEGG pathway analysis showed the top 10 enrichment pathways that EnrichmentScore (−log₁₀[P value]) value significantly changed after a reduction in abstinence period. Ejaculate 1: 3–7 days of abstinence; Ejaculate 2: 1–3 h of abstinence; tRNA: transfer RNA; tRF: tRNA-derived fragments; MAPK: mitogen-activated protein kinase; AMPK: adenosine 5‘-monophosphate (AMP)-activated protein kinase; KEGG: Kyoto Encyclopedia of Genes and Genomes; cAMP: cyclic adenosine monophosphate.

Validation of the DE tRFs after reduced abstinence periods

Compared with the samples obtained after 3–7 days of abstinence, those obtained after 1–3 h of abstinence showed upregulation of tRF-Lys-TTT (P < 0.05) and downregulation of tRF-Gln-CTG (P < 0.05; Figure 5a). These findings were similar to those of the tRF-seq results, which demonstrated the reliability of our tRF sequencing.

Figure 5.

Verification of three differentially expressed tRFs and 2 target mRNAs. (a) tRF-Lys-TTT, tRF-Gln-CTG, and tRF-Met-CAT were analyzed by qRT-PCR. Bar graphs show mean ± standard deviation. (b) The most significant biological process GO terms for the 260 target genes of tRF-Lys-TTT. (c) SOS1 and MAP2K2 were analyzed by qRT-PCR. Bar graphs show mean ± standard deviation. (d) 3’-UTR fragment of MAP2K2 was found to interact with tRF-Lys-TTT, which disrupted MAP2K2 expression. Statistical differences in the five paired specimens were analyzed by the Wilcoxon signed-rank test (^*P < 0.05). Ejaculate 1: 3–7 days of abstinence; Ejaculate 2: 1–3 h of abstinence; SOS1: son of sevenless homolog 1; MAP2K2: mitogen-activated protein kinase kinase 2; qRT-PCR: quantitative real-time reverse transcription polymerase chain reaction; UTR: untranslated region; tRNA: transfer RNA; tRF: tRNA-derived fragments; AU: Adenine-Uracil.

tRF-Lys-TTT directly downregulates MAP2K2 in the MAPK signaling pathway after 1–3 h of abstinence

We screened a total of 260 genes whose sequences perfectly matched tRF-Lys-TTT. Gene Ontology (GO) analysis showed that the target genes of tRF-Lys-TTT are highly involved in cellular process and metabolic process (Figure 5b). Two candidate genes (MAP2K2 and son of sevenless homolog 1 [SOS1]) targeted by tRF-Lys-TTT were significantly enriched in the MAPK pathway. qRT-PCR revealed that MAP2K2 mRNA levels (P < 0.05) were downregulated after 1–3 h of abstinence (Figure 5c).

To explore how tRF-Lys-TTT could potentially affect MAP2K2 expression, we analyzed the 3’-untranslated region (UTR) sequence of MAP2K2 using TargetScan (http://www.targetscan.org/, last accessed on May 22, 2022) and microRNA.org (http://www.microrna.org/microrna/, last accessed on May 22, 2022) to reveal a possible binding site for tRF-Lys-TTT (Figure 5d). The findings indicated that the gene transcripts might be a direct target for tRF-Lys-TTT.

DISCUSSION

This study provides comprehensive information pertaining to the physiological and biochemical parameters of sperm collected from normozoospermic, asthenozoospermic, and oligozoospermic men after 3–7 days and 1–3 h of abstinence. We observed that sperm motility was significantly improved after 1–3 h of abstinence compared with that after 3–7 days of abstinence.

During longer periods of abstinence, spermatozoa are stored mainly in the ampulla and vas deferens, and partly in the cauda epididymis;28 the successive ejaculated semen sample is derived from the more proximal part (near the tail) of the epididymal body, which is characterized by highly motile sperm.29,30 The results of some other studies6,8 are consistent with our data, as they reported higher spermatozoa motility after 2 h of abstinence. To fuse with an oocyte, sperm must be highly motile; thus, sperm motility is the key predictive physiological marker for both natural and assisted pregnancy outcomes.31 These findings indicate that shorter ejaculatory abstinence may be a simpler and more effective way to improve fertilization and pregnancy rates for natural and assisted pregnancy.

A higher proportion of motile sperm was observed after a shorter abstinence period, and sperm DFI was negatively correlated with sperm motility.32 This indicates that DFI can be efficiently reduced by short-term abstinence.7,33 Furthermore, when comparing only motile sperm separated by swim-up, an improvement in sperm DFI was also observed after shorter abstinence periods.5 The cauda/vas deferens microenvironment has a high level of ROS that may impair sperm function owing to the absence of DNA repair ability in sperm. Therefore, DNA damage likely accumulates under increasing lengths of exposure of spermatozoa to ROS in the epididymis.34 Therefore, reducing the storage time of sperm in the epididymis should help prevent DNA damage, which should increase male fertility and result in better reproductive outcomes in natural conception.35,36,37

As an independent measure of sperm quality, DFI is a better diagnostic and prognostic parameter for male fertility potential compared with other sperm parameters, and it is crucial for ensuring the precise transfer of genetic information and promoting the health of future generations. Thus, DFI may be valuable when using sperm with intact DNA obtained after 1–3 h of abstinence and may serve as a potential therapeutic measure for infertile men. Furthermore, by obtaining a semen sample soon after a shorter period of abstinence, clinicians could avoid epididymal oxidative damage and testicular sperm aspiration and retrieve ejaculates comprising spermatozoa with lower DFI.

We did not anticipate some of our results pertaining to asthenozoospermia and oligozoospermia, such as sperm concentration and ROS levels. The sperm reservoir capacity is poorly developed in humans.33 Lower sperm concentration and TSC in samples obtained after only 2 h of abstinence were consistent with our findings in normozoospermic men;6 however, in oligozoospermic men, sequential ejaculation may overcome impaired sperm transport, resulting in an increase in motile sperm34 and higher sperm concentration in the second consecutive ejaculate.

Our data indicated that sequential ejaculates after 3–7 days and 1–3 h of abstinence should be pooled for artificial reproduction techniques, which may lead to a change in the treatment strategies for asthenozoospermic and oligozoospermic males, such as replacing intracytoplasmic sperm injection with in vitro fertilization. Furthermore, a previous study reported that semen samples collected after a brief period of abstinence (30–60 min) from oligoasthenozoospermic men resulted in higher in vitro fertilization rates.35 Considering the lack of a consensus on the optimal period of abstinence in infertile men, particularly in the case of artificial reproduction techniques, our findings indicate that a shorter period of abstinence (1–3 h) is pragmatic.

Long periods of abstinence can reportedly cause sperm senescence in infertile patients.36 The functional activity of enzymes involved in ROS production seems to deteriorate by the later stages of apoptosis;37,38 finally, ROS leaks out of nonviable sperm. A positive correlation has been reported between ROS and sperm viability and motility.39 It is therefore not surprising that ROS levels in sperm paradoxically increased after a shorter period of abstinence in asthenozoospermic and oligozoospermic men. In humans, spermatozoa appear to use ROS for diverse physiological functions, such as hyperactivation, AR, capacitation, and spermatozoa–oocyte fusion. Consequently, further research is needed before antioxidant therapy can be used, particularly for men with low ROS levels.

Protein phosphorylation, transcription, and translation steps have been observed in human sperm40 that align with changes in sperm protein profiles after reduced abstinence periods.8 Our findings showed altered tRF profiles after 1–3 h of abstinence, which may be linked to improved sperm functions, such as improved sperm motility. The functions of DE tRFs were enriched in the MAPK and insulin pathways. The insulin pathway can provide more glycolysis to promote sperm motility, catering to the high and rapid energy requirements of sperm,41 whereas the MAPK pathway reportedly plays an important role in regulating sperm function,26 cell growth, and apoptosis.42 Moreover, MAPK signaling has a substantial role in regulating sperm motility,43 and alterations in sperm cell signaling may also affect sperm motility. Consistent with the findings of our study, it was reported that tRFs play biological roles throughout the MAPK pathway.44

An increasing number of studies have shown significant associations between tRF expression and sperm quality.12,45,46,47 It was reported that tRFs have significant associations with sperm DNA fragmentation levels,12 and tRFs can attenuate DNA damage to protect cells from apoptosis;48,49 those findings indicate that tRFs could be involved in the fine-tuning of cellular processes. These insights support our hypothesis that changes in tRF profiles could affect sperm functions, such as motility and DNA integrity. Therefore, tRFs have emerged as a promising area of study, with recent research suggesting that tsRNAs hold significant potential as biomarkers for sperm quality and fertility.21,47,50 Our results indicate a relationship between tRF profiles and sperm motility. Exploring the causal relationship between tRFs and sperm motility in future studies could provide valuable insights.

Our study further revealed that tRF-Lys-TTT targets MAP2K2, leading to a decrease in the MAPK pathway. It was reported that sperm mRNAs exhibit regulatory effects on sperm motility, and differential expression of mRNA between high- and low-motility sperm from the same semen sample was observed.51,52 Therefore, alteration in tRF-targeted mRNA potentially explains the observed enhancement in sperm motility.

Additionally, our screening of tRF-Lys-TTT-targeted genes revealed significant enrichment in cellular and metabolic processes, underscoring the critical role of these transcripts in metabolic processes in producing energy to power flagellar movement. After a reduced period of male abstinence, a single tRF can have hundreds of target mRNAs, and an mRNA target can bind to one or different tRFs. Consequently, after reduced abstinence periods, tRFs constitute a powerful regulatory network that controls several targets and physiological processes. Ultimately, this manifests as changes in sperm functions.

In conclusion, our study provides empirical evidence that shorter periods of abstinence may significantly enhance sperm motility and DNA integrity. This suggests a pragmatic yet impactful strategy for selecting superior quality semen. Through analysis of DE tRFs in human sperm following decreased ejaculate intervals, we postulate a regulatory role of tRF/mRNA interactions in sperm function. Nonetheless, the precise mechanisms by which tRF/mRNA alterations contribute to better sperm quality during reduced abstinence intervals remain unclear.

Our research necessitates further investigations to confirm these preliminary findings and to comprehensively elucidate how these tRFs and their target RNAs directly influence sperm biological functionality. Although our current understanding of the intricate relationship between tRFs and sperm quality is still developing, our results provide a valuable framework for future investigations. However, a limitation of this study is the insufficient sample size used for tRF sequencing; this constrains the generalizability of our findings. Consequently, this study underscores the need for advanced molecular tools and methodologies to clarify the complex regulatory networks and potentially pave the way for novel therapeutic approaches in reproductive medicine and fertility enhancement.

AUTHOR CONTRIBUTIONS

WBZ had full access to all the data in the study and took responsibility for the integrity of the data and the accuracy of the data analysis. WBZ and CH conceived the study and designed the research. XRJ, RJW, and HLW acquired the data. XRJ, RJW, HB, XHH, and ZHH conducted data analysis and interpretation. CH and XRJ drafted the manuscript. All authors critically revised the manuscript for important intellectual content. ZHH and GL conducted the statistical analysis. All authors read and approved the final manuscript.

COMPETING INTERESTS

All authors declare no competing interest.

Supplementary Figure 1

MAPK pathway map, differently expressed genes are highlighted in orange in the KEGG annotation generated using DAVID software.