Abstract
Background
Perimenopausal depression (PMD), a psychiatric disorder triggered by declining ovarian function before menopause, remains poorly understood in terms of therapeutic mechanisms. While acupuncture has demonstrated efficacy in alleviating PMD symptoms, its molecular basis requires further exploration. This study aimed to investigate whether acupuncture ameliorates PMD by modulating phosphatidylinositol 3-kinase (PI3K)/serine-threonine protein kinase (AKT)/mammalian target of rapamycin (mTOR) signaling in a rat model.
Methods
The female SD rats were randomly assigned to four groups: model, blank, acupuncture, and Western medicine, with each group consisting of six rats. The acupuncture group received acupuncture at the Baihui (GU20), Shenshu (BL23), Ganshu (BL18), and Sanyinjiao points for 28 consecutive sessions over 4 weeks. A PMD rat model was established through ovariectomy (OVX) combined with chronic unpredictable mild stress. Depression-related behaviors were measured through the forced swimming test, sucrose preference test, and open field test. The levels of estrogen (E2), luteinizing hormone (LH), follicle-stimulating hormone (FSH), and gonadotropin-releasing hormone (GnRH) in serum were determined through ELISA. The expression of PI3K, AKT, and mTOR in the hippocampal Cornu Ammonis 1 (CA1) region was analyzed by reverse transcription quantitative PCR and Western blotting.
Results
Acupuncture markedly attenuated depression-like behaviors and hippocampal pathology in PMD rats. It restored hormonal balance by elevating serum E2 while suppressing FSH, LH, and GnRH. At the molecular scale, acupuncture enhanced the expression of both mRNA and proteins of PI3K, AKT, and mTOR in the hippocampus CA1 region.
Conclusion
Acupuncture alleviates PMD through dual regulation of sex hormone homeostasis and activation of the PI3K/AKT/mTOR pathway, suggesting a potential mechanism for its antidepressant effects in perimenopause.
Keywords: acupuncture, behavioral studies, perimenopausal depression, PI3K/Akt/mTOR signaling, sex hormone levels
Introduction
Perimenopausal depression (PMD) refers to an emotional disorder that occurs during a decline in female reproductive function and is characterized by depression, irritability, anxiety, slow thinking, cognitive decline, and physical discomfort as its primary clinical manifestations [1]. It usually occurs in women around 45–54 years of age, both before and after menopause [2]. Severe depressive episodes and the onset of depressive symptoms can occur during the perimenopausal stage [3]. Epidemiological data highlight its growing burden: China currently harbors the largest perimenopausal population globally, projected to exceed 210 million by 2030 (accounting for −15% of the total population) [4,5]. Regional studies further reveal a PMD incidence of 25.99% in Shanghai communities [6], aligning with global trends indicating over 75% of postreproductive-aged women experience severe menopausal symptoms [7]. These statistics underscore PMD as a critical public health challenge demanding effective interventions [8].
The 2018 recommendations suggest using selective serotonin and norepinephrine reuptake inhibitors as the first-line therapy for PMD [9]. The administration of hypnotic and antianxiety drugs has been shown to have significant negative consequences, such as dizziness, shaking, tiredness, cognitive decline, sexual dysfunction, and difficulty urinating. As a result, patients have shown decreased adherence to these prescriptions [10,11]. For most individuals with menopausal depression, it is recommended to use antidepressants together with menopausal hormone treatment (MHT) [12]. Nevertheless, a full recovery is not achieved by 70% of patients, and initial pharmacological therapy does not elicit a response in 30% of cases [13]. Menopause hormone replacement therapy may increase the risk of breast cancer [14,15], skin cancer [16], and stroke and venous thrombosis in postmenopausal women [17]. Therefore, it is urgent to develop new effective and less dangerous alternatives to achieve therapeutic and preventive effects.
Acupuncture, a traditional Chinese medicine modality, has gained recognition for its antidepressant efficacy in PMD with minimal side effects [18–20]. Clinical and preclinical studies [21,22], including our team’s work on acupoint catgut implantation [23,24], validate its potential as a complementary therapy. However, the molecular mechanisms underlying its benefits remain elusive. Most scholars currently believe that hypothalamic-pituitary-adrenal axis dysregulation-dependent damage to hippocampal neurons is the main driving force of PMD [25]. Some studies have shown that inhibiting excessive autophagy in hippocampal neurons can reduce cell apoptosis or necrosis and alleviate neuronal damage. Improving the synaptic function of the hippocampus can also play a neuroprotective role [26,27]. Several studies have demonstrated that acupuncture can stimulate the proliferation of the hippocampal nerve in perimenopausal depressed rodents by stimulating the pathway controlled by Wnt/β-catenin [28]. Crucially, the phosphatidylinositol 3-kinase (PI3K)/serine-threonine protein kinase (AKT)/mammalian target of rapamycin (mTOR) pathway-a central regulator of autophagy [29,30], cell survival, and estrogen (E2) signaling [31–34] may bridge these mechanisms. This pathway not only governs ovarian granulosa cell dynamics [35] but also modulates hippocampal neuronal plasticity, suggesting its dual role in hormonal balance and neuroprotection [36].
Building on this rationale, we hypothesized that acupuncture alleviates PMD by activating PI3K/AKT/mTOR signaling to mitigate hippocampal neuronal damage. Using a validated rat model of PMD, this study investigates the pathway’s role in mediating acupuncture’s therapeutic effects, aiming to provide mechanistic insights for clinical translation.
Materials and methods
Animals and reagents
Female Sprague–Dawley rats (n = 40, age 3 months, body weight 200–220g) were purchased from Shanghai Jihui Experimental Animal Breeding Co., Ltd. [SCXK(Shanghai)2022-0012, China]. The animals were confined to typical laboratory environments and provided food and water ad libitum. The conditions were a 12-h light/dark cycle, 15–20 air changes per hour, and a relative humidity of 40–70%. The temperature ranged from 20 to 26 °C. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Zhejiang Chinese Medical University [Ethics Approval No.: SYXK(Zhe)2022-0003] and complied with the National Standards of the People’s Republic of China for Laboratory Animal Welfare (GB/T 35892-2018) and Animal Research: Reporting of In Vivo Experiments guidelines.
Estradiol valerate tablets (Prognova) were produced by Biologicals B.V. (Netherlands). Clomipramine hydrochloride tablets (Jiangsu Enhua Pharmaceutical Co., Ltd., China). Disposable sterile needles (Suzhou Medical Products Factory Co., Ltd., China). Kits for rat E2, follicle-stimulating hormone (FSH), luteinizing hormone (LH), and gonadotropin-releasing hormone (GnRH) ELISA were acquired from Jiangsu Enzyme Exemption Industry Co., Ltd. Antibodies against PI3K, mTOR, and the p-Akt protein were acquired from Cell Signaling Technology, located in Beverly, California, USA.
Grouping and interventions
The PMD model rats were separated into four groups: the model group, blank group, acupuncture group, and Western medicine group, with each group including six rats.
Figure 1 provides a diagram of the experimental setup and a brief summary of the methods used for the treatment groups. The participants in the acupuncture group got acupuncture therapy daily. The acupuncture points used were Baihui (GV20), Shenshu (BL23), Ganshu (BL18), and Sanyinjiao (SP6), selected according to the Experimental Acupuncture Atlas (Chinese Acupuncture Society, 2nd edition). We took measures to guarantee that the animals were aware and had few restrictions throughout the acupuncture session. Rats were minimally restrained using soft cloth sleeves on a heated platform (37 °C) to maintain physiological stability; sterile disposable needles (0.25 × 25 mm) were inserted vertically at 5 mm depth on GV20 and 3 mm depth on BL23/BL18/SP6. Manual stimulation was applied with bidirectional rotation (180°, 60 rpm) for 10 s/needle, repeated every 10 min during 20-min daily sessions for 28 days. Estradiol valerate (0.1 mg/kg) and clomipramine (20 mg/kg) were suspended in 0.9% saline (2 ml/kg) and administered via oral gavage daily for 28 days in the Western medicine group.
Fig. 1.
Protocols for experiments. Selecting OVX combined with CUMS to establish a perimenopausal depression rat model. Behavioral tests were used to investigate the effect of acupuncture on depression from day 33 to day 61 after Molding. After surgery, HE and Nissl staining were used to observe the effect of acupuncture on neuronal damage, and ELISA and Western Blot were used to detect the expression of related hippocampal autophagy-related factors. CUMS, chronic unpredictable mild stress; HE, hematoxylin and eosin; OVX, ovariectomy.
Each animal underwent the open field test (OFT), sucrose preference test (SPT), and forced swimming test (FST). After modeling and treatment, behavioral tests were carried out. The animals were then made unconscious with a 10% chloral hydrate solution (0.3 ml/100g, i.p.) following drug administration. Blood samples were subsequently collected from the abdominal aorta using tubes that lacked heparin. These samples were used to isolate serum and assess E2, LH, FSH, and GnRH levels. Rat brain tissue was dissected to isolate the hippocampus tissue. Hematoxylin and eosin (HE) staining was conducted, and subsequent examination of the hippocampal neuronal cells using a microscope to identify any morphological alterations. The hippocampal expression levels of P13K, Akt, and mTOR in rats were assessed using western blotting techniques and reverse transcription quantitative PCR (RT-qPCR).
Surgery and chronic unpredictable mild stress
The PMD model was established through OVX combined with chronic unpredictable mild stress (CUMS) as previously validated [37]. After weighing the rats, a solution of chloral hydrate with a concentration of 10% was injected into the peritoneum of each rat. A volume of 0.3 ml/100g of TA was administered. The rats were put under anesthesia and positioned prone. Following dorsal fur removal, the exposed epidermal surface underwent sequential antisepsis with a povidone-iodine solution followed by ethanol swabbing. A 1–2 cm incision was made lengthwise down the center of the back, starting at the lumbar spine. The skin and dorsal muscle were incised, the peritoneum was dissected, and the lower portion of the two ovarian tubules (along with some adipose tissue) was ligated. The surgical procedure involved the removal of both ovaries. The tissue was meticulously relocated inside the abdominal cavity, followed by suturing the muscle layer and skin layer [38].
The rats were put in a warm environment and cautiously provided with food after the procedure. After 1 week of postoperative rest, vaginal exfoliated cell smears were collected from all rats for five consecutive days. After successful modeling, all rats received 21 days of CUMS stimulation. Stimulation included a heated environment (45 °C, 5 min), food and water deprivation (24 h), cold water swimming (4 °C, 5 min), tail clipping (clipping the rat tail tip 1 cm away with hemostatic forceps for 1 min), moist padding and tilting the cage (24 h), and overnight illumination (24 h).
Behavioral assessments
The OFT, SPT, and FST are the three behavioral tests performed after modeling and intervention.
Open field test
The experimental subjects were placed in a rectangular wooden chamber measuring 80 cm×80 cm×40 cm (L × W × H). The apparatus featured 25 equally sized grid divisions with matte black paint applied to all interior surfaces to minimize light reflection. Each subject was centered in the central quadrant of the chamber floor, while behavioral parameters were recorded via a ceiling-mounted video recording system throughout the 6-min experimental session. Upon conclusion of testing, all contact surfaces underwent rigorous sanitization with 70% ethanol to eliminate potential olfactory cues that might confound subsequent experimental trials.
Sucrose preference test
Sucrose solution consumption and preference index were quantifiable metrics for assessing reward sensitivity deficits and anhedonia-like behaviors. Subjects were individually housed in standard laboratory conditions. During the 24-h acclimation phase, two identical 1% sucrose solution reservoirs (100 ml each) were symmetrically positioned in the home enclosure to eliminate positional preference bias. Following acclimation, a 24-h water deprivation protocol was implemented to standardize hydration status before testing. The experimental apparatus consisted of paired drinking vessels containing 100 ml of 1% sucrose solution (w/v) and 100 ml of purified water (Milli-Q grade) positioned at standardized coordinates within the enclosure. After a 24-h test interval, gravimetric measurements of both reservoirs were conducted using analytical balance instrumentation (±0.01g sensitivity). Total fluid intake was calculated as the sum of sucrose solution and water consumption, with the sucrose preference percentage derived from (sucrose intake/total fluid intake) × 100%.
Forced swimming test
Subjects underwent forced swim testing in a cylindrical glass apparatus (inner diameter: 20 cm; height: 40 cm) filled to 20 cm depth with temperature-controlled water (25 ± 1 °C). Following a 2-min habituation phase, ethologically relevant behaviors (immobility duration, active swimming) were video-recorded for 4 min through a lateral observation window. Intertrial protocols required complete water replacement and apparatus sterilization with 70% ethanol to eliminate pheromonal interference between subjects. All trials were conducted under standardized ambient conditions (22–24 °C, 60% humidity) with overhead lighting maintained at 300 lux.
ELISA
Intragroup hemodynamic sampling (5 ml volume) was performed on anesthetized subjects using transperitoneal aortic access, with strict adherence to aseptic technique. Following a 30-min clotting period at room temperature, whole blood samples were centrifuged at 4 °C (1200 × g for 10 min) to obtain serum. Serum concentrations of 17β-E2, LH, FSH, and GnRH were quantified using commercially available ELISA kits (Jiangsu Enzyme Immunoassay Industrial Co., Ltd., China) according to the manufacturer’s standardized protocols.
Western blot analysis
Western blotting was used to analyze the expression levels of phosphatidylinositol 3-kinase (PI3K), protein kinase B (Akt), and phosphorylated Akt (p-Akt) in the hippocampus Cornu Ammonis 1 (CA1) region. Total protein was extracted from hippocampal tissues using a commercial protein lysis buffer (RIPA, P0013D, Beyotime, Shanghai, China). Protein aliquots normalized by Bicinchoninic Acid Assay quantification underwent electrophoretic resolution in 10% SDS-polyacrylamide gels (Tris-glycine system), followed by semi-dry transfer onto 0.45 μm polyvinylidene fluoride membranes under constant current (300 mA, 90 min). Posttransfer membranes were subjected to 2-h blocking in tris buffered saline with tween 20 (MassachusettsMassachusettsTBST)-based blocking buffer (5% w/v skim milk powder) with orbital shaking (50 rpm) at 25 °C.
Following blocking, membranes were incubated overnight at 4 °C with specific primary antibodies: anti-p-Akt (1:2000, 4060T, CST, Danvers, Massachusetts, USA), anti-PI3K (1:1000, 4257T, CST, Danvers, Massachusetts, USA), and anti-mTOR (1:1000, 2983T, CST, Danvers, Massachusetts, USA) as loading control. After three 10-min TBST washes, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000 dilution) for 1 h at room temperature. Postincubation washes were performed as described above. Enhanced chemiluminescence-based immunodetection was achieved through time-optimized exposure protocols (30 s–3 min dynamic range) using SuperSignal West Pico substrate. Digital image capture was executed on a Bio-Rad ChemiDoc MP Imaging System, followed by densitometric analysis via ImageLab 6.0 workstation. Relative protein quantification was calculated against β-actin housekeeping protein controls.
Histopathological examination and immunofluorescence
The rat hippocampal CA1 tissue was fixed for a full day in 10% formalin and 4% paraformaldehyde before being rinsed with physiological saline. Once they were transparent and dehydrated using ethanol and xylene, specimens were immersed in paraffin and sliced into four-micrometer-thick slices. HE staining was employed to observe pathological changes in the rodents after the sections were dewaxed. Rat neuronal alterations were observed using Nissl staining. The slides were secured using a neutral adhesive and scrutinized under a microscope to acquire and manipulate images.
Quantitative real-time PCR
Before molecular analysis, hippocampal CA1 tissues were fixed in paraffin and sectioned at 4 μm thickness for histological preservation. Total RNA was extracted using TRIzol reagent, with concentration and purity assessed spectrophotometrically (A260/A280 ratio >1.8). Subsequently, 2 μg of total RNA underwent reverse transcription using M-MLV reverse transcriptase (Promega, Beijing, China) to generate cDNA templates. Primer sequences for PI3K, Akt, mTOR, and β-actin (internal control) were designed using Primer Premier 5.0 software (PREMIER Biosoft, Palo Alto, California, USA) and validated through National Center for Biotechnology Information Basic Local Alignment Search Tool analysis to ensure target specificity. With high-performance liquid chromatography (HPLC) purification, all oligonucleotides (Table 1) were commercially synthesized by Kangwei Century Biotechnology (Beijing, China). Quantitative PCR amplification was performed on a QuantStudio 5 system (Applied Biosystems, Waltham, Massachusetts, USA) under standardized conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Each reaction contained 1× SYBR Green Master Mix (Roche) and 10 pmol of each primer. Target gene expression levels were normalized to β-actin using the comparative threshold cycle (2−ΔΔCt) method.
Table 1.
Primer sequences
| Gene | Forwards primer | Reverse primer |
|---|---|---|
| Rat PI3K | AGTGGTGCAGACCCTAGACT | TTGAGGGGCGTTTCACCTAC |
| Rat AKT | ACATGGCCCCCGGTTAAAAA | AGTTGTTGAGTGGGGACTCG |
| Rat mTOR | TCTGCACTTGTTGTTGCCTC | ACAATCGGGTGAATGATGCG |
| Rat GAPDH | AAGGTCGGTGTGAACGGATTT | CTTTGTCACAAGAGAAGGCAGC |
Data analysis
The data were statistically analyzed using SPSS 21.0 software. For each experiment, P-values were calculated using the statistical methods specified in the corresponding figure legend, with P < 0.05 considered significant. The graphs were created using the GraphPad Prism software.
Results
Effects of acupuncture on the behavior of perimenopausal depression model rats
The OFT, FST, and SPT were performed to assess depression-like behaviors in rodents that were exposed to chronic, unpredictable moderate stress. The OFT is frequently implemented to evaluate rodents’ anxiety levels and exploratory behavior in a novel environment. We utilized the OFT, a widely recognized model, to quantify both locomotion and depression-like behavior in rodents to evaluate acupuncture’s impact. According to Fig. 2, the rodents in the model, acupuncture, and Western medicine groups exhibited significantly lower vertical and horizontal movement scores than those in the normal control group (P < 0.01). The vertical and horizontal mobility scores of rodents in the acupuncture and Western medicine groups were significantly greater than those in the model group posttreatment (P < 0.01 or P < 0.05). Compared to the acupuncture group, the rodents in the Western medicine group exhibited higher vertical and horizontal mobility scores(P < 0.01 or P < 0.05).
Fig. 2.
After modeling, the vertical and horizontal movement scores decreased in the model, acupuncture, and Western medicine groups (a), and acupuncture for 28 days increased the vertical and horizontal movement scores of the rats (b) in the open field test. The values are expressed as the means ± SD, n = 6. ∆∆P < 0.01 vs. normal control; ★★P < 0.01 vs. model; ##P < 0.01 vs. Western medicine. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. ANOVA, analysis of variance.
The FST is a frequently employed experimental technique for evaluating depressive behavior by inducing stress and observing the decrease in escape responses. As illustrated in Fig. 3, the immobility periods of the rodents in the model group, acupuncture group, and Western medicine group were significantly longer than those of the rats in the normal control group following the modeling process (P < 0.01). The immobility periods of rodents in the acupuncture and Western medicine groups were significantly diminished compared to those of rats in the model group following treatment. The Western medicine group experienced a significantly shortened duration of immobility than the acupuncture group(P < 0.01).
Fig. 3.
After model establishment, immobility time increased in the model, acupuncture, and Western medicine groups (a), and acupuncture for 28 days decreased immobility time (b) in the forced swimming test in rats with perimenopausal depression. The values are expressed as the means ± SD, n = 6. ∆∆ P < 0.01 vs. the normal control group. ★★P < 0.01 vs. model; ##P < 0.01 vs. Western medicine. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. ANOVA, analysis of variance.
The SPT is widely regarded as the most dependable method for evaluating the degree of delight reduction in rodents. Figure 4 shows that the outcomes of the modeling process differed significantly from the standard control group. The levels of purified water consumption in the model, acupuncture, and Western medicine groups were not significantly different (P > 0.05). However, the sugar water consumption, total liquid consumption, and sugar water preference rate were significantly lower (P < 0.01). As illustrated in Fig. 5, the acupuncture and Western medicine groups did not exhibit a significant difference in pure water consumption following treatment (P > 0.05). However, the acupuncture and Western medicine groups exhibited significantly higher sugar water consumption, total liquid consumption, and sugar water preference rates (P < 0.01). The Western medicine group showed significant statistical differences in sugar water intake, overall liquid intake, and preference for sugar water (P < 0.05) when compared to the acupuncture group. However, there was no statistically significant difference in purified water consumption (P > 0.05).
Fig. 4.
After modeling, the model, acupuncture, and Western medicine groups exhibited decreased sugar water consumption (a), pure water consumption (b), total liquid consumption (c), and sugar water preference (d) in the sucrose preference test. There was no difference in pure water consumption among the groups. The values are expressed as the means ± SD, n = 6. ∆∆ P < 0.01 vs. normal control. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. ANOVA, analysis of variance.
Fig. 5.
After treatment, acupuncture for 28 days increased sugar water consumption (a), pure water consumption (b), total liquid consumption (c), and sugar water preference (d) in the sucrose preference test in perimenopausal depressed rats. There was no difference in pure water consumption among the groups. The values are expressed as the means ± SD, n = 6. ∆∆ P < 0.01 vs. normal control; ★★P < 0.01 vs. model, ##P < 0.05 vs. Western medicine. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. ANOVA, analysis of variance.
The model group exhibited a substantially shorter horizontal movement distance, fewer vertical movements, a lower sugar water consumption and preference rate, and prolonged forced swimming immobility compared to the normal control group (P < 0.01). Regarding forced swimming immobility duration, horizontal movement distance, vertical activities, sugar water and total liquid consumption, and sugar water preference rate, the acupuncture group outperformed the model group (P < 0.01). Nevertheless, the group exhibited marginally fewer improvements in horizontal activity and sucrose preference rate. In comparison to the Western medicine group, the acupuncture group exhibited marginally reduced improvements in sucrose preference rate, horizontal activity distance, and forced swimming immobility time (P < 0.05 or P < 0.01). In conclusion, acupuncture significantly improved depression-like behaviors in PMD model rats, as evidenced by increased vertical and horizontal movement scores in the OFT, decreased immobility time in the FST, and increased sucrose preference in the SPT.
Hematoxylin and eosin staining observation of pathological changes in rat hippocampal CA1 tissue
Figure 6 illustrates that the hippocampal CA1 tissue structure of the control group was mostly normal, featuring a high neuron density in the hippocampus and intact cell shapes. The model group had fewer cells and greater neural cell aggregation than the normal control group, whereas the groups receiving acupuncture and Western medicine also had fewer cells. In contrast to the model group, there was less cell aggregation overall. Therefore, the pathological changes in the brain tissue of PMD model rats were alleviated by acupuncture, which reduced the cell aggregation compared to the model group.
Fig. 6.
HE staining revealed the structure of the CA1 region in rat hippocampal tissue. The normal group showed high neuronal density and intact cell morphology in the hippocampus. The model group showed a decrease in cell count and an increase in cell aggregation, indicating damage. In the acupuncture and medicine groups, the number of cells recovered, cell aggregation decreased, and organizational structure improved. Scale bars: 100 μm (upper panels) and 50 μm (lower panels). The arrow indicates the area of nerve damage. CA1, Cornu Ammonis 1; HE, hematoxylin and eosin.
Observation of pathological changes in the rat hippocampal CA1 region using Nissl staining
Figure 7 illustrates that the neurons in the hippocampal CA1 region of the normal group rodents were stained light blue and exhibited a complete cell structure. In contrast, certain neurons in the hippocampal CA1 region of the model group rodents were pyknotic and densely stained, while others were vacuolar in shape. The cellular structures in the hippocampal CA1 region of both the acupuncture and Western medicine groups were more intact compared to the model group, with only a few neurons showing pyknotic deep staining or vacuolar morphology. Thus, ameliorated the pathological changes in the hippocampal CA1 region of PMD model rats, rendering the cellular structures more intact and reducing the number of neurons with abnormal morphology.
Fig. 7.
Nissl staining shows the cellular structure of CA1 neurons in rat hippocampal tissue. Normal group neurons were stained light blue with intact cell structure. Some neurons in the model group have deeply stained cell bodies, showing a condensed shape, while others have vacuolated cell bodies, indicating damage. The cell body structure of neurons in the acupuncture and moxibustion and drug treatment groups was more complete than that in the model group, with fewer deeply stained or vacuolated neurons. Scale bars: 100 μm (upper panels) and 50 μm (lower panels). Arrows indicate areas of nerve damage. CA1, Cornu Ammonis 1.
Effect of acupuncture on serum biochemical indices in perimenopausal depression model rats
The serum E2 concentration in the model group was significantly lower (P < 0.01) than that of the normal group, as illustrated in Fig. 8. Furthermore, the model group exhibited substantially increased concentrations of LH, FSH, and GnRH (P < 0.01). The acupuncture and Western medicine groups showed a significant increase in blood E2 levels compared to the model group (P < 0.01). Furthermore, both groups demonstrated a substantial decrease in LH, FSH, and GnRH levels (P < 0.01). Compared to the Western medicine group, the serum E2 level in the acupuncture group was significantly lower (P < 0.01). Furthermore, the acupuncture group substantially increased LH, FSH, and GnRH levels (P < 0.01). In summary, acupuncture can regulate the serum biochemical indices in PMD model rats, increasing the E2 level and decreasing the levels of LH, FSH, and GnRH. However, the regulatory effect of acupuncture on E2 levels is weaker than that of Western medicine.
Fig. 8.
Treatment with acupuncture for 28 days increased estradiol (E2) levels (a). However, acupuncture reduced the levels of LH (b), FSH (c), and GnRH (d) in rats with perimenopausal depression. The values are expressed as the means ± SD, n = 6. ∆∆ P < 0.01 vs. normal control, ★★P < 0.01 vs. model, ##P < 0.05 vs. Western medicine. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. ANOVA, analysis of variance; FSH, follicle-stimulating hormone; GnRH, gonadotropin-releasing hormone; LH, luteinizing hormone.
Expression of phosphatidylinositol 3-kinase/serine-threonine protein kinase/mammalian target of rapamycin mRNA in the rat hippocampal CA1 region
Figure 9 illustrates that the rodents in the model group exhibited significantly reduced expression levels of P13K, Akt, and mTOR mRNA in the hippocampal CA1 region (P < 0.01) than those in the normal group. The levels of mRNA expression for P13K, Akt, and mTOR in the hippocampal CA1 region were significantly increased in the acupuncture and Western medicine groups relative to the model group (P < 0.05 or P < 0.01). In comparison to the Western medicine group, the acupuncture group demonstrated decreased expression levels of Akt and P13K (P < 0.05). Nevertheless, the two groups had no statistically significant difference in mTOR expression. Overall, acupuncture can upregulate the expression of P13K, Akt, and mTOR mRNA in the hippocampal CA1 region of PMD model rats. However, its effect on the expression of Akt and P13K is slightly weaker than that of Western medicine.
Fig. 9.
Icariin administration for 30 days increased the mRNA expression levels of P13K (a), Akt (b), and mTOR (c) in rats with perimenopausal depression. The values are expressed as the mean ± SD, n = 6. ∆∆ P < 0.01 vs. normal control, ★★P < 0.01 and ★P < 0.05 vs. model, #P < 0.05 vs. Western medicine. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. Akt, serine-threonine protein kinase; ANOVA, analysis of variance; mTOR, mammalian target of rapamycin; P13K, phosphatidylinositol 3-kinase.
Effect of acupuncture on the phosphatidylinositol 3-kinase/serine-threonine protein kinase pathway in the hippocampal CA1 region of perimenopausal depression model rats
Western blotting and RT-qPCR techniques were utilized to explore the possible mechanism of acupuncture in the PMD model rats by evaluating the expression of PI3K, Akt, and mTOR in the hippocampal CA1 region. In the hippocampal CA1 region, PI3K, Akt, and mTOR expression is lower in the model, acupuncture, and Western medicine groups than in the control group (P < 0.01). Figure 10 illustrate this. In the acupuncture and Western medicine groups, P13K, Akt, and mTOR expression levels in the animals’ hippocampus CA1 region were considerably higher (P < 0.05 or P < 0.01%). The outcomes of the Western blot and immunohistochemistry matched. These results imply that acupuncture or Western medicine significantly corrected the caused decreases in PI3K, Akt, and mTOR levels in PMD model rats. From the results obtained, acupuncture can significantly correct the decreases in PI3K, Akt, and mTOR levels in the hippocampal CA1 region of PMD model rats, which may be one of the mechanisms of acupuncture in treating PMD.
Fig. 10.
Treatment with acupuncture for 28 days increased the protein expression levels of P13K (a), Akt (b), and mTOR (c) in the hippocampal tissue of rats with perimenopausal depression. The values are expressed as the means ± SD, n = 6. ∆∆ P < 0.01 vs. normal control. ★★P < 0.01 and ★P < 0.05 vs. model. ##P < 0.05 and #P < 0.05 vs. Western medicine. Statistical analysis: one-way ANOVA with Tukey’s post hoc test; significance: P < 0.05. Akt, serine-threonine protein kinase; ANOVA, analysis of variance; mTOR, mammalian target of rapamycin; P13K, phosphatidylinositol 3-kinase.
Discussion
Currently, the treatment options for PMD consist of antidepressant medications, such as selective serotonin reuptake inhibitors and serotonin and norepinephrine dual reuptake inhibitors, as well as hormone replacement therapy (MHT) and a combination of antidepressants with MHT. Nevertheless, the usage of antidepressants may potentially result in drug dependency and give rise to unfavorable side effects, including dizziness, nausea, and vomiting [10]. Hormone drugs may lead to increased cardiovascular disease risk and breast cancer risk in some women, with certain limitations [14–16]. A rising number of women are embracing complementary and alternative therapies for PMD, including acupuncture and moxibustion, because of their clear effectiveness and absence of noticeable negative effects. In this study, acupuncture at the Sanyinjiao, Baihui, Shenshu, and Ganshu acupoints was used to treat PMD. Acupuncture combined with a mid-course twirling and tonifying method is an empirical formula used in famous traditional Chinese medicine in Zhejiang Province. The therapeutic efficacy of this moxibustion and acupuncture technique is evident. Ganshu (BL18) and Shenshu (BL23) are both acupoints of the Foot Sun Bladder Meridian, while Baihui (GU20) is the acupoint of the Du Meridian. The Foot Sun Bladder Meridian communicates with the branches of the Governor Vessel, which in turn communicate with the numerous Yang meridians through the Foot Sun Meridian. Ultimately, the meridians converge in the kidneys, penetrating the bloodstream and brain. The intersection site of the liver, spleen, and kidney meridians is San Yin Jiao (SP6), which can regulate the qi and circulation of the organs and meridians. The aim of this study was to investigate the mechanism through which this acupuncture technique may act in treating PMD.
The PMD model is a complicated combination of the perimenopausal syndrome and depression models. Rat ovariectomy significantly reduces the supply of E2 from the ovaries, simulating hormonal changes in humans during perimenopause. The unpredictability of life can lead to chronic stimulation with stress-inducing stimuli [39]. This study used OVX and CUMS to construct a PMD rat model [38,40] and tested the depressive-like behavior of the PMD model rats; the results indicated that CUMS could induce depressive behavior in perimenopausal rats, which is consistent with previous studies [41,42]. To further verify the antidepressant effect of acupuncture on PMD, we used the SPT, OFT, and FST [43,44] and used a Western medicine group (treated with estradiol valerate combined with clomipramine hydrochloride tablets) as the positive control group [45,46]. This investigation demonstrated that the sucrose preference rate of PMD model rodents was statistically substantially elevated by both the acupuncture and Western medicine groups, increased the vertical and horizontal movement distance of PMD experimental rats in the OFT, and decreased the remaining time of PMD model rats in the FST. This study suggests additional evidence of the therapeutic efficacy of acupuncture in an experimental setting, specifically illustrating its antidepressant-like effect on rodents with PMD.
Damage to hippocampal neurons in brain tissue is a common feature of neurological disorders [47]. Numerous studies have shown that depression is characterized by the atrophy and loss of synapses in the medial prefrontal cortex and hippocampus [48]. Especially the pathological changes in the hippocampal CA1 region are related to the development of depression and cognitive decline [49,50]. Animal studies have shown that CUMS can cause functional impairment in the hippocampal CA1 region of rats, with HE staining showing neuronal atrophy, disorder, and irregular shape of the hippocampal pyramidal nucleus [51,52]. This study also revealed significant damage in the hippocampal CA1 region of PMD model rats, such as atrophy, loss of hippocampal neurons, and reduction of Nissl bodies. Acupuncture and moxibustion treatment can help repair the damage of hippocampal CA1 neurons in PMD model rats, thus effectively alleviating the symptoms of PMD.
PMD involves dysregulation of the human phenotype ontology (HPO) axis. The HPO axis consists of the hypothalamus, pituitary gland, and ovary, forming a comprehensive and coordinated neuroendocrine system that is intimately linked to the secretion of female sex hormones [53]. This axis initiates with hypothalamic GnRH pulsatility, stimulating pituitary release of FSH and LH, which subsequently drive ovarian E2 production [54,55]. Studies have shown that a lack of ovarian E2 is associated with emotional disorders such as depression [56]. Our model replicated key hormonal changes: decreased serum E2 and elevated FSH, LH, and GnRH. Acupuncture treatment significantly increased E2 and reduced FSH, LH, and GnRH levels, effectively rebalancing the HPO axis, similar to the hormonal action of estradiol valerate.
Controlling the functioning of autophagy is a good strategy for treating depression [57]. Autophagy, in addition to its antidepressant properties, significantly influences neuronal activity in individuals suffering from depression [58]. Studies have shown that mTOR, often referred to as the mammalian target protein of rapamycin, is an enzyme that phosphorylates serine and threonine residues. It functions as a autophagy suppressor, and its expression level is strongly associated with autophagy in neural cells [59,60]. The PI3K/Akt signaling system controls E2 levels in the body and contributes to the development, specialization, and movement of ovarian granulosa cells by regulating mTOR via the upstream PI3K/Akt pathway [61]. This pathway governs the process of cell proliferation and division and is involved in the differentiation, growth, proliferation, and repair of neuronal cells [62]. The study found that the protein and mRNA levels of P13K, Akt, and mTOR in the hippocampal CA1 region of the experimental group rats were significantly reduced. On the contrary, acupuncture and western medicine increased the mRNA and protein levels of P13K, Akt, and mTOR in the hippocampal CA1 region of rats. This study proposed that acupuncture has the potential to modulate the PI3K/Akt/mTOR signaling pathway. Acupuncture has a regulatory influence on the PI3K/Akt/mTOR signal transduction pathway. It is suggested that the antidepressant-like effects of acupuncture and moxibustion in rats with PMD could be linked to the activation of the PI3K/Akt/mTOR pathway. In future studies, we will further explore the effect of acupuncture and moxibustion on autophagy-related molecules downstream of mTOR and observe the morphological changes in autophagy cells in the hippocampal neurons of rats with PMD through transmission electron microscopy.
Overall, this study elucidated the function and mechanism of acupuncture in treating PMD. It demonstrated that acupuncture may elevate E2 levels in rats with PMD, decrease FSH and LH levels, and perhaps control hippocampus neuronal autophagy via the P13K/Akt/mTOR pathway in PMD model rats. Crucially, these effects contribute to the repair of neuronal damage specifically within the hippocampal CA1 subregion, a key area implicated in the pathophysiology of PMD. This repair of CA1 neuronal damage is likely a significant mechanism underlying acupuncture’s antidepressant effects. This study not only validates the practicality of using acupuncture as a therapeutic approach for PMD but also establishes a theoretical basis for the integration of acupuncture in PMD therapy. However, this study still has some limitations in terms of research methods. In future studies, we will further explore the effect of acupuncture and moxibustion on autophagy-related molecules downstream of mTOR and observe the morphological changes in autophagy in the hippocampal neurons of rats with PMD through transmission electron microscopy.
Conclusions
In summary, the present study demonstrated that acupuncture effectively alleviated depressive symptoms in rats during the perimenopausal period by modulating the PI3K/Akt/mTOR signaling pathway. Specifically, acupuncture treatment led to significant increases in the mRNA and protein expression levels of PI3K, Akt, and mTOR. These molecular changes subsequently mitigated the neurodegenerative alterations observed in the hippocampal CA1 region. Moreover, the PI3K/Akt/mTOR pathway may play a role in regulating hormone levels, thereby enhancing ovarian function. Additionally, the interplay between these pathways may contribute to the relief of depressive symptoms in perimenopausal women. Further research is warranted to elucidate the underlying mechanisms and explore the potential clinical applications of acupuncture in this context.
Acknowledgements
We thank all the study authors, Prof. Jin Yabei for her valuable comments on the article and Prof. Jin Huifang for guiding the statistical analysis of this article.
Data curation, S.-Z.L. Formal analysis, Y.-S.N. Methodology, J.-Y.B. Project administration, Z.-L.F. Writing-original draft, Z.-L.F. Writing review and editing, L.-C.H.
The datasets generated during and analyzed during the current study are available from the corresponding author on reasonable request.
This research was financially supported by the Provincial Administration of Traditional Chinese Medicine of Zhejiang Province, China (No. 2023ZF147) and the Hangzhou Municipal Health (No. A20220780).
Conflicts of interest
The authors declared no potential conflicts of interest concerning this article’s research, authorship, and publication.
References
- 1.Maki PM, Kornstein SG, Joffe H, Bromberger JT, Freeman EW, Athappilly G, et al. Guidelines for the evaluation and treatment of perimenopausal depression: summary and recommendations. J Womens Health (Larchmt). 2019; 28:117–134. [DOI] [PubMed] [Google Scholar]
- 2.Vivian-Taylor J, Hickey M. Menopause and depression: is there a link? Maturitas. 2014; 79:142–146. [DOI] [PubMed] [Google Scholar]
- 3.Alblooshi S, Taylor M, Gill N. Does menopause elevate the risk for developing depression and anxiety? Results from a systematic review. Australas Psychiatry. 2023; 31:165–173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Jin ZS, et al. Evaluation of cognitive impairment and factors influencing perimenopausal momen in China: an empirical analysis based on CHALs data. Mod Prev Med. 2023; 50:4094–4098 + 4123. [Google Scholar]
- 5.Jin ZS, et al. Evaluation of cognitive impairment and factors influencing perimenopausal women in China: an empirical analysis based on CHARLS data. Mod Prev Med. 2022; 42:1038–1043. [Google Scholar]
- 6.Li RX, et al. Analysis of perimenopausal syndrome, anxiety and depression and associated factors in community-women aged 40 to 55 years old. Fudan Univ J Med Sci. 2017; 44:27–33. [Google Scholar]
- 7.Al Wattar BH, Rogozińska E, Vale C, Fisher D, Petersen I, Nicum S, et al. Effectiveness and safety of menopause treatments: pitfalls of available evidence and future research need. Climacteric. 2024; 27:154–158. [DOI] [PubMed] [Google Scholar]
- 8.Chu K, Shui J, Ma L, Huang Y, Wu F, Wei F, et al. Biopsychosocial risk factors of depression during menopause transition in southeast China. BMC Womens Health. 2022; 22:273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Garay RP, Charpeaud T, Logan S, Hannaert P, Garay RG, Llorca P-M, Shorey S. Pharmacotherapeutic approaches to treating depression during the perimenopause. Expert Opin Pharmacother. 2019; 20:1837–1845. [DOI] [PubMed] [Google Scholar]
- 10.Milan R, Vasiliadis HM. The association between side effects and adherence to antidepressants among primary care community-dwelling older adults. Aging Ment Health. 2020; 24:1229–1236. [DOI] [PubMed] [Google Scholar]
- 11.Edinoff AN, Akuly HA, Hanna TA, Ochoa CO, Patti SJ, Ghaffar YA, et al. Selective serotonin reuptake inhibitors and adverse effects: a narrative review. Neurol Int. 2021; 13:387–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Nabavi SM, Daglia M, Braidy N, Nabavi SF. Natural products, micronutrients, and nutraceuticals for the treatment of depression: a short review. Nutr Neurosci. 2017; 20:180–194. [DOI] [PubMed] [Google Scholar]
- 13.Eubanks A. Hormone therapy: menopausal hormone therapy. FP Essent. 2023; 531:15–21. [PubMed] [Google Scholar]
- 14.Vinogradova Y, Coupland C, Hippisley-Cox J. Use of hormone replacement therapy and risk of breast cancer: nested case-control studies using the QResearch and CPRD databases. Bmj. 2020; 371:m3873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Abenhaim HA, Suissa S, Azoulay L, Spence AR, Czuzoj-Shulman N, Tulandi T. Menopausal hormone therapy formulation and breast cancer risk. Obstet Gynecol. 2022; 139:1103–1110. [DOI] [PubMed] [Google Scholar]
- 16.Lallas K, Anagnostis P, Theocharis P, Boureka E, Kyrgidis A, Klonos E, et al. The effect of menopausal hormone therapy on the risk of melanoma and keratinocyte skin cancer: a systematic review and meta-analysis of observational studies. Maturitas. 2023; 168:20–28. [DOI] [PubMed] [Google Scholar]
- 17.Gu Y, Han F, Xue M, Wang M, Huang Y. The benefits and risks of menopause hormone therapy for the cardiovascular system in postmenopausal women: a systematic review and meta-analysis. BMC Womens Health. 2024; 24:60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Van Hal M, Dydyk AM, Green MS. Acupuncture, in StatPearls. 2024, StatPearls Publishing Copyright ©. 2024, StatPearls Publishing LLC.: Treasure Island (FL) ineligible companies. Disclosure: Alexander Dydyk declares no relevant financial relationships with ineligible companies. Disclosure: Michael Green declares no relevant financial relationships with ineligible companies. [Google Scholar]
- 19.Zhao FY, Fu Q-Q, Spencer SJ, Kennedy GA, Conduit R, Zhang W-J, Zheng Z. Acupuncture: a promising approach for comorbid depression and insomnia in perimenopause. Nat Sci Sleep. 2021; 13:1823–1863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zheng L, Sun Z, Liu C, Zhang J, Jin Y, Jin H. Acupuncture-adjuvant therapies for treating perimenopausal depression: a network meta-analysis. Medicine (Baltim). 2023; 102:e34694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang J, Liao Y, You Y, Liang W, Wan L, Yang H, et al. Acupuncture and Chinese herbal medicine for menopausal mood disorder: a randomized controlled trial. Climacteric. 2023; 26:392–400. [DOI] [PubMed] [Google Scholar]
- 22.Zhong Z, Dong H, Wang H, Huang Y, Huang D, Huang G. Electroacupuncture for the treatment of perimenopausal syndrome: a systematic review and meta-analysis of randomized controlled trials. Acupunct Med. 2022; 40:111–122. [DOI] [PubMed] [Google Scholar]
- 23.Jin YB, Xiang HY, Zheng LF. Influence of catgut implantation at back-shu points on HAMD score and sex hormones in patients with perimenopausal depression and anxiety. J Chin J Tradit Chin Med. 2013; 31:1322–1324. [Google Scholar]
- 24.Sun ZL, et al. Clinical observation of acupoint catgut embedding in the treatment of mild depression in perimenopausal patients with kidney deficiency and liver stagnation syndrome. J Chin Acupunct Moxibusiton. 2015; 35:443–446. [PubMed] [Google Scholar]
- 25.Gordon JL, Girdler SS, Meltzer-Brody SE, Stika CS, Thurston RC, Clark CT, et al. Ovarian hormone fluctuation, neurosteroids, and HPA axis dysregulation in perimenopausal depression: a novel heuristic model. Am J Psychiatry. 2015; 172:227–236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Zhang K, Wang F, Zhai M, He M, Hu Y, Feng L, et al. Hyperactive neuronal autophagy depletes BDNF and impairs adult hippocampal neurogenesis in a corticosterone-induced mouse model of depression. Theranostics. 2023; 13:1059–1075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Gassen NC, Rein T. Is there a role of autophagy in depression and antidepressant action? Front Psychiatry. 2019; 10:337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jing Q, Ren L, Deng X, Zhang N, Fu M, Wang G, et al. Electroacupuncture promotes neural proliferation in hippocampus of perimenopausal depression rats via wnt/β-catenin signaling pathway. J Acupunct Meridian Stud. 2020; 13:94–103. [DOI] [PubMed] [Google Scholar]
- 29.Fakhri S, Iranpanah A, Gravandi MM, Moradi SZ, Ranjbari M, Majnooni MB, et al. Natural products attenuate PI3K/Akt/mTOR signaling pathway: a promising strategy in regulating neurodegeneration. Phytomedicine. 2021; 91:153664. [DOI] [PubMed] [Google Scholar]
- 30.Chen Y, Guan W, Wang M-L, Lin X-Y. PI3K-AKT/mTOR signaling in psychiatric disorders: a valuable target to stimulate or suppress? Int J Neuropsychopharmacol. 2024; 27:pyae010. doi: 10.1093/ijnp/pyae010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Su P, Wu M, Yin X, Li M, Li Y, Bai M, et al. Modified Xiaoyao San reverses lipopolysaccharide-induced depression-like behavior through suppressing microglia M1 polarization via enhancing autophagy involved in PI3K/Akt/mTOR pathway in mice. J Ethnopharmacol. 2023; 315:116659. [DOI] [PubMed] [Google Scholar]
- 32.Wang Z, Huang P-E, Wang N, Zhang Q, Kang J, Fang Y, et al. β-asarone inhibits autophagy by activating the PI3K/Akt/mTOR pathway in a rat model of depression in Parkinson’s disease. Behav Brain Res. 2024; 465:114966. [DOI] [PubMed] [Google Scholar]
- 33.Xu J, Zheng B, Ma Y, Zhang X, Cheng J, Yang J, et al. PI3K-AKT-mTOR signaling pathway regulates autophagy of hippocampal neurons in diabetic rats with chronic unpredictable mild stress. Behav Brain Res. 2023; 452:114558. [DOI] [PubMed] [Google Scholar]
- 34.Yu J. Hormone Resistance. Adv Exp Med Biol. 2021; 1187:391–401. [DOI] [PubMed] [Google Scholar]
- 35.Liu S, Jia Y, Meng S, Luo Y, Yang Q, Pan Z, et al. Mechanisms of and potential medications for oxidative stress in ovarian granulosa cells: a review. Int J Mol Sci. 2023; 24:9205. doi: 10.3390/ijms24119205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Li W, Yin X, Yan Y, Liu C, Li G. Kurarinone attenuates hydrogen peroxide-induced oxidative stress and apoptosis through activating the PI3K/Akt signaling by upregulating IGF1 expression in human ovarian granulosa cells. Environ Toxicol. 2023; 38:28–38. [DOI] [PubMed] [Google Scholar]
- 37.Jin YB, et al. Discussion of effect on ethology of perimenopausal syndrome rats by electroacupuncture in different periods. Chin J Trad Chin Med Pharmacy. 2010; 25:1689–1693. [Google Scholar]
- 38.Yao G, Bai Z, Niu J, Zhang R, Lu Y, Gao T, Wang H. Astragalin attenuates depression-like behaviors and memory deficits and promotes M2 microglia polarization by regulating IL-4R/JAK1/STAT6 signaling pathway in a murine model of perimenopausal depression. Psychopharmacology (Berl). 2022; 239:2421–2443. [DOI] [PubMed] [Google Scholar]
- 39.Antoniuk S, Bijata M, Ponimaskin E, Wlodarczyk J. Chronic unpredictable mild stress for modeling depression in rodents: meta-analysis of model reliability. Neurosci Biobehav Rev. 2019; 99:101–116. [DOI] [PubMed] [Google Scholar]
- 40.Wang D, Wang J, Yu Z, Yao R, Zhang J, Zhao X. Quercetin alleviates perimenopausal depression induced by ovariectomy combined with chronic unpredictable mild stress through regulating serum elements and inhibiting ferroptosis in prefrontal cortex of rats. Biol Trace Elem Res. 2024; 202:5596–5611. [DOI] [PubMed] [Google Scholar]
- 41.Hao-Ran Y, Li-Na L, Fei GE, Jing Y, Qin-Lei C, Wei-Ting LU, Fei Q. Effect of Xiaoyao San on OVX combined with CUS anxiety and depression model rats based on hippocampal microglia M1 polarization. Zhongguo Zhong Yao Za Zhi. 2020; 45:4964–4970. [DOI] [PubMed] [Google Scholar]
- 42.Zhang K, Wang Z, Pan X, Yang J, Wu C. Antidepressant-like effects of Xiaochaihutang in perimenopausal mice. J Ethnopharmacol. 2020; 248:112318. [DOI] [PubMed] [Google Scholar]
- 43.Hao Y, Ge H, Sun M, Gao Y. Selecting an appropriate animal model of depression. Int J Mol Sci. 2019; 20:4827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Zhou XD, Yang X-J, Zheng Y, Qin Z-S, Sha W, Chen G, Zhang Z-J. A proprietary herbal medicine, ameliorates mood disorder-like behavior and cognitive impairment in estrogen-deprived mice exposed to chronic unpredictable mild stress: implication for a potential therapy of menopause syndrome. Front Psychiatry. 2020; 11:579995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Vega-Rivera NM, Fernández-Guasti A, Ramírez-Rodríguez G, Estrada-Camarena E. Effect of sub-optimal doses of fluoxetine plus estradiol on antidepressant-like behavior and hippocampal neurogenesis in ovariectomized rats. Psychoneuroendocrinology. 2015; 57:113–124. [DOI] [PubMed] [Google Scholar]
- 46.Récamier-Carballo S, Estrada-Camarena E, Reyes R, Fernández-Guasti A. Synergistic effect of estradiol and fluoxetine in young adult and middle-aged female rats in two models of experimental depression. Behav Brain Res. 2012; 233:351–358. [DOI] [PubMed] [Google Scholar]
- 47.Chen K, Palagashvili T, Hsu W, Chen Y, Tabakoff B, Hong F, et al. Brain injury and inflammation genes common to a number of neurological diseases and the genes involved in the genesis of GABAnergic neurons are altered in monoamine oxidase B knockout mice. Brain Res. 2022; 1774:147724. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Wen J, Fu CHY, Tosun D, Veturi Y, Yang Z, Abdulkadir A, et al. ; iSTAGING consortium, ADNI, BIOCARD, and BLSA. Characterizing heterogeneity in neuroimaging, cognition, clinical symptoms, and genetics among patients with late-life depression. JAMA Psychiatry. 2022; 79:464–474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Idunkova A, Lacinova L, Dubiel-Hoppanova L. Stress, depression, and hippocampus: from biochemistry to electrophysiology. Gen Physiol Biophys. 2023; 42:107–122. [DOI] [PubMed] [Google Scholar]
- 50.Liu Y, Li Y, Li J, Rao H, Sun J, Xiu J, Wu N. Gypenosides alleviate oxidative stress in the hippocampus, promote mitophagy, and mitigate depressive-like behaviors induced by CUMS via SIRT1. J Ethnopharmacol. 2025; 337:118823. [DOI] [PubMed] [Google Scholar]
- 51.Tian RH, Bai Y, Li J-Y, Guo K-M. Reducing PRLR expression and JAK2 activity results in an increase in BDNF expression and inhibits the apoptosis of CA3 hippocampal neurons in a chronic mild stress model of depression. Brain Res. 2019; 1725:146472. [DOI] [PubMed] [Google Scholar]
- 52.Wang Y, Du X, Duan C, Wang M, Zhu Y, Wang L, et al. Regulating the plasticity of hippocampal neurons via electroacupuncture in depression model mice. Cell Prolif. 2025:e70057. doi: 10.1111/cpr.70057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Ma J, Guo C-Y, Li H-B, Wu S-H, Li G-L. Prophylactic effects of hemp seed oil on perimenopausal depression: a role of HPA axis. J Oleo Sci. 2023; 72:939–955. [DOI] [PubMed] [Google Scholar]
- 54.Li J, He P, Zhang J, Li N. Orcinol glucoside improves the depressive-like behaviors of perimenopausal depression mice through modulating activity of hypothalamic-pituitary-adrenal/ovary axis and activating BDNF- TrkB-CREB signaling pathway. Phytother Res. 2021; 35:5795–5807. [DOI] [PubMed] [Google Scholar]
- 55.Wang HX, et al. Research progress on the relationship between perimenopausal depression and the hypothalamic pituitary ovarian axis. Guangxi Med J. 2021; 43:484–486 + 502. [Google Scholar]
- 56.Xu H, Yu ZH, Ge MJ, Shen J-X, Han F, Pan C, et al. Estradiol attenuates chronic restraint stress-induced dendrite and dendritic spine loss and cofilin1 activation in ovariectomized mice. Horm Behav. 2021; 135:105040. [DOI] [PubMed] [Google Scholar]
- 57.Sainani SR, Pansare PA, Rode K, Bhalchim V, Doke R, Desai S. Emendation of autophagic dysfuction in neurological disorders: a potential therapeutic target. Int J Neurosci. 2022; 132:466–482. [DOI] [PubMed] [Google Scholar]
- 58.Zhu YJ, Huang J, Chen R, Zhang Y, He X, Duan W-X, et al. Autophagy dysfunction contributes to NLRP1 inflammasome-linked depressive-like behaviors in mice. J Neuroinflammation. 2024; 21:6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Querfurth H, Lee HK. Mammalian/mechanistic target of rapamycin (mTOR) complexes in neurodegeneration. Mol Neurodegener. 2021; 16:44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Battaglioni S, Benjamin D, Wälchli M, Maier T, Hall MN. mTOR substrate phosphorylation in growth control. Cell. 2022; 185:1814–1836. [DOI] [PubMed] [Google Scholar]
- 61.Al-Shahat A, Hulail MAE, Soliman NMM, Khamis T, Fericean LM, Arisha AH, Moawad RS. Melatonin mitigates cisplatin-induced ovarian dysfunction via altering steroidogenesis, inflammation, apoptosis, oxidative stress, and PTEN/PI3K/Akt/mTOR/AMPK signaling pathway in female rats. Pharmaceutics. 2022; 14:2769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Ekizceli G, Inan S, Oktem G, Onur E, Ozbilgin K. Immunohistochemical determination of mTOR pathway molecules in ovaries and uterus in rat estrous cycle stages. Histol Histopathol. 2020; 35:1337–1351. [DOI] [PubMed] [Google Scholar]










