Distinct cellular and reproductive consequences of meiotic chromosome synapsis defects in syce2 and sycp1 mutant zebrafish

Iván Olaya; Ilara N Yilmaz; Naima Nour-Kasally; Ross E Charboneau; Bruce W Draper; Sean M Burgess

doi:10.1371/journal.pgen.1011656

. 2025 Sep 5;21(9):e1011656. doi: 10.1371/journal.pgen.1011656

Distinct cellular and reproductive consequences of meiotic chromosome synapsis defects in syce2 and sycp1 mutant zebrafish

Iván Olaya ^1,², Ilara N Yilmaz ¹, Naima Nour-Kasally ¹, Ross E Charboneau ¹, Bruce W Draper ¹, Sean M Burgess ^1,^*

Editor: Michael Lichten³

PMCID: PMC12425308 PMID: 40911633

Abstract

The synaptonemal complex (SC) is a meiosis-specific structure that aligns homologous chromosomes and promotes the repair of meiotic DNA double-strand breaks (DSBs). To investigate how defects in SC formation affect gametogenesis in zebrafish, we analyzed mutations in two genes encoding core SC components: syce2 and sycp1. In syce2 mutants, chromosomes exhibit partial synapsis, primarily at sub-telomeric regions, whereas sycp1 mutant chromosomes display early prophase co-alignment but fail to synapse. Both mutants exhibit reduced efficiency in repairing meiotic DSBs compared to wild type. Despite these defects, syce2 and sycp1 mutant females are fertile. However, sycp1 mutant females produce a higher proportion of malformed progeny, correlating with increased univalent formation. While syce2 mutant males are fertile and produce normal offspring, sycp1 mutant males are sterile, with spermatocytes that transit prophase I but arrest at metaphase I or II. Additionally, sycp1 mutants display a male-biased sex ratio that can be suppressed by extending the developmental window for sex determination, suggesting that the absence of synapsis delays-but does not completely block-meiotic progression. Notably, embryos from syce2 and sycp1 mutant females exhibit widespread somatic mosaic aneuploidy, indicating that impaired meiotic chromosome dynamics can compromise genome stability during early development. In contrast to mouse SC mutants, the zebrafish syce2 and sycp1 mutants examined in this study progress through meiotic prophase I with minimal disruption, suggesting a less stringent surveillance mechanism for synapsis errors in zebrafish.

Author summary

Meiosis is a specialized cell division that generates eggs and sperm and ensures that offspring inherit the correct number of chromosomes. A protein-based structure called the synaptonemal complex (SC) plays a central role in aligning homologous chromosomes and promoting the repair of intentional DNA breaks that occur during meiosis. Defects in the SC can lead to infertility or birth defects, but the consequences of these defects can vary across species. In this study, we used Zebrafish to investigate how mutations in two core SC genes, syce2 and sycp1, affect meiosis and development. We found that both genes are required for proper chromosome synapsis and DNA repair during meiosis, but the consequences of disrupting each gene differ. Mutants lacking sycp1 are sterile as males and produce malformed embryos as females, while syce2 mutants are fertile and produce healthy offspring. Surprisingly, despite their meiotic defects, both mutants proceed through meiosis without triggering a strong arrest, suggesting that zebrafish may have a weaker surveillance system than mammals. Furthermore, we found that offspring from mutant females often show mosaic chromosome abnormalities, indicating that meiotic errors can lead to genome instability during early development. These findings highlight important differences in how vertebrates monitor meiosis and reveal a previously underappreciated link between meiotic chromosome regulation and somatic genome stability.

Introduction

There has been a world-wide trend of decreasing sperm count among men, yet the cause is unknown [1]. Mutations in genes encoding protein components of the meiotic synaptonemal complex (SC) are associated with nonobstructive azoospermia [2–5] in men and pregnancy loss [6] and primary ovarian insufficiency syndrome in women [7,8]. It is possible that effects of less deleterious mutations might be enhanced by environmental factors [1]. Studies in several model organisms have demonstrated the critical role the SC plays in the completion of meiosis that have provided insights into human infertility [9].

Meiosis is a specialized cellular program that is required to produce haploid gametes through one round of DNA replication and two consecutive rounds of chromosome segregation. Homologous chromosomes (homologs) are segregated in meiosis I while sister chromatids are segregated in meiosis II. Crossing over between non-sister chromatids of homologs by homologous recombination is central to proper meiosis I segregation. Recombination is initiated by forming and repairing programmed DNA double-strand breaks (DSBs) that are catalyzed by the enzyme Spo11 [10,11]. Each homolog pair experiences at least one crossover that supports proper segregation [12–17]. This so-called “crossover assurance” depends on ZMM (Zip, Msh, Mer) proteins that function within the context of the synaptonemal complex (SC) [18,19].

The SC is an evolutionarily conserved tripartite structure observed in meiotic prophase across many species [20] and is composed of two chromosome axes, one for each homolog, a central region containing proteins that connect homologous axes, and a central element within the central region that stabilizes the overall structure (Fig 1A) [21,22]. In vertebrates, the central region contains head-to-head interacting dimers of the transverse filament protein SYCP1 flanked by two bands of central element filaments containing SYCE1, SYCE2, SYCE3, TEX12 and SIX6OS1 [21]. Zebrafish share orthologs of corresponding genes with mouse and humans. In mouse, SYCE2 and TEX12 form a complex that stabilizes interactions between the alpha-helical domains at the N terminus (𝛼N) of SYCP1 [23–27]. Once the SC is established at sites of future crossovers, the central element promotes longitudinal expansion of the SC to align chromosomes end-to-end. Mouse SYCE2 is required to fully assemble the SC by stabilizing SYCP1 interactions, and its absence leads to foci or short stretches of SYCP1 between paired chromosome axes [23]. Functional orthologs of the central element proteins also exist in the SC in budding yeast [28] and Drosophila [29], highlighting the conserved nature of SC assembly.

A meiotic checkpoint network exists to coordinate the ordered execution of dependent events of meiotic prophase I [30]. Asynapsis or unrepaired DSBs can lead to delayed or arrested prophase I, and in some cases result in apoptosis. In mice, the failure to fully synapse homologs activates a checkpoint that is separable from one surveilling DSBs, and in both cases cells are eliminated at meiotic prophase I [31–35]. In humans, mutations in the central element gene SYCE1 are associated with nonobstructive azoospermia [2,4]. Synapsis defects in other model organisms tend to have less severe phenotypes: In C. elegans, a null mutation in the sycp1 ortholog, syp-1, results in an increase in apoptosis in the germline [36,37] and egg production is reduced by ~22–24% [38,39]. In budding yeast, disrupting the transverse filament or central element of the SC delays the first meiotic division, presumably due to the slow repair of DSBs and not through a synapsis checkpoint per se [40–44]. In Drosophila females, partial disruption of the SC leads to a checkpoint-mediated prophase I delay, yet total loss of SC does not appear to cause delay or arrest [45,46]. In Arabidopsis, elimination of the SC has marginal effects on seed number and pollen viability [47]. Zebrafish spo11 mutant females produce normal numbers of fertile eggs despite defects in DSB formation and synapsis [48]. However, it is possible that a “checkpoint-inducing” signal is not produced in the spo11 mutant, similar to what has been proposed for the spo11 mutant in budding yeast [49,50]. In this study, we investigated how loss of synapsis in syce2 and sycp1 mutant zebrafish impacts meiotic progression and reproduction and compare and contrast outcomes with these model organisms.

The chromosome events of meiotic prophase I follow a coherent timeline in zebrafish [48,51]. During leptotene, the deposition of short axial structures at each telomere is concurrent with the formation of DSBs. At early zygotene, co-alignment of short homolog axes is followed by the initiation of the SC, which extends closely behind the growing axes creating a moving fork until homologs are synapsed from end-to-end at pachytene. Co-alignment and synapsis appear to initiate almost exclusively at the ends of chromosomes while interstitial regions are joined by “zippering up”. This is reminiscent of the temporal order of events in C. elegans, where pairing and synapsis are initiated solely at defined pairing centers located at one end of each chromosome and the SC extends in a linear fashion [52–54]. The important difference is that in C. elegans, pairing at chromosome ends is mediated by protein/protein interactions to bridge homologs, while in zebrafish it is mediated by the processing of Spo11-induced DSBs.

A mutation in the zebrafish sycp1 gene was recovered in a forward genetic screen to identify mutants defective for spermatogenesis [55]. Further analysis of mutant sycp1^isa/isa males showed that homologs pair at the ends but do not synapse [56]. In addition, spermatogenesis was arrested, though the meiotic stage of the arrest was not determined. Since females were not analyzed in this study, it remained unknown how loss of sycp1 affects oogenesis. Here, we examined zebrafish containing loss-of-function mutations in sycp1 or syce2 and found that synapsis is completely abolished in sycp1^-/- mutants and reduced to short synapsed-like structures at the ends of chromosomes in syce2^-/- mutants. Both mutants exhibit increased numbers of DSBs in zygotene nuclei and inefficient repair implicating the SC in this process. Remarkably, syce2^-/- mutant males and females are fertile and produce a high percentage of healthy offspring. By contrast, sycp1^-/- males are infertile with spermatocytes transiting prophase I to metaphase. In addition, sycp1^-/- females produce normal numbers of eggs but predominantly malformed progeny, though some live to adulthood. Our study highlights the differences in reproductive outcomes between males and females in a teleost species in response to synapsis defects. We also show that embryos of syce2^-/- and sycp1^-/- mothers exhibit a striking degree of somatic mosaic aneuploidy suggesting that defects in meiotic genes can lead to genome instability during embryogenesis.

Results

Targeted mutation of syce2 and sycp1

The zebrafish syce2 gene consists of 5 exons that encode a 187 amino acid (aa) protein. Alignment of the zebrafish Syce2 amino acid sequence with human and mouse orthologs highlights conservation of the core region of SYCE2 in vertebrates (Fig 1B). The core is a long α helical structure shown to interact with TEX12 [24]. A human SYCE2 genetic variant associated with pregnancy loss is located within the core region [6] (Fig 1B). To disrupt the function of zebrafish syce2, we used CRISPR-Cas9 to introduce an indel mutation resulting in a predicted 88 aa truncated protein (syce2^uc98; Figs 1B-green arrow; and S1A). An AlphaFold-predicted structure shows that the syce2^uc98 mutation should remove all but three amino acids of the core and abolish the Tex12 interaction domain (Fig 1C). Antibodies to mammalian SYCE2 did not cross-react with the zebrafish protein. In this study we refer to the syce2^uc98/uc98 mutant as syce2^-/-.

The sycp1 gene contains 32 exons that encode a 1000 aa protein. Using CRISPR-Cas9 we introduced a deletion/insertion mutation into exon 5 (sycp1^uc97; S1B Fig). This mutation creates a net five aa deletion within the αN domain immediately followed by a premature stop codon resulting in a predicted 97 aa protein (Fig 1D). For this study we refer to the sycp1^uc97/uc97 mutant as sycp1^-/-. Sequencing of RT-PCR products generated from syce2^-/- and sycp1^-/- testes RNA confirmed that the mutations do not cause exon skipping that could potentially lead to a truncated but functional protein (S1C Fig) [57,58]. Immunostaining Sycp1 reveals its localization is absent in sycp1^-/- mutants (described below).

Loss of Syce2 leads to asynapsis of interstitial regions of homologous chromosomes

Since mammalian SYCE2 functions to extend the SC from sites of initiation [23], we predicted that in syce2^-/- zebrafish, synapsis would occur at the ends of chromosomes but would fail to “zipper-up” end-to-end. To test this, we analyzed images of immunostained surface-spread chromosomes from wild-type and syce2^-/- zebrafish spermatocytes with antibodies to Sycp3, Sycp1, and a probe hybridizing to telomeres, and imaged them using structured-illumination microscopy. In wild-type spermatocytes, the homolog axes assemble initially at the chromosome ends in leptotene, co-align in early zygotene, then extend concurrently with the deposition of Sycp1 to form full-length SC in pachytene (Figs 2A and S2A). In syce2^-/- spermatocytes, the majority of the 50 chromosome ends form short parallel axial tracks in early zygotene, suggesting that homologs have found their partners (Figs 2B and S2B). However, the synapsed-like configuration at the ends does not lengthen as meiotic prophase I progresses. Instead, the axes continue to elongate until they include the entire length of each homolog, but the interstitial regions remain separated. Occasional patches of synapsed-like axes occur in the interstitial regions in the syce2^-/- mutant but are relatively rare. We measured the mean lengths of synapsed and synapsed-like segments per nucleus which are 7.71 ± 1.54 µm in wild-type pachytene nuclei compared to 1.16 ± 0.26 µm in pachytene-like nuclei of the mutant (Fig 2C). These results indicate that short stretches of SC form between homologs in the absence of Syce2 but that longitudinal extension of the SC is inhibited.

Fig 2 — (A–B) Surface-spread chromosomes from *syce2*^+/+ (A) and *syce2*^-/- (B) spermatocytes imaged using structured illumination microscopy. Proteins are immunostained for Sycp3 (green) and Sycp1 (magenta and gray). Telomeres (cyan) are detected by *in-situ* hybridization using a fluorescent PNA probe. Examples of spread chromosomes during meiotic prophase I are shown: Early Zygotene (EZ), Late Zygotene (LZ), Pachytene (P) (*syce2*^+/+), and Pachytene-like (P-like) (*syce2*^-/-). Scale bar = 10 µm. Boxed region represents magnified examples of synapsed pachytene (*syce2*^+/+) and pachytene-like (*syce2*^-/-) chromosomes. Scale bar for magnified examples = 2 µm. Arrows represent synapsed-like regions with Sycp1 localization. Double arrowheads indicate Sycp1 localization at unaligned axial regions. (C) Mean synapsed segment per cell (µm) in pachytene and pachytene-like spermatocytes. The mean synapsed segment is significantly lower in *syce2*^-/- spermatocytes (n = 7) compared to *syce2*^+/+ (n = 8). Significance was determined using an unpaired t-test. **** = p < 0.0001. (D) Relative mean Sycp1 intensity per cell from early zygotene to pachytene or pachytene-like spermatocytes normalized to the mean *syce2*^+/+ EZ values. Mean-fluorescence intensity between the axes (n = 25) – mean background (n = 6) was determined for each cell using the segmented-line tool in ImageJ. n = 5, *syce2*^+/+ – EZ; n = 5; *syce2*^+/+ – MZ; n = 4, *syce2*^+/+ – LZ; n = 8, *syce2*^+/+ – P; n = 3, *syce2*^-/- – EZ; n = 6, *syce2*^-/- – MZ; n = 4, *syce2*^-/- – LZ; n = 7, *syce2*^-/- – P-like. Significance was determined using ordinary one-way ANOVA testing with Šidák’s multiple comparisons test. ns = not significant; **** = p < 0.0001. (E) Distance between axes for co-aligned axial pairs in pachytene (n = 126) and pachytene-like (n = 93) spermatocytes from 8 cells in *syce2*^+/+ and 7 cells in *syce2*^-/- shown as a violin plot. Note that one pixel is equal to 0.03 µm resulting in a graph with a bimodal distribution. Significance was determined using an unpaired t-test. **** = p < 0.0001. (F–G) Surface-spread chromosomes from *syce2*^+/+ (F) and *syce2*^-/- (G) oocytes imaged using structured illumination microscopy immunostained for Sycp3 and Sycp1. Examples of spread chromosomes during meiotic prophase I are described in (A–B). Scale bar = 10 µm. Boxed region represents magnified examples of synapsed pachytene and pachytene-like chromosomes. Scale bar for magnified examples = 2 µm. Arrows represent synapsed-like regions with Sycp1 localization. Double arrowhead indicates Sycp1 localization at unaligned axial regions.

To better understand how synapsed-like regions compare to bona fide SC, we measured the relative levels of Sycp1 protein in synapsed (wild-type) and synapsed-like (syce2^-/-) chromosomes in nuclei that represented all stages of prophase I. In wild-type spermatocytes, the relative mean Sycp1 fluorescence intensity increased steadily by nearly 3-fold by the end of prophase I from 1.00 ± 0.32 in early zygotene to 2.75 ± 0.76 in pachytene (Fig 2D). In syce2^-/- spermatocytes, Sycp1 also loads between nascent axes, but at levels barely above background, and as foci or short patches instead of continuous stretches (Fig 2B; P-like magnified). Sycp1 is also found at low levels along the lengths of asynapsed axes by visual inspection. In addition, the relative mean intensity of Sycp1 between axes in syce2^-/- spermatocytes remains low from early zygotene (0.48 ± 0.10) through the pachytene-like stage (0.66 ± 0.29) (Fig 2D). The diminished Sycp1 levels observed in the syce2^-/- mutant presumably reflect the destabilization of the central region.

We next tested whether the reduced level of Sycp1 on syce2^-/- chromosomes affects the distance between axes in the synapsed-like regions. For this, a line perpendicular to the parallel axes was drawn in ImageJ and the distance between the maximum intensity signal (peaks) for each axis was determined. We found that the mean distance between peaks was slightly larger in the syce2^-/- mutant (0.17 ± 0.02 µm) compared to wild-type (0.14 ± 0.02 µm) (Fig 2E). These results show that the synapsed-like regions in syce2^-/- mutants resemble wider than normal SC with reduced amounts of Sycp1.

We next examined chromosome spreads of syce2^+/+ and syce2^-/- oocytes (Fig 2F and 2G). As seen for spermatocytes, Sycp1 also appears as foci at sub-telomeric regions in syce2^-/- zygotene oocytes (as detected by bright nodules of Sycp3 staining) and as short stretches in pachytene-like oocytes (Fig 2G). While we did not observe full-length chromosome alignment in the syce2^-/- females, the co-aligned (< 0.5 µm) and synapsed-like regions are found both at the ends of chromosomes and in interstitial regions. Since the distribution of crossovers indicated by Mlh1 foci is more evenly distributed in zebrafish oocytes compared to spermatocytes [59,60], it appears that partial synapsis may mirror the different recombination landscape of the two sexes. Notably, there is considerable entanglement of chromosome axes in both oocytes and spermatocytes.

Formation and loss of co-aligned axes in sycp1^-/- spermatocytes resembles wild-type chromosome behavior

A previous study of the sycp1^isa allele reported that sub-telomeric regions of sycp1^isa/isa spermatocytes were aligned in leptotene and early zygotene, but that these tight associations were lost at late prophase stages [56]. We also found co-aligned ends during early zygotene (EZ) and late zygotene (LZ) stage of spermatogenesis that are similar to wild-type chromosome spreads (Fig 3A and 3B). We found the number of co-aligned pairs of chromosome ends per cell in sycp1^-/- leptotene spermatocytes (10.7 ± 6.1) out of 50 is comparable to wild-type (13.9 ± 8.4) (Fig 3C) and these values increase in zygotene (33.7 ± 7.3), yet they do not reach the same level as synapsed ends in wild-type (45.5 ± 5.5). Instead, the number of co-aligned regions between full-length axes, which we refer to as “pachytene/diplotene-like”, in sycp1^-/- mutant spermatocytes is reduced from zygotene levels by ~54% (15.5 ± 8.8) consistent with the sycp1^isa/isa phenotype which was attributed to possibly weak contacts at sub-telomeric regions or DSBs resolving into non-crossovers [56]. Similar to syce2^-/- mutants, there is considerable entanglement of axes in both oocytes and spermatocytes.

Fig 3 — (A) Surface-spread chromosomes from *sycp1*^-/- spermatocytes imaged using structured illumination microscopy stained for Sycp3 (green), Sycp1 (magenta and gray) and telomeres (cyan). Examples of spread chromosomes during meiotic prophase I are shown: EZ (early zygotene), LZ (late zygotene), P (pachytene). Scale bar = 10 µm. Boxed region represents magnified examples of pachytene chromosomes. Scale bar for magnified examples = 2 µm. (B) Surface-spread chromosomes from *sycp1*^-/- spermatocytes as described in (A); P/D (pachytene/diplotene-like). Scale bar = 10 µm. Boxed region represents magnified examples of P/D-like chromosomes. Scale bar for magnified examples = 2 µm. (C) Number of co-aligned pairs of sub-telomeric regions per cell across prophase I in *sycp1*^+/+ and *sycp1*^-/- spermatocytes from (A–B). Images for leptotene (L) are not shown but are characterized by predominantly short un-aligned axes. n = 27, *sycp1*^+/+– L; n = 25, *sycp1*^-/-– L; n, = 61 *sycp1*^+/+– Z; n = 60, *sycp1*^-/-– Z; n = 36, *sycp1*^+/+– P; n = 20, *sycp1*^-/-– P/D-like. Significance was determined using ordinary one-way ANOVA testing with Šidák’s multiple comparisons test. ns = not significant; **** = p < 0.0001. (D) Proportion of co-aligned and unaligned pairs of sub-telomeric regions in *sycp1*^+/+ diplotene (D) (n = 186) and *sycp1*^-/- P/D-like (n = 1000) spermatocytes. 11 cells were used for *sycp1*^+/+ and 20 cells for *sycp1*^-/-. Significance was determined using Fisher’s exact test. ns = not significant. (E) Surface-spread chromosomes from *sycp1*^-/- oocytes as described in (A and B). Scale bar = 10 µm. Boxed region represents magnified examples of P/D-like chromosomes. Scale bar for magnified examples = 2 µm.

We next considered that the loss of co-aligned ends in sycp1^-/- pachytene/diplotene-like nuclei might reflect a natural feature of wild-type diplotene chromosomes and extended the analysis to compare pachytene/diplotene-like chromosome ends in the mutant to wild-type diplotene chromosomes. Diplotene is the stage following pachytene when the SC is disassembled, and homologs are held together by chiasmata (sites of crossing over). Thus, the proximity of telomeres in diplotene bivalents depends on the distance between a chiasma and the adjacent chromosome ends. Since zebrafish spermatocytes experience ~1.1 crossovers per chromosome on average [59,61], it would be expected that most telomeres of diplotene chromosomes will not be in close proximity. We used 0.5 µm as the maximum distance to consider chromosome axes as co-aligned as in [48] based on the ~ 400 nm co-alignment distance between axes reported in other species prior to or without synapsis [62,63]. Since meiotic chromosomes do not undergo uniform desynapsis in any given nucleus, we limited our analysis to desynapsed ends in diplotene nuclei that we define as having three or more bivalents where at least 50% of full-length axes are not synapsed (S3 Fig). The number of ends we could evaluate in the sycp1^-/- spermatocytes is much larger since they were all considered to be asynapsed. The proportion of desynapsed aligned ends in wild-type diplotene spermatocytes (29.6%) is indistinguishable from sycp1^-/- pachytene/diplotene-like spermatocytes (24.2%) (Fig 3D). Therefore, loss of sub-telomeric contacts is a general property of normal diplotene chromosomes and sycp1^-/- chromosomes with full-length axes may be in a diplotene-like configuration.

Co-aligned axes but not synapsis in sycp1^-/- oocytes

A previous study of the sycp1^isa allele failed to recover females in the homozygous population [56], therefore how loss of Sycp1 affects oogenesis was not determined. Because we found females among the sycp1^-/- population, we could examine chromosome spreads of sycp1^-/- females. We found evidence of chromosome co-alignment without synapsis at sub-telomeric regions in early zygotene as in wild-type (Figs 3E and 2F), but full-length alignment is not observed in later stage oocytes. These results show that synapsis is dispensable for co-alignment but required for end-to-end alignment of homologs during oogenesis.

Different reproductive outcomes in syce2^-/- and sycp1^-/- mutants despite severe synapsis defects

In mice, mutations in Syce2 and Sycp1 lead to infertility due to a prophase I checkpoint that removes defective spermatocytes and oocytes [21]. We therefore tested whether fertility was affected in syce2^-/- and sycp1^-/- mutants. syce2^-/- males induce wild-type females to spawn similar numbers of eggs (272 ± 164) as wild-type males (234 ± 103) (Fig 4A), indicating normal mating behavior. The average fertilization rate of syce2^-/- males (74.6% ± 26.4%), while somewhat lower, was not significantly different from wild-type controls (90.4% ± 9.2%) (Fig 4A).

When crossed to wild-type males, syce2^-/- females also yield similar numbers of spawned eggs (183.6 ± 101.0) as wild-type females (207.6 ± 146.4) (Fig 4A). The average fertilization rate of syce2^-/- females (95.2% ± 4.8%), was also similar to wild-type controls (and 90.1% ± 25.7%) (Fig 4A). Remarkably, a high percentage of fertilized eggs from both syce2^-/- males and females appear morphologically healthy at 1- and 5-days post fertilization (dpf) (Fig 4B), though there was more variability among progeny of syce2^-/- mothers compared to males.

To determine whether the mutants produce euploid or aneuploid offspring, we counted metaphase chromosomes in cells (n = 10) isolated from 1-day old embryos of wild-type mothers, and both normal and malformed-looking embryos from syce2^-/- mothers. Both normal and malformed progeny from syce2^-/- females exhibit considerable variability in the number of chromosomes per nucleus (dots) within individual embryos (bars), while wild-type nuclei rarely deviate from 50 chromosomes (Fig 4C). These results indicate that defects in the meiotic machinery can lead to genome instability in the developing embryo leading to mosaic somatic aneuploidy.

Crosses involving sycp1^-/- males induced similar numbers of spawned eggs (258 ± 62) compared to wild-type controls (280 ± 1130) (Fig 4D). Similarly, spawning by sycp1^-/- females was not significantly different from controls (162 ± 87 and 178 ± 181) (Fig 4D). However, fertility is dramatically reduced in sycp1^-/- males (<0.04% ± 0.1%) compared to controls (75.9% ± 25%) while the fertility of sycp1^-/- females (82.8% ± 25.7%) is not (88.9% ± 13.5%) (Fig 4D). The majority of offspring from sycp1^-/- mutant females appear malformed at 1 and 5 dpf (Fig 4E). Over the course of this study, we found that 6 out of 4233 eggs (0.14%) were fertilized by sycp1^-/- males, indicating that completion of meiosis does occur at a low rate.

Similar to progeny of syce2^-/- mothers, a significant amount of mosaic somatic aneuploidy is observed among cells of embryos of sycp1^-/- mutant females (Fig 4F). These results demonstrate that the partial synapsis observed in syce2^-/- mutants is sufficient to produce fertile gametes and progeny that are visually normal at 1 and 5 dpf while complete asynapsis in the sycp1^-/- mutant primarily affects male fertility.

We raised a subset of normal-looking offspring from syce2^-/- and sycp1^-/- mothers past 5 dpf, and a substantial percentage survived into adulthood (Fig 4G). This was surprising given the severity of the synapsis defects, yet it suggested that chromosomes segregate normally at least in a subset of meiosis, that some degree of gamete aneuploidy is tolerated during development, or that aneuploid cells are preferentially removed or outcompeted by euploid cells during development to adulthood.

Sex ratios are altered in sycp1^-/- mutants but not syce2^-/- mutants

Sex determination in domesticated zebrafish is poorly understood, but it is not regulated solely by sex chromosomes [64]. Instead, all larvae (~14–20 dpf) regardless of their eventual sex produce early-stage oocytes (Stage IA) and those that produce a threshold number of oocytes continue to develop as females, while those that do not undergo oocyte apoptosis and develop as males [65]. Oocyte apoptosis in presumptive males initiates around 20–25 dpf and the gonad begins transitioning to a testis. By 30 dpf, most of the oocytes have been cleared from the gonad [66]. In addition, continuous oocyte production is required to maintain the female phenotype after sex determination [67]. Therefore, a male-biased mutant population can be indicative of a defect in oogenesis [58,68–72]. To gauge if sex ratios are altered in syce2^-/- populations, we measured the percentage of males in four different broods of each genotype. We found no significant difference in the percentage of males between syce2^-/- mutant (76.0% ± 14.8%) and wild-type (68.3% ± 6.4%) or heterozygous (66.4% ± 6.0%) populations, indicating that sufficient oocytes are present for female sex determination in the syce2^-/- mutant population (Fig 5A).

Fig 5 — (A) Percentage of animals developing as male in *syce2*^+/+, *syce2*^+/- and *syce2*^-/- genotypes from four independent experiments. Each data point indicates the percentage of males within each genotype out of total animals per brood: Blue (S4348) n= 99; Pink (S4461) = 342; Green (S4634) n = 318; Red (S4643) = 328. Significance was determined using repeated measures one-way ANOVA testing with Šidák’s multiple comparisons test; ns = not statistically significant. (B) Whole mount ovaries from 45 dpf *syce2*^+/+ *and syce2*^-/- females imaged using confocal microscopy. Ovaries are stained for DAPI (gray) and Ddx4 (green). Scale bar = 50 µm. (C) Calculated diameters of individual Stage IB oocytes from 45 dpf ovaries *syce2*^+/+ (n = 3; 118 total oocytes) and *syce2*^-/- (n = 3; 104 total oocytes). Different colors represent cells from different ovaries. Significance was determined using an unpaired t-test. ns = not statistically significant, * = p < 0.05. (D) Percentage of animals developing as male in *sycp1*^+/+, *sycp1*^+/- and *sycp1*^-/- genotypes from five independent experiments. Each data point indicates the percentage of males within each genotype out of total animals per brood: Purple (S3667) n = 183; Blue (S4297) n= 237; Red (S4347) = 112; Black (S4395) n = 167; Green (S4434) n= 382. Significance was determined using repeated measures one-way ANOVA testing with Šidák’s multiple comparisons test; ns = not statistically significant, * = p < 0.05. (E) Percent females among genotypes of progeny from a *sycp1*^-/+*; dmrt1*^+/- incross. n values are given for each genotype. (F) Number of eggs spawned by *sycp1*^+/+*; dmrt1*^-/- (n = 5) *and sycp1*^-/-*; dmrt1*^-/- (n = 2) females (left) and the percent fertilized by AB males (center). Significance was determined using an unpaired t-test. ns = not statistically significant, * = p < 0.05. Percent of normal progeny (right) at 1 and 5 dpf for each cross. (G) Whole mount ovaries from 45 dpf *sycp1*^+/+ and *sycp1*^-/- females in a *dmrt1*^-/- background stained with DAPI (gray) and Ddx4 (green). Scale bar = 50 µm. (H) Calculated diameters of individual Stage IB oocytes from two 45 dpf *sycp1*^+/+; *dmrt1*^-/- ovaries (n = 2; 81 total oocytes) and six 45 dpf *sycp1*^-/-; *dmrt1*^-/- ovaries (n = 6; 151 total oocytes). Different colors represent cells from different ovaries. Unpaired t-test; Significance was determined using an unpaired t-test. **** = p < 0.0001. (I) Percent abnormal ovaries by size by visual inspection dissected from 52 dpf fish. *sycp1*^+/+; *dmrt1*^-/- (n = 11) and *sycp1*^-/-; *dmrt1*^-/- (n = 12). (J) Ovaries from adult *syce2*^+/+ and *syce2*^-/- adult females (age = 11 months) *in situ* (left) and the gonadosomatic index of each (100 X gonad mass/total body mass) (right). N = 5 for each genotype. Unpaired t-test; ns = not statistically significant, * = p < 0.05. (K) Ovaries from *sycp1*^+/+; *dmrt1*^-/- and *sycp1*^-/-; *dmrt1*^-/- adult females (age = 13 months) as described in part J. N = 5 for each genotype. Unpaired t-test; ns = not statistically significant, * = p < 0.05. Note that the difference in ovary size from J is due to lower tank density and a greater amount of food per fish.

To test if oocytes appeared normal, we stained whole gonads from 45 dpf juveniles with an antibody to the germ cell marker Ddx4 and DAPI to visualize DNA. At this age, wild-type ovaries contain primarily Stage IA oocytes (leptotene to pachytene stages) in germline cysts with diameters ranging from ~8–20 µm and Stage IB oocytes (diplotene stage) that are surrounded by follicle cells (d = ~20–140 µm) and some Stage II oocytes (d = 140–340 µm) [73] are present. The overall morphology and distribution of the sizes of individual oocytes present in follicles was similar in syce2^+/+ and syce2^-/- mutants (Fig 5B and 5C). There were very few Stage IB oocytes undergoing apoptosis in wild-type or mutants based on lack of nuclear fragmentation or other evidence of oocyte loss pointing to female-to-male sex reversal. Thus, oocyte development appears unaffected in syce2^-/- mutant females despite severe synapsis defects.

In contrast, the sycp1^-/- mutant population exhibited a significantly higher percentage of males (84.0% ± 11.7%) compared to wild-type (41.1% ± 25.6%) and heterozygous (45.7% ± 26.8%) populations (Fig 5D). These effects show that mutation of sycp1^-/- may be impacting oogenesis, but not to the extent of sycp1^isa/isa where a complete male population was reported [56]. The sycp1 allele generated in our study encodes the first 97 amino acids of the protein compared to 408 amino acids encoded by the sycp1^isa allele [56]. While it is possible that the isa allele is disrupting meiosis in an unexpected way, chromosome spreads in both mutants show a complete absence of Sycp1 antibody staining. Given the genetic and environmental influences on zebrafish sex determination, it seems more likely that differences in animal husbandry and/or strain background (AB, this study, versus India) resulted in insufficient numbers of oocytes to support female sex determination or maintenance in the sycp1^isa/isa mutant that were analyzed in the previous study [56].

Extending the sex-determination window by mutating dmrt1 rescues the male bias of sycp1^-/- mutants

We reasoned that if the male bias of sycp1^-/- populations is due to insufficient oocyte production during the time sex is normally determined, then expanding the sex-determining window might increase the percentage of females. The sex-determining window depends on the relative timing of the initiation of meiotic prophase events and rate of apoptosis of early-stage oocytes, after which point the bipotential ovary transitions to a testis [65,68,74]. Mutation of the testis-promoting gene dmrt1 reduces the number of these apoptotic oocytes and skews sex ratios to favor female development [75]. By contrast, a male-skewed population that is the result of checkpoint-mediated apoptosis in response to synapsis defects is not expected to be reversed by extending the sex-determining window due to an alternative apoptotic pathway. Instead, checkpoint-mediated apoptosis would lead to male development due to insufficient oocytes. We found that the dmrt1 mutation dramatically increases the percentage of females in the sycp1^-/- background from 5.9% to 72.7% (Fig 5E). These results suggest that the male bias in sycp1^-/- mutants is likely due to the failure to create sufficient oocyte numbers for the determination or maintenance of the female sex in a subset of fish, rather than by oocyte loss through checkpoint-mediated apoptosis. Supporting this interpretation, we also found that sycp1^-/-; dmrt1^-/- adult females spawned similar numbers of eggs and were fertilized at similar rates as sycp1^+/+; dmrt1^-/- fish and embryo tracking shows similar decreased numbers of normal embryos similar to the sycp1^-/- single mutant (Figs 4F and 5F).

We next measured the areas of follicle oocytes in sycp1^-/-; dmrt1^-/- 45 dpf fish as described above. We reasoned that a checkpoint-mediated delay, rather than checkpoint-mediated apoptosis, might provide an extended time to complete the chromosome events of meiotic prophase resulting in smaller oocytes. If DSBs result in apoptosis, we would expect to see loss of follicle oocytes and evidence of ovaries transitioning to testis morphology. We visually inspected stained whole gonads from 45 dpf juveniles with an antibody to the germ cell marker Ddx4 and DAPI to visualize DNA. Stage IB diplotene oocytes from sycp1^-/-; dmrt1^-/- gonads were present near the edge of the ovary where Stage IA cells are located, without signs of fragmented DNA indicative of apoptotic nuclei or cells transitioning to testis (Fig 5G). This is in stark contrast to the sycp1^isa mutant where Stage IB oocytes fail to grow past 40 µm in diameter (~1300 µm²) in similarly aged animals [56]. On average, Stage IB oocytes in sycp1^-/-; dmrt1^-/- females are somewhat smaller than in the dmrt1^-/- control (Fig 5H), however, the percent of oocytes greater than 1300 µm² is similar in sycp1^-/-; dmrt1^-/- and dmrt1^-/- ovaries (81%, n = 158 and 89%, n = 100, respectively). The smaller oocyte size could be due to gonads that start transitioning to testes, but without dmrt1 revert to an ovary fate leading to female development [75]. Alternatively, cells could be transiting through prophase I somewhat slower in the sycp1^-/-; dmrt1^-/- mutant. At 52 dpf, sycp1^+/+; dmrt1^-/- and sycp1^-/-; dmrt1^-/- ovaries were dissected for chromosome spreads. All ovaries from animals carrying the mutated sycp1 allele were abnormally small (12/12) compared to those with the wild-type sycp1 allele (0/11) (Fig 5I). However, analysis of homolog pairing and synapsis in sycp1^-/-; dmrt1^-/- surface spread oocytes shows no difference in chromosome morphologies compared to sycp1^-/- oocytes (Fig 3E) and nuclei of all stages from leptotene to the P/D-like stage were recovered (S4 Fig).

In zebrafish mutants that undergo female-to-male sex reversal due to defects in oogenesis, the transition is often complete by 45–50 dpf [56,68,69,71,74]. Despite the normal fertility of sycp1^-/-; dmrt1^-/- mutants, we wondered if the adult ovaries would also be smaller than the sycp1^+/+; dmrt1^-/- control. For this we used visual inspection of adult ovaries of syce2^-/- and sycp1^+/+; dmrt1^-/- and determined the gonadosomatic index (100 x gonad mass/total animal mass) of mutant and control adult ovaries. Since GSI can account for age and feeding regimen of age matched fish [76], we controlled age-matched fish raised in the same tanks for syce2 and sycp1; dmrt1 populations, respectively. The ovaries from syce2^-/- and sycp1^-/-; dmrt1^-/- adult fish and the respective control animals from the same broods showed similar variation between individuals and the average GSIs were indistinguishable from controls (Figs 5J, 5K and S5A and S6A). These results show that while there may be some delay of follicle growth in the sycp1^-/-; dmrt1^-/- juveniles, once female fate is established, the fertility and average GSI of adult animals with severe synapsis defects is indistinguishable from controls.

Spermatogenesis is blocked in sycp1^-/- but not syce2^-/- mutants

Next, we examined testes of syce2^-/- and sycp1^-/- males to test if spermatogenesis is disrupted in these mutants. Consistent with the normal fertility of syce2^-/- males, mutant testes have prominent sperm clusters and are morphologically indistinguishable from wild-type (Fig 6A). The GSI is similar in syce2^-/- and syce2^+/+ males (Fig 6B) though there appeared to be somewhat higher asymmetry in the size of the left and right mutant testes (S4B Fig). By contrast, sycp1^-/- testes contain no sperm clusters indicating that spermatogenesis is incomplete (Fig 6C), yet there were several cysts containing irregularly shaped nuclei indicative of cells in metaphase I and metaphase II [77]. To test if these are cells in metaphase, we immunostained wild-type and sycp1^-/- testes with an antibody to the metaphase marker phospho-Histone H3 (Serine 10) [78]. We found that the irregularly shaped nuclei were positive for this marker, which accounted for ~15% of the total cyst area compared to ~4% for wild-type (Fig 6D). While sycp1^-/- testes were less opaque compared to wild-type due to lack of sperm, the GSI is similar to sycp1^+/+ testes (Figs 6E and S6B).

Fig 6 — (A) Whole mount testes from adult (> 60 dpf) *syce2*^+/+ and *syce2*^-/- males stained with DAPI (gray). Examples of primary spermatocytes (PS) and spermatozoa (SZ). Scale bar = 50 µm. (B) The gonadosomatic index of *syce2*^+/+ (n = 5) and *syce2*^-/- (n = 5) testes. Unpaired t-test; ns = not statistically significant, * = p < 0.05. (C) Whole mount testes from adult (> 60 dpf) *sycp1*^+/+ and *sycp1*^-/- males stained with DAPI (gray) and phospho-Histone H3 (pH3; red). Examples of spermatocytes in metaphase I or II (MPI/II) and spermatozoa are noted. Scale bar = 50 µm. (D) Percent of cyst area represented by phospho-histone H3 staining. Multiple image fields (n = 20) were analyzed each for wild-type *sycp1*^+/+ testes (n = 2) and *sycp1*^-/- mutant testes (n = 2). Different colors represent data from same testis. Unpaired t-test; **** = p < 0.0001. (E) The gonadosomatic index of *sycp1*^+/+ (n = 5) and *sycp1*^-/- (n = 5) testes. Unpaired t-test; ns = not statistically significant, * = p < 0.05. (F) Whole mount testes from adult (> 60 dpf) *sycp1*^+/+ (top) and *sycp1*^-/- (bottom) males stained with DAPI (gray), Ddx4 (green) and cleaved caspase-3 (magenta). Arrows represent apoptotic nuclei. Scale bar = 50 µm. (G) Percent of cyst areas including spermatogonial cells (SPG), primary spermatocytes (PS), metaphase I/II (MPI/II), secondary spermatocytes (SS), spermatids (ST), and spermatozoa (SZ). Multiple image fields (n = 20) were analyzed each for wild-type *sycp1*^+/+ testes (n = 2) and *sycp1*^-/- mutant testes (n = 2). Measurements from individual testes shown in gray or blue circles. One-way ANOVA testing with Šidák’s multiple comparisons; **** = p < 0.0001; ns = not statistically significant, * = p < 0.05. (H) Percent of cyst area with cleaved caspase-3 positive cells. Multiple image fields (n = 20) were analyzed each for wild-type *sycp1*^+/+ testes (n = 2) and *sycp1*^-/- mutant testes (n = 2). Measurements from individual testes shown in black or blue circles. Unpaired t-test; **** = p < 0.0001. (I) Proportion of distinguishable chromosome configurations (cross/bridge bivalents, pinch bivalents and univalents) among diplotene (wild-type), pachytene-like (*syce2*^-/-) and pachytene/diplotene-like (*sycp1*^-/-) chromosomes. *syce2*^+/+ (n = 82) and *syce2*^-/- (n = 198); Chi-squared test: ns = not significant, ns = p < 0.05. *sycp1*^-/- (n = 144) and *sycp1*^+/+ (n = 227); Chi-squared p < 0.0001. Data is compiled from chromosomes spreads performed over seven independent experiments.

The testis is made up of cysts where groups of cells are roughly in the same stage of spermatogenesis. We measured the relative cyst area for all germline cell types, including spermatogonial cells (SPG), primary spermatocytes (PS), metaphase I/II (MPI/II), secondary spermatocytes (SS), round spermatids (ST) and spermatozoa (SZ) and found a complete absence of round spermatids and spermatozoa (Figs 6F and 6G and S7) indicating that the primary defect in spermatogenesis in the sycp1^-/- mutant is not transit through meiosis I prophase, but instead by exiting metaphase I or metaphase II.

In mice, univalents cannot be stably oriented on the meiosis I spindle, which subsequently activates the spindle assembly checkpoint (SAC) and leads to apoptosis [79]. To test if apoptotic cells were present in the sycp1^-/- testes, we immunostained mutant and wild-type testes with an antibody to cleaved caspase-3, an indicator of apoptosis. Surprisingly, only ~1% of total cyst area was positive for this signal compared to the 15% positive for phospho-histone H3 marker, but this was significantly greater than 0.04% found in sycp1^+/+ testes (Fig 6F and 6H). While it was difficult to stage these cells, they appeared to be enriched in clusters of cells that contained cells in metaphase II (S7 Fig).

Univalents are more common in sycp1^-/- than syce2^-/- mutants

Next, we investigated whether the different reproductive outcomes in syce2^-/- and sycp1^-/- mutants could be due to the presence of univalents in sycp1^-/- mutants. We examined chromosome spreads from syce2^-/- and sycp1^-/- nuclei containing chromosomes with full-length axes and asynapsed diplotene chromosomes in wild-type spermatocytes. Because of the entangled nature of syce2^-/- and sycp1^-/- spread chromosomes, we limited our analysis to only those chromosomes where the full axes could be unambiguously traced end-to-end, which were generally on the outer edges of the spread chromosome region. We observed three types of chromosome configuration (Fig 6I): (1) bivalents in a pinched configuration, where the axes of sub-telomeric regions are co-aligned as parallel tracks but with no apparent crossing over of axes, suggestive of recombination-induced homolog co-alignment [48]; (2) bivalents with crossed or bridged axes, where axes overlap each other or appear bridged by a short stretch of Sycp3; or (3) univalents, where a full-length chromosome is found with no apparent partner. The proportion of univalents in syce2^-/- and syce2^+/+ spermatocytes was comparable (3% vs 2.4%, respectively; Fig 6I). This result suggests that short stretches of synapsed-like regions observed in syce2^-/- mutants are sufficient to promote the formation of at least one crossover between each pair of homologs. By contrast, the proportion of univalents (but not pinched) in sycp1^-/- spermatocytes was higher than in sycp1^+/+ (32.6% vs 6.3%; Fig 6C).

Less efficient DSB repair in syce2^-/- and sycp1^-/- mutants

In mice, mutations in Syce2 and Sycp1 lead to the accumulation of unrepaired DSBs [23,80]. We investigated whether there is a DSB repair defect in the analogous zebrafish mutants by examining spread spermatocyte chromosomes for the presence of Rad51, an indicator of unrepaired DSBs [81]. Although the pachytene-like and diplotene-like stages are indistinguishable in the sycp1^-/- spermatocyte spreads, we were able to identify diplotene-like spermatocytes in syce2^-/- mutants by finding nuclei in which the axes were full-length, but Sycp1 localization in synapsed-like regions is largely absent. In wild-type spermatocytes, Rad51 foci are present in leptotene (65.86 ± 30.6) and zygotene (74.53 ± 25.01) with a sharp reduction in pachytene (39 ± 16.02) and diplotene (16.86 ± 7.77) (Fig 7A and 7D). Both syce2^-/- and sycp1^-/- mutants have significantly more Rad51 foci from zygotene (109.3 ± 36.97 and 122.5 ± 32.54, respectively) to late prophase (79.86 ± 40.25, P-like; 65.5 ± 25.08, D-like; and 94.81 ± 34.43, P/D-like, respectively) (Fig 7A–D), indicative of increased DSB formation and/or less efficient DSB repair. The number of foci post-zygotene decreases in both mutants, suggesting that a fraction of DSBs are repaired (Fig 7D). Despite the synapsed-like nature of syce2^-/- homologs, there is no significant difference in Rad51 foci between syce2^-/- and sycp1^-/- mutants. We then immunostained whole sycp1^-/- mutant testes with an antibody to the DSB marker 𝛾H2AX, which allowed us to assess whether DSBs are still present in metaphase cells. We found that 𝛾H2AX is not detectable in metaphase nuclei, suggesting that despite their persistence through much of prophase I, DSBs are eventually repaired or the 𝛾H2AX marker itself is lost while DSBs persist (S8A Fig). We also immunostained whole-mount juvenile ovaries from 39 dpf sycp1^-/- mutant females. While 𝛾H2AX is observed in Stage IA oocytes that are in leptotene/zygotene as expected, 𝛾H2AX is not detectable in Stage IB oocytes that reach diplotene (S8B Fig), suggesting DSBs are repaired before oocytes enter the follicle stage.

Fig 7 — (A–C) Surface-spread chromosomes from wild-type (A), *syce2*^-/- (B) and *sycp1*^-/- (C) spermatocytes immunostained for Sycp3 (green), Sycp1 (magenta) and Rad51 (yellow). Examples of spread chromosomes from meiotic prophase I: L, EZ, LZ, P, D, P-like (*syce2*^-/-) and P/D-like(*sycp1*^-/-). D-like nuclei (*syce2*^-/-) are categorized as having full-length axes, but Sycp1 is largely absent from pseudo-synapsed regions throughout the nucleus. Scale bar = 10 µm. (D) Number of Rad51 foci per cell using data from (A–C). EZ to LZ nuclei are grouped together as zygotene (Z). Data is pooled from 2 independent experiments. n = 21, WT – L; n = 23, *syce2*^-/- – L; n = 22, *sycp1*^-/- – L; n = 34, WT – Z; n = 41, *syce2*^-/- – Z; n = 44, *sycp1*^-/- – Z; n = 22, WT – P; n = 7, WT – D; n = 21, *syce2*^-/- – P-like; n = 10, *syce2*^-/- – D-like; n = 26, *sycp1*^-/- – P/D-like. Significance was determined using ordinary one-way ANOVA testing with Šidák’s multiple comparisons test. ns = not significant; ** = p < 0.01; *** = p < 0.001; **** = p < 0.0001.

Hormad1 persists in partially synapsed syce2^-/- bivalents

In mice, DSB formation is promoted by HORMAD1, an axis-associated HORMA domain containing protein that is removed by TRIP13/Pch2 once a region has become synapsed [82]. In wild-type zebrafish, Hormad1 localization to meiotic chromosomes is transient since SC elongation immediately follows longitudinal growth of the axis. Consequently, only short stretches of Hormad1 staining are seen along asynapsed axes in spermatocytes during leptotene and zygotene [56] (Fig 8A). Hormad1 also binds to diplotene chromosomes once the synaptonemal complex is disassembled, similar to what has been observed in mice [83,84]. In syce2^-/- leptotene spermatocytes, Hormad1 localizes to asynapsed axes as seen in mouse (Fig 8B) [23]. Hormad1 persists on axial elements of partially synapsed regions in zygotene and then along full-length axes in pachytene-like syce2^-/- spermatocytes suggesting Syce2 may be required to remove Hormad1 from axes. We also found Hormad1 localization along axes in sycp1^-/- spermatocytes (Fig 8C), as was described previously for the sycp1^isa/isa mutant [56]. In mice, Hormad1 staining persists at centromeres of pachytene chromosomes, however, we saw no evidence of this localization on pachytene chromosomes in zebrafish spermatocytes. Together, these results suggest that meiotic chromosomes of syce2^-/- and sycp1^-/- spermatocytes lack an SC component that directs the removal of Hormad1.

Fig 8 — (A–C) Surface-spread chromosomes from wild-type (A), *syce2*^-/- (B) and *sycp1*^-/- (C) spermatocytes immunostained for Sycp3 (green), Sycp1 (magenta) and Hormad1 (yellow). Examples of spread chromosomes from meiotic prophase I described in Fig 7A–C. Scale bar = 10 µm. Boxes represent magnified areas for each stage. Scale bar for magnified examples = 2 µm. Arrows represent Hormad1 localization to pseudo-synapsed regions with Sycp1. (D) Violin plot showing the distance between axes for co-aligned axial pairs in early zygotene for wild-type (n = 28), *syce2*^-/- (n = 28) and *sycp1*^-/- (n = 28) spermatocytes. 4 cells from each genotype were used for the analysis. Significance was determined using ordinary one-way ANOVA testing with uncorrected Fisher’s LSD test. ** = p < 0.01; *** = p < 0.001; **** = p < 0.0001.

Given the similarities in Hormad1 localization, DSB repair inefficiency and sub-telomeric co-alignment in syce2^-/- and sycp1^-/- mutants, we investigated whether the interaxis distance in the sub-telomeric region is also similar. Since the distance between axes can vary in spreads done on different days, we prepared a set of chromosome spreads from wild-type, syce2^-/- and sycp1^-/- spermatocytes from fish born and raised together. We focused our analysis on early- to mid-zygotene chromosomes when entanglement of chromosome axes is infrequent and found that the interaxis distance in syce2^-/- spermatocytes (0.266 ± 0.049) is intermediate between wild-type (0.224 ± 0.019) and sycp1^-/- (0.387 ± 0.062) (Fig 8D). These results suggest that Sycp1 contributes to close alignment of homologs even in the absence of a key central element protein.

Discussion

Our study supports four main conclusions. First, SC components Syce2 and Sycp1 are required for full synapsis and efficient DSB repair during zebrafish meiosis. Second, the severity of meiotic disruption differs between the two mutants: Both syce2^-/- females and males are fertile, while sycp1^-/- females are fertile but produce more malformed progeny and males fail to produce sperm. Third, synapsis defects in these mutants do not appear to trigger a robust surveillance mechanism that blocks progression through meiotic prophase I. Fourth, maternal SC mutations cause embryonic genome instability, as shown by somatic mosaic aneuploidy in progeny.

Our finding that chromosome ends are co-aligned while in the bouquet in sycp1^-/- mutants is consistent with previous findings [56]. When the axes reach full length, the majority of co-alignment is disrupted, but not more or less than what is seen for desynapsed bivalents of wild-type diplotene chromosomes. If co-alignment in leptotene nuclei is mediated by recombination intermediates [48], then these appear to be resolved in the mutant by the time the axes achieve their full length. Crossed axes are evidence that crossing over has occurred, suggesting that sycp1^-/- spermatocytes have reached the diplotene-like stage of prophase, however, a significant increase in univalents is observed suggesting that at least a subset of recombination intermediates are repaired as noncrossovers [56]. A similar progression is seen in syce2^-/- mutants except that in the intervening period between zygotene and pachytene stages, short stretches of synaptonemal complex have formed and then disassembled. In both mutants, Hormad1 protein is bound along the lengths of axes from throughout prophase I. These events are summarized in S9 Fig. It appears that crossing over may be more efficient in the syce2^-/- mutant since fewer univalent are observed in chromosome spreads. Nonetheless, a high degree of somatic mosaic aneuploidy is seen in both normal and malformed embryos within 24 hours suggesting gamete aneuploidy. The presence of univalents in the sycp1^-/- mutant may account for the high percentage of malformed progeny of females and also male sterility.

We found that syce2^-/- and sycp1^-/- females produce normal numbers of fertile eggs and some progeny that can live to adulthood despite extensive asynapsis and inefficient DSB repair during meiotic prophase I. This is in striking contrast to what is seen in mice, where Sycp1 mutant females along with other central element mutants exhibiting synapsis defects are infertile and oocytes undergo apoptosis before reaching the follicle stage in diplotene [80,85–87]. Though, Sycp2^-/- and Sycp3^-/- female mice with interrupted synapsis due to defects in axial element structures are sub-fertile and produce aneuploid oocytes [88,89]. Ovaries of 45 dpf zebrafish from syce2^-/- and sycp1^-/- females contain large numbers of Stage IB oocytes at the follicle stage with no evidence of loss or apoptotic bodies or any loss of oocytes that are characteristics of female-to-male sex reversal at this age. The gonadosomatic indices of adult syce2^-/-and sycp1^-/- females are similar to controls. Together, these results suggest that zebrafish females tolerate asynapsis and are fertile whereas in mice asynapsis leads to checkpoint-mediated apoptosis and infertility. Instead, an apparently weaker, or absent, surveillance system monitoring synapsis defects in zebrafish appears to be more similar to budding yeast, Drosophila, and Arabidopsis, which form meiotic spores or gametes despite extensive asynapsis [30,90]. While we cannot rule out that a subset of oocytes are undergoing checkpoint-mediated apoptosis during the leptotene to pachytene stages as seen in C. elegans [36], zebrafish females do not display reduced egg-laying capacity observed in syp-1 null mutant worms [38,39]. We also cannot entirely rule out that syce2^-/- and sycp1^-/- zebrafish mutants lack a synapsis checkpoint-inducing signal as we posited for the spo11^-/-mutant that lacks meiotically induced DSBs and synapsis [48]. Though we think it unlikely, we also cannot rule out that the syce2^-/- mutant produces a nonconserved 88 amino acid protein fragment that interferes with a potential checkpoint activity.

In mice, prophase I arrest in response to unrepaired DSBs or asynapsis is coupled to a cellular program leading to meiotic silencing of unpaired chromatin (MSUC) [91–93]. MSUC is a process related to meiotic sex chromosome inactivation (MSCI) that silences unpaired regions of sex chromosomes in the heterogametic sex to evade checkpoint activation [91,92,94]. Similarly, the unpaired X chromosome in C. elegans is also transcriptionally silenced to evade checkpoint signaling in the male germline [95–98]. Evidence of MSUC or MCSI has not been described in fish species, though self-pairing of folded supernumerary B chromosomes and nonhomologous synapsis of sex chromosomes may play a role in circumventing a MSUC activation [99–101]. However, evidence of both male and female heterogamety (e.g., XY and ZW) implies switching from one system to another in the teleost lineage (e.g., genera Oryzias [102] and Xiphophorus [103]) suggesting asynapsis may be more generally tolerated. In zebrafish, fertile triploid females can be generated in a cntd1 mutant background, suggesting the presence of 25 unpaired chromosomes does not inhibit female development.

Teleosts make up the most species-rich clade among vertebrates with over 30,000 species [104]. Accommodation of asynapsis in this lineage could be a vestige of the whole genome duplication event that occurred 320–350 million years ago giving rise to a common polyploid ancestor [105]. Moreover, more recent genome doubling (autoploidy) and hybridization between different species (allopolyploidy) is common among fish species [106]. Polyploidy could create challenges for meiotic homolog pairing and recombination and these challenges might be better tolerated without a stringent checkpoint response to asynapsis [107]. Polyploidy and whole genome duplication have occurred multiple times in plants, often contributing to speciation [108]. Polyploidization across plant species is often attributed to relaxed meiotic checkpoints [107]. Arabidopsis mutants with asynapsis and unrepaired DSBs complete meiosis, suggesting a weak synapsis and/or recombination checkpoint [109]. Though, at elevated temperatures a specialized variation of the prophase I checkpoint appears to exist in Arabidopsis [110]. Among non-mammalian vertebrate species, polyploidy is most common in amphibians and fishes, [111] but no undisputed evidence of a mammalian polyploid species exists [112]. It has also been suggested that reduced checkpoint stringency could favor animal taxa that produce large numbers of progeny in fresh water conditions where fertilization occurs outside of the body [113,114].

All zebrafish lacking germ cells develop as males and have testes [115]. Several zebrafish mutants with defects in meiotic processes develop solely as males, including those with mutations in chromosome axis genes sycp2 [70] and sycp3 [74], the meiosis-specific cohesin subunits smc1b (ortholog of human SMC1β) [116] and rad21l1 (ortholog of human RAD21L) [71], and the DSB repair genes brca2 [69,72], rad51 [117] and fancl [68] and other Fanconi anemia genes [58] exhibiting a range of phenotypes from shortened axial structures, reduced DSB formation, unrepaired DSBs, and asynapsis. The lack of females is partially rescued in sycp3, rad21l1, brca2, rad51, and fancl mutants by reducing TP53-mediated apoptosis [68,69,71,72,74,117] consistent with observations in mice indicating that the TP53 ortholog is involved in eliminating cells with unrepaired DSBs [118]. While we did not directly examine the role of the TP53 ortholog, our findings are not consistent with significant oocyte removal by checkpoint-mediated apoptosis in the mutants examined in this study since increasing the window of sex determination allows for the vast majority of sycp1^-/-; dmrt1^-/- juveniles to achieve female-sex fate and grow to be fertile adults. The alternative outcome was not observed, where checkpoint-mediated apoptosis causes sycp1^-/-; dmrt1^-/- animals to develop as infertile males. We predict that mutating dmrt1 and prolonging the sex determination window would also suppress female-to-male sex reversal phenotype of the sycp1^isa/isa mutant, and possibly other zebrafish mutants, including fancl and rad21l1 mutants that have been shown to produce Stage IB oocytes before undergoing female-to-male sex reversal [56,68,71]. The smaller oocytes seen in sycp1^-/-; dmrt1^-/- double mutants compared to dmrt1^-/- single mutants may indicate that progression through early meiotic prophase I (e.g., leptotene through pachytene) is slower in the absence of sycp1, perhaps due to slower pairing kinetics, removal of entanglements, or delayed DSB repair that might transiently activate a DNA repair checkpoint that functions during prophase I. While chromosome spreads of double mutant oocytes show all stages of meiotic prophase I f(leptotene through pachytene/diplotene-like stages), our experiments do not rule out that at least a subset of cells in early prophase I are undergoing checkpoint-mediated apoptosis. Notably, we see a similar progression through the chromosome events of prophase I in males and no evidence of prophase I checkpoint-mediated apoptosis by cleaved-caspase 3 staining in primary spermatocytes.

The dramatic increase in metaphase spermatocytes in sycp1^-/- mutant males suggests that cells can transit prophase I in the absence of synapsis but the increased level of univalents, or perhaps chromosome entanglements, are causing cells to arrest in MI or in some cases MII. Zebrafish cntd1 and mlh1 mutant spermatocytes reach the pachytene stage with fully synapsed chromosomes but are defective in forming crossovers. In these cases, spermatocytes arrest at metaphase I, triggering apoptosis [119,120], possibly mediated by the spindle assembly checkpoint (SAC). Other evidence for the activation of the SAC during zebrafish spermatogenesis comes from studies showing metaphase arrest and apoptosis in testes treated with nocodazole at an elevated temperature; in this case, apoptosis is suppressed by mutation of the SAC checkpoint kinase gene mps1 (ttk) [121]. Interestingly though, we found that only about 1% of the total cyst area measured in sycp1^-/- testes was positive for the apoptotic marker cleaved caspase 3 despite ~15% of cells being arrested in metaphase I or II. It is possible that there is an insufficient number of univalents in the majority of metaphase I cells to activate the SAC in sycp1^-/- mutants and instead, spermatogenesis is blocked by a SAC-independent mechanism.

Finally, one aspect of our work that was surprising was the high degree of somatic mosaic aneuploidy observed among cells of individual embryos of syce2^-/- and sycp1^-/- mothers. These events suggest that zebrafish can tolerate high levels of aneuploidy during early development and also suggests that errors in meiosis can promote genome instability in progeny.

Materials and methods

Ethics statement

The University of California Davis Institutional Animal Care and Use Committee (IACUC) has approved of this work under the protocol #23636. For noninvasive procedures (e.g., fin clips for genotyping), zebrafish were anesthetized using tricaine. Invasive surgical methods were performed on fish euthanized by submerging fish in ice water.

Zebrafish husbandry

Zebrafish husbandry was performed as previously described [122] with the following modifications. At 5 days post fertilization (dpf), zebrafish larvae were placed into 1 L aquaria at 40 fish/tank. At 5–10 dpf larvae were fed ~ 3 mL rotifers ad libitum. From 10–14 dpf larvae were fed 3 mL rotifers ad libitum and 1 drop concentrated brine shrimp twice daily. From 14–23 dpf, larvae were fed 2 drops concentrated brine shrimp twice daily. From 23–30 dpf, larvae were fed 3 drops concentrated brine shrimp twice daily. At 30 dpf, juvenile fish were moved to 9 L tanks continuous system water flow and no more than 40 fish. From 30–60 dpf, juveniles were fed ~ 500 µL concentrated brine shrimp and 100 mg Gemma Micro 300 twice daily. Starting at 60 dpf, fish were fed 100 mg Zebrafish Select Diet twice daily.

Mutant generation and identification

The wild-type AB strain was used to generate the syce2^-/- and sycp1^-/- mutants. All fish used in the experiments were outcrossed to the AB strain. The syce2^-/- and sycp1^-/- mutants were generated with CRISPR-Cas9 using the CRISPR Design Tool (Synthego, Redwood City, CA, USA). gRNA target sequences: 5’ UUCACCAGCCAACAAUACAG 3’ (syce2, exon 4) and 5’ CGAGCAGUUUGGAGUACAGC 3’ (sycp1, exon 5). One-cell embryos were injected with 300 ng/µL gRNA, 2µM Cas9-NLS purified protein (MacroLab, University of California, Berkeley), and phenol red (5% in 2M KCl). Injected founder fish were raised to adulthood and outcrossed to wild-type fish. Genomic DNA was extracted from the caudal fin of resulting offspring to screen for mutations via High Resolution Melt Analysis (HRMA) [48]. syce2 HRMA primers: forward 5’-TGATGATTCAGGAATTGGTGTT-3’; reverse 5’-CATCTATTGGTGAATTGTTTGGAG-3’. sycp1 HRMA primers: forward 5’-GGAGCTTTTTGTTGTTGTTGCAT-3’; reverse 5’-ATCGGTTCTGAACTTCCAGAGT 3’. Mutations were identified in offspring of syce2 injected fish using PolyPeak Parser [123] after Sanger Sequencing of PCR products amplified by Phusion DNA polymerase (New England Biolabs catalog #M0530L). Mutations were confirmed by sequencing PCR products from homozygous mutants. PCR primers: forward 5’-ACCATTTCGTTTCTTGTGTCAGT-3’; reverse 5’-ACACGTTTTACTAATCTGCCTGT-3’. Mutations were identified in offspring of sycp1 injected fish using PCR products amplified by Phusion DNA polymerase and cloned into the pCR Blunt II-TOPO vector (Invitrogen catalog #450245). sycp1 PCR primers: forward 5’-GCCAATGGAAAAGGAAGAGGTC-3’; reverse 5’-TGCTTAGACTTTCATTTGCGAACT-3’. The dmrt1 mutation was generated as previously described [75].

Genotyping

syce2 and sycp1 fish were genotyped using the HRMA primers above. dmrt1 HRMA primers (BWD934 and BWD935) are reported elsewhere [75].

Protein alignment

Protein alignments were done using the Clustal Omega multiple sequence alignment tool [124] using protein sequences from the UniProtKB database for zebrafish, human, and mouse Syce2 orthologs (Q56P19, Q6PIF2 and Q505B8, respectively) and Sycp1 orthologs (F1QYS1, Q15431 and Q62209, respectively).

RT-PCR

Total RNA extraction from individual testes was performed as previously described [71]. Total RNA extraction from individual adult (> 60 dpf) testes was performed as previously described with the following modification: upon liquid phase separation 70 µL of the top, clear aqueous solution was purified using the RNA Clean and Concentrator-5 Kit (Zymo Research catalog #R1015). syce2 RT-PCR primers: forward 5’-CATACATCAGCAAAGGTGCCAG-3’; reverse 5’-CACCAAAAGGTTCCAGGGCT-3’. sycp1 RT-PCR primers: forward 5’-CGTCGAGAAGCTTTGGTGACT-3’; 5’-TGCCACCATCCTCTGAACAT-3’. eef1a1l1 (control) RT-PCR primers: forward 5’-CTACCTACCCTCCTCTTGGTCG-3’; reverse 5’-CCTTAAGTAGAGTGCCCAGGT-3’.

Sex ratios

The sex of adult zebrafish (> 60 dpf) was determined by the absence or presence of an ovipositor found only in females. For juvenile animals between ~45–52 dpf, the sex was determined by the presence of Stage IB oocytes in the follicle stage.

Chromosome spread preparation and staining

Four to seven testes from adult males (> 60 dpf) were dissected and prepared as previously described in [48] with minor modifications in reagents used: Trypsin inhibitor (Sigma-Aldrich, catalog #T9253); Paraformaldehyde (ThermoFisher, catalog # 28908). Five to fifteen ovaries were dissected from juvenile females (46–52 dpf) and prepared as previously described [48].

PNA telomere probe and primary and secondary antibody staining was performed as previously described [48]. PNA Telomere probe used: TelC-Alexa647 (PNA Bio Inc, catalog #F1013). Primary antibodies used: 1:200 rabbit anti-Sycp3 (Abcam, catalog #ab150292, discontinued); 1:200 rabbit anti-Sycp3 (Novus Biologicals, catalog #NB300232); 1:100 chicken anti-Sycp1 [48]; 1:100 mouse anti-Rad51 (ThermoFisher catalog# MA5–14419, discontinued); 1:100 mouse anti-Hormad1 [56]. Our attempts to probe for crossovers in wild-type meiotic nuclei with commercially available and a custom made anti-Mlh1 antibody were unsuccessful. Secondary antibodies used at 1:1000: goat anti-rabbit IgG Alexa Fluor 488 (ThermoFisher, catalog #A-11008); goat anti-chicken IgY Alexa Fluor 568 (ThermoFisher, catalog #A-11041); goat anti-chicken IgY Alexa Fluor 594 (ThermoFisher, catalog #A-11042); goat anti-mouse IgG Alexa Fluor 647 (ThermoFisher, catalog #A-21236). Slides not stained for telomeres were rehydrated in ~500 µL 1X PBS and then proceeded to primary antibody staining. Slides were mounted with Prolong diamond antifade mountant with DAPI (ThermoFisher, catalog #P36966), Prolong diamond antifade mountant (ThermoFisher, catalog #P36970) or Prolong glass antifade mountant with NucBlue (ThermoFisher, catalog #P36985).

Whole mount gonad and staining

Adult testes (> 60 dpf) were dissected and stained as previously described [48]. Juvenile ovaries (39–52 dpf) were dissected and stained similarly to adult testes. Primary antibodies used: 1:2000 chicken anti-Ddx4 [48]; 1:200 mouse anti-pH3 (Abcam, catalog #ab14955); 1:100 rabbit anti-𝛾H2AX [125]; 1:200 rabbit anti-𝛾H2AX (GeneTex, GTX127342) rabbit anti-cleaved Caspase-3 (Asp175) (Cell Signaling Technology, catalog #9661S). Secondary antibodies used at 1:300: goat anti-chicken IgY Alexa Fluor 488 (ThermoFisher, catalog #A-11039); goat anti-mouse IgG Alexa Fluor 594 (ThermoFisher, catalog #A-11032); goat anti-rabbit IgG Alexa Fluor 594 (ThermoFisher, catalog #A-11012).

Metaphase spreads

Embryos at ~19–32 hours post fertilization were manually dechorionated and prepared according to [126] with the following modifications: Embryos were incubated in colchicine for 2 hours 15 minutes. The yolk was removed within 16 minutes followed by incubating on ice for 16 minutes. Embryos were mechanically homogenized for 3 minutes in 50 μL of fixative solution followed by brief centrifugation for 1 minute. Instead of pre-equilibrating slides to 4 ºC, slides were held face down immediately above a 55°C water bath for 15–20 seconds. The entire cell suspension from one embryo was then dropped onto the center of the slide held at a 30–45° angle to allow the cell suspension to spread. The slide was held face down above a 55°C water bath for 15–20 seconds, air dried for 2 minutes, passed back and forth over a flame 5 times and washed in a coplin jar with 1X PBS for 5 minutes. Slides were air dried or excess PBS was removed with a nasal aspirator to facilitate drying. Slides were stained with Vectashield antifade mounting medium with DAPI (Vector Laboratories, catalog #H-1200) and covered with a glass coverslip.

Imaging

Images of stained meiotic chromosomes and gonads were collected at the Department of Molecular and Cellular Biology Light Microscopy Imaging Facility at UC Davis. Chromosomes spreads were imaged using the Nikon N-SIM Super-Resolution microscope in 3D-SIM imaging mode with APO TIRF 100X oil lens. Images were collected and reconstructed using the NIS-Elements Imaging Software. Gonads were imaged using the Zeiss 980 Laser Scanning Microscope with Airyscan using LMS confocal. Gonads immunostained for 𝛾H2AX were imaged using the Olympus FV1000 laser scanning confocal microscope. Images of metaphase chromosomes were collected on a Zeiss MetaSystems Imager Z2 microscope 63X lens with MetaFer 5.

Cleaved caspase-3 and phospho-histone H3 staining in testes was imaged using Andor BC43 CF spinning disk confocal microscope. All images were processed using Fiji ImageJ software. Only linear modifications to brightness and contrast of whole images were applied.

Quantification of mean synapsed length and Sycp1 fluorescence intensity

Mean synapsed lengths per cell were determined by tracing stretches of Sycp1 lines using the segmented line tool in ImageJ. Since Sycp1 staining is often discontinuous between co-aligned axes in syce2 mutants, we included regions where co-aligned axes were in a partially synapsed-like configuration (i.e., separated by ~0.2 µm). To calculate the mean fluorescence intensity of Sycp1 signal per cell, we subtracted a mean fluorescence intensity of six boxes taken from the background region of each spread from the mean fluorescence intensity of each scanned Sycp1 segment from the same spread. The average of the adjusted means for each nucleus was normalized to the value calculated from the wild-type EZ spreads to get the relative levels for mutant and wild-type at each stage.

Interaxis distance

The interaxis distance was measured by drawing a line perpendicular to parallel co-aligned axes in ImageJ to generate kymographs. We identified the maximum intensity signals from the kymographs to determine x-values of the two highest peaks. The x-values were subtracted to calculate the interaxis distance.

Number of co-aligned sub-telomeric regions

Axes were considered co-aligned if parallel regions of the axes were separated by less than 0.5 µm. In wild-type spermatocytes, synapsed regions were included as co-aligned. Slightly misaligned axes in otherwise parallel axes were considered as co-aligned since the orientation of the chromosomes may shift when the 3D nucleus is flattened to 2D. Axes that were perpendicular to each other but had no other parallel region between them were not considered co-aligned. All instances of co-aligned axes of asynapsed chromosomes ends were assessed independently since the high levels of chromosome entanglement in the sycp1^-/- mutant made it difficult to assess if one or both ends were co-aligned.

Fertility testing and embryo tracking

To analyze fertility, individual mutant fish were placed in a divided mating tank overnight with one or two AB wild-type fish of the opposite sex. The divider was removed soon after the onset of light, and any eggs produced were collected with a strainer and categorized as fertilized, unfertilized or decomposed. Fertilized eggs were placed in a petri dish at 28–30 °C with embryo media and monitored at 1 and 5 dpf for malformities.

Oocyte area

The segmented line tool of ImageJ was used to trace an outline of individual diplotene oocytes in single optical sections in intact gonads imaged using the Zeiss 980 Laser Scanning Microscope. Ovaries were imaged with one edge in the field of view for comparison between images. The area is determined by the number of pixels bound by the perimeter and the pixel density of the image.

Caspase and metaphase area

Cells showing cleaved Caspase-3 or phospho-Histone H3 signal were traced using the ImageJ freehand selection tool and their areas were measured. The relative areas were calculated by taking (area of cells with signal/total area of meiotic cells) x 100%. Cells were staged according to [77]. For S7 Fig four images were stitched using the Grid/Collection stitching plugin in ImageJ [127].

Gonadosomatic index

Whole fish and dissected gonads were weighed and the gonadosomatic index was calculated by taking (gonad weight/whole fish weight) x 100%. Fish were not fed the morning of the analysis.

Statistics

All statistical analyses were performed using GraphPad Prism 10. Statistical tests are reported in the figure legends. Comparisons between controls and mutants for individual experiments were done using fish born on the same day.

Supporting information

S1 Fig. Targeted mutation of syce2 and sycp1 via CRISPR/Cas9.

(A) Creation of the syce2 mutation by CRISPR/Cas9 showing a 2 nucleotide (nt) deletion within exon 4 (out of 5). The CRISPR target site (green) and premature stop codon (yellow) are shown. (B) Creation of the sycp1 mutation by CRISPR-Cas9 showing the site of the mutation within exon 5 (out of 32). The CRISPR target site (green), premature stop codon (yellow) and the complex mutation (orange) are shown. The complex mutation leads to a net increase of 22 nt. (C–D) RT-PCR from wild-type, syce2^-/- and sycp1^-/- testes. Two biological samples were used for each genotype. -RT = no reverse transcriptase. eef1a1l1 is the positive control. (D) Note the slower migration in the sycp1^-/- samples due to the complex mutation with a net increase of 22 nt.

(PDF)

pgen.1011656.s001.pdf^{(312.7KB, pdf)}

S2 Fig. EZ and LZ stages from syce2^+/+ and syce2^-/- spermatocytes.

Magnified images from EZ and LZ stages from Fig 2A and 2B.

(PDF)

pgen.1011656.s002.pdf^{(1.8MB, pdf)}

S3 Fig. Identification of wild-type diplotene spermatocytes.

Examples of diplotene spermatocytes from sycp1^+/+ males stained for Sycp3 (green), Sycp1 (magenta and gray) and Telomeres (cyan). Spermatocytes were classified as diplotene if they contained three or more bivalents with 50% or more desynapsis. Arrows point to examples of desynapsed sub-telomeric regions that were analyzed for co-alignment (< 0.5 µm). Scale bar = 10 µm.

(PDF)

pgen.1011656.s003.pdf^{(6.1MB, pdf)}

S4 Fig. dmrt1 mutation does not affect chromosome co-alignment.

(A–B) Surface-spread chromosomes from sycp1^+/+; dmrt1^-/- (A) and sycp1^-/-; dmrt1^-/- (B) oocytes stained for Sycp3 (green) and Sycp1 (magenta and gray). Examples of spread chromosomes from meiotic prophase described in Fig 3 A–B. Scale bar = 10 µm.

(PDF)

pgen.1011656.s004.pdf^{(9.3MB, pdf)}

S5 Fig. Ovaries and testes from syce2^+/+ and syce2^-/- animals.

Brightfield images of ovaries (A) and testes (B) in situ that were used to calculate the gonadosomatic index (GSI) for each sex.

(PDF)

pgen.1011656.s005.pdf^{(7.8MB, pdf)}

S6 Fig. Ovaries and testes from sycp1^+/+ and sycp1^-/- animals.

Brightfield images of ovaries (A) and testes (B) in situ that were used to calculate the gonadosomatic index (GSI) for each sex. Graphs are the same as in Fig S5.

(PDF)

pgen.1011656.s006.pdf^{(9.1MB, pdf)}

S7 Fig. Cleaved caspase-3 positive cells in a sycp1^-/- testis.

Four stitched images showing the germ cell landscape of a sycp1^-/- testis with examples of cleaved Caspase-3 stained cells (arrows). (A) Testis region stained with DAPI (cyan), cleaved Caspase-3 (magenta), and Ddx4 (green). Patches of cells in metaphase I or metaphase II outlined in yellow. A subset of cells in the outlined regions are positive for cleaved Caspase-3 staining. (B) Larger field image showing the location of the cells in the testis in part A. (C) Same panel as in part B showing DAPI (gray). (D) Same panel as in part B showing cleaved Caspase-3 (magenta). (E) Same panel as part B showing Ddx4 (green).

(PDF)

pgen.1011656.s007.pdf^{(9.2MB, pdf)}

S8 Fig. yH2AX staining in sycp1^-/- testes and oocytes.

(A) Whole mount testes from adult (> 60 dpf) sycp1^+/+ and sycp1^-/- males stained with DAPI (gray) and 𝛾H2AX (green). Dashed lines represent metaphase nuclei. Scale bar = 50 µm. (B) Whole mount ovaries from 39 dpf sycp1^+/+ and sycp1^-/- females stained with DAPI (gray) and 𝛾H2AX (green). Examples of Stage IA oocytes (leptotene/zygotene stage) and Stage IB oocytes are indicated by blue lines. Scale bar = 50 µm.

(PDF)

pgen.1011656.s008.pdf^{(5.9MB, pdf)}

S9 Fig. Model of chromosome events during meiotic prophase.

(A–C) Temporal progression of chromosome axis formation, DSB repair, Hormad1 localization, synapsis and homolog juxtaposition. (A) In wild-type zebrafish, DSBs form in early meiotic prophase I and are gradually repaired. Hormad1 localizes to asynapsed regions and is displaced upon synapsis. As synapsis progresses, homologs are “zippered up”. (B) In syce2^-/- mutants, there is partial recruitment of Sycp1 to synapsed-like regions and unaligned axes. Hormad1 localizes along the entire length of chromosomes. DSBs form but repair is less efficient. Without a fully formed SC, chromosome co-alignment is limited to sub-telomeric regions. (C) In sycp1^-/- mutants where there is no synapsis, Hormad1 localizes along entire axes and DSB repair is less efficient. Chromosome co-alignment is also limited to sub-telomeric regions. Not shown are other central element components: Syce1, Syce3, Six6os1, and Tex12 (forms a complex with Syce2).

(PDF)

pgen.1011656.s009.pdf^{(354.8KB, pdf)}

S1 File. Master data table with graph values.

(XLSX)

pgen.1011656.s010.xlsx^{(110.8KB, xlsx)}

Acknowledgments

We thank Kelly Komachi, Nancy Hollingsworth, JoAnne Engebrecht, and Satoshi Namekawa for discussions and comments on the manuscript. The Hormad1 antibody was a gift from Yukiko Imai and Norioshi Sakai from the National Institute of Genetics, Mishima Japan.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by grants from the National Institutes of General Medical Sciences (https://www.nigms.nih.gov/); 5R35GM145244 to S.M.B. and GM116690 National Institutes of General Medical Sciences Postbaccalaureate Research Education Program (PREP) to I.O. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Mann U, Shiff B, Patel P. Reasons for worldwide decline in male fertility. Curr Opin Urol. 2020;30(3):296–301. doi: 10.1097/MOU.0000000000000745 [DOI] [PubMed] [Google Scholar]
2.Maor-Sagie E, Cinnamon Y, Yaacov B, Shaag A, Goldsmidt H, Zenvirt S, et al. Deleterious mutation in SYCE1 is associated with non-obstructive azoospermia. J Assist Reprod Genet. 2015;32(6):887–91. doi: 10.1007/s10815-015-0445-y [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Nabi S, Askari M, Rezaei-Gazik M, Salehi N, Almadani N, Tahamtani Y. A rare frameshift mutation in SYCP1 is associated with human male infertility. Mol Hum Reprod. 2022;28:gaac009. [DOI] [PubMed] [Google Scholar]
4.Pashaei M, Rahimi Bidgoli MM, Zare-Abdollahi D, Najmabadi H, Haji-Seyed-Javadi R, Fatehi F, et al. The second mutation of SYCE1 gene associated with autosomal recessive nonobstructive azoospermia. J Assist Reprod Genet. 2020;37(2):451–8. doi: 10.1007/s10815-019-01660-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.García-Martínez OI, Geisinger A, de Los Santos E, Santiñaque FF, Folle GA, Pórfido JL, et al. Mouse modeling of familial human SYCE1 c.197-2A>G splice site mutation leads to meiotic recombination failure and non-obstructive azoospermia. Mol Hum Reprod. 2025;31(1):gaaf002. doi: 10.1093/molehr/gaaf002 [DOI] [PubMed] [Google Scholar]
6.Steinthorsdottir V, Halldorsson BV, Jonsson H, Palsson G, Oddsson A, Westergaard D, et al. Variant in the synaptonemal complex protein SYCE2 associates with pregnancy loss through effect on recombination. Nat Struct Mol Biol. 2024;31(4):710–6. doi: 10.1038/s41594-023-01209-y [DOI] [PMC free article] [PubMed] [Google Scholar]
7.De Vries L, Behar DM, Smirin-Yosef P, Lagovsky I, Tzur S, Basel-Vanagaite L. Exome Sequencing Reveals SYCE1 Mutation Associated With Autosomal Recessive Primary Ovarian Insufficiency. J Clin Endocrinol Metab. 2014;99:E2129–32. [DOI] [PubMed] [Google Scholar]
8.Zhe J, Ye D, Chen X, Liu Y, Zhou X, Li Y, et al. Consanguineous Chinese Familial Study Reveals that a Gross Deletion that Includes the SYCE1 Gene Region Is Associated with Premature Ovarian Insufficiency. Reprod Sci. 2020;27(2):461–7. doi: 10.1007/s43032-019-00037-0 [DOI] [PubMed] [Google Scholar]
9.Zhang F, Liu M, Gao J. Alterations in synaptonemal complex coding genes and human infertility. Int J Biol Sci. 2022;18(5):1933–43. doi: 10.7150/ijbs.67843 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Bergerat A, de Massy B, Gadelle D, Varoutas PC, Nicolas A, Forterre P. An atypical topoisomerase II from Archaea with implications for meiotic recombination. Nature. 1997;386(6623):414–7. doi: 10.1038/386414a0 [DOI] [PubMed] [Google Scholar]
11.Keeney S, Giroux CN, Kleckner N. Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell. 1997;88(3):375–84. doi: 10.1016/s0092-8674(00)81876-0 [DOI] [PubMed] [Google Scholar]
12.Shinohara M, Oh SD, Hunter N, Shinohara A. Crossover assurance and crossover interference are distinctly regulated by the ZMM proteins during yeast meiosis. Nat Genet. 2008;40(3):299–309. doi: 10.1038/ng.83 [DOI] [PubMed] [Google Scholar]
13.Martini E, Diaz RL, Hunter N, Keeney S. Crossover homeostasis in yeast meiosis. Cell. 2006;126:285–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Joshi N, Barot A, Jamison C, Börner GV. Pch2 links chromosome axis remodeling at future crossover sites and crossover distribution during yeast meiosis. PLoS Genet. 2009;5(7):e1000557. doi: 10.1371/journal.pgen.1000557 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Sym M, Roeder GS. Crossover interference is abolished in the absence of a synaptonemal complex protein. Cell. 1994;79(2):283–92. doi: 10.1016/0092-8674(94)90197-x [DOI] [PubMed] [Google Scholar]
16.Rosu S, Libuda DE, Villeneuve AM. Robust crossover assurance and regulated interhomolog access maintain meiotic crossover number. Science. 2011;334(6060):1286–9. doi: 10.1126/science.1212424 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Zakharyevich K, Tang S, Ma Y, Hunter N. Delineation of joint molecule resolution pathways in meiosis identifies a crossover-specific resolvase. Cell. 2012;149:334–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Lynn A, Soucek R, Börner GV. ZMM proteins during meiosis: crossover artists at work. Chromosome Res. 2007;15(5):591–605. doi: 10.1007/s10577-007-1150-1 [DOI] [PubMed] [Google Scholar]
19.Pazhayam NM, Turcotte CA, Sekelsky J. Meiotic Crossover Patterning. Frontiers in Cell and Developmental Biology. 2021;9:681123. doi: 10.3389/fcell.2021.681123 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.von Wettstein D, Rasmussen SW, Holm PB. The synaptonemal complex in genetic segregation. Annu Rev Genet. 1984;18:331–413. doi: 10.1146/annurev.ge.18.120184.001555 [DOI] [PubMed] [Google Scholar]
21.Adams IR, Davies OR. Meiotic Chromosome Structure, the Synaptonemal Complex, and Infertility. Annu Rev Genomics Hum Genet. 2023;24:35–61. doi: 10.1146/annurev-genom-110122-090239 [DOI] [PubMed] [Google Scholar]
22.Cahoon CK, Hawley RS. Regulating the construction and demolition of the synaptonemal complex. Nat Struct Mol Biol. 2016;23(5):369–77. doi: 10.1038/nsmb.3208 [DOI] [PubMed] [Google Scholar]
23.Bolcun-Filas E, Costa Y, Speed R, Taggart M, Benavente R, De Rooij DG, et al. SYCE2 is required for synaptonemal complex assembly, double strand break repair, and homologous recombination. J Cell Biol. 2007;176(6):741–7. doi: 10.1083/jcb.200610027 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Davies OR, Maman JD, Pellegrini L. Structural analysis of the human SYCE2-TEX12 complex provides molecular insights into synaptonemal complex assembly. Open Biol. 2012;2(7):120099. doi: 10.1098/rsob.120099 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Dunce JM, Dunne OM, Ratcliff M, Millán C, Madgwick S, Usón I. Structural basis of meiotic chromosome synapsis through SYCP1 self-assembly. Nature Structural & Molecular Biology. 2018;25:557–69. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Dunce JM, Salmon LJ, Davies OR. Structural basis of meiotic chromosome synaptic elongation through hierarchical fibrous assembly of SYCE2-TEX12. Nat Struct Mol Biol. 2021;28(8):681–93. doi: 10.1038/s41594-021-00636-z [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Hamer G, Wang H, Bolcun-Filas E, Cooke HJ, Benavente R, Höög C. Progression of meiotic recombination requires structural maturation of the central element of the synaptonemal complex. J Cell Sci. 2008;121(Pt 15):2445–51. doi: 10.1242/jcs.033233 [DOI] [PubMed] [Google Scholar]
28.Humphryes N, Leung W-K, Argunhan B, Terentyev Y, Dvorackova M, Tsubouchi H. The Ecm11-Gmc2 complex promotes synaptonemal complex formation through assembly of transverse filaments in budding yeast. PLoS Genet. 2013;9(1):e1003194. doi: 10.1371/journal.pgen.1003194 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Page SL, Khetani RS, Lake CM, Nielsen RJ, Jeffress JK, Warren WD, et al. Corona is required for higher-order assembly of transverse filaments into full-length synaptonemal complex in Drosophila oocytes. PLoS Genet. 2008;4(9):e1000194. doi: 10.1371/journal.pgen.1000194 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Subramanian VV, Hochwagen A. The meiotic checkpoint network: step-by-step through meiotic prophase. Cold Spring Harb Perspect Biol. 2014;6(10):a016675. doi: 10.1101/cshperspect.a016675 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Barchi M, Mahadevaiah S, Di Giacomo M, Baudat F, de Rooij DG, Burgoyne PS, et al. Surveillance of different recombination defects in mouse spermatocytes yields distinct responses despite elimination at an identical developmental stage. Mol Cell Biol. 2005;25(16):7203–15. doi: 10.1128/MCB.25.16.7203-7215.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Di Giacomo M, Barchi M, Baudat F, Edelmann W, Keeney S, Jasin M. Distinct DNA-damage-dependent and -independent responses drive the loss of oocytes in recombination-defective mouse mutants. Proc Natl Acad Sci U S A. 2005;102(3):737–42. doi: 10.1073/pnas.0406212102 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Pacheco S, Marcet-Ortega M, Lange J, Jasin M, Keeney S, Roig I. The ATM signaling cascade promotes recombination-dependent pachytene arrest in mouse spermatocytes. PLoS Genet. 2015;11(3):e1005017. doi: 10.1371/journal.pgen.1005017 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Rinaldi VD, Bolcun-Filas E, Kogo H, Kurahashi H, Schimenti JC. The DNA Damage Checkpoint Eliminates Mouse Oocytes with Chromosome Synapsis Failure. Mol Cell. 2017;67(6):1026-1036.e2. doi: 10.1016/j.molcel.2017.07.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Baudat F, Manova K, Yuen JP, Jasin M, Keeney S. Chromosome synapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11. Mol Cell. 2000;6(5):989–98. doi: 10.1016/s1097-2765(00)00098-8 [DOI] [PubMed] [Google Scholar]
36.Bhalla N, Dernburg AF. A conserved checkpoint monitors meiotic chromosome synapsis in Caenorhabditis elegans. Science. 2005;310(5754):1683–6. doi: 10.1126/science.1117468 [DOI] [PubMed] [Google Scholar]
37.Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N. Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans. Genetics. 2016;204(3):987–97. doi: 10.1534/genetics.116.191494 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Lascarez-Lagunas LI, Herruzo E, Grishok A, San-Segundo PA, Colaiácovo MP. DOT-1.1-dependent H3K79 methylation promotes normal meiotic progression and meiotic checkpoint function in C. elegans. PLoS Genet. 2020;16(10):e1009171. doi: 10.1371/journal.pgen.1009171 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Garcia-Muse T, Galindo-Diaz U, Garcia-Rubio M, Martin JS, Polanowska J, O’Reilly N, et al. A Meiotic Checkpoint Alters Repair Partner Bias to Permit Inter-sister Repair of Persistent DSBs. Cell Rep. 2019;26(3):775-787.e5. doi: 10.1016/j.celrep.2018.12.074 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Storlazzi A, Xu L, Schwacha A, Kleckner N. Synaptonemal complex (SC) component Zip1 plays a role in meiotic recombination independent of SC polymerization along the chromosomes. Proc Natl Acad Sci U S A. 1996;93(17):9043–8. doi: 10.1073/pnas.93.17.9043 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Zavec AB, Lesnik U, Komel R, Comino A. The Saccharomyces cerevisiae gene ECM11 is a positive effector of meiosis. FEMS Microbiol Lett. 2004;241(2):193–9. doi: 10.1016/j.femsle.2004.10.020 [DOI] [PubMed] [Google Scholar]
42.Chen X, Gaglione R, Leong T, Bednor L, de Los Santos T, Luk E, et al. Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80. PLoS Genet. 2018;14(11):e1007832. doi: 10.1371/journal.pgen.1007832 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Prugar E, Burnett C, Chen X, Hollingsworth NM. Coordination of Double Strand Break Repair and Meiotic Progression in Yeast by a Mek1-Ndt80 Negative Feedback Loop. Genetics. 2017;206(1):497–512. doi: 10.1534/genetics.117.199703 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Chen X, Suhandynata RT, Sandhu R, Rockmill B, Mohibullah N, Niu H, et al. Phosphorylation of the Synaptonemal Complex Protein Zip1 Regulates the Crossover/Noncrossover Decision during Yeast Meiosis. PLoS Biol. 2015;13(12):e1002329. doi: 10.1371/journal.pbio.1002329 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Joyce EF, McKim KS. Drosophila PCH2 is required for a pachytene checkpoint that monitors double-strand-break-independent events leading to meiotic crossover formation. Genetics. 2009;181(1):39–51. doi: 10.1534/genetics.108.093112 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Joyce EF, McKim KS. Chromosome axis defects induce a checkpoint-mediated delay and interchromosomal effect on crossing over during Drosophila meiosis. PLoS Genet. 2010;6(8):e1001059. doi: 10.1371/journal.pgen.1001059 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.France MG, Enderle J, Röhrig S, Puchta H, Franklin FCH, Higgins JD. ZYP1 is required for obligate cross-over formation and cross-over interference in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 2021;118:e2021671118. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Blokhina YP, Nguyen AD, Draper BW, Burgess SM. The telomere bouquet is a hub where meiotic double-strand breaks, synapsis, and stable homolog juxtaposition are coordinated in the zebrafish, Danio rerio. PLoS Genet. 2019;15(1):e1007730. doi: 10.1371/journal.pgen.1007730 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Kee K, Keeney S. Functional interactions between SPO11 and REC102 during initiation of meiotic recombination in Saccharomyces cerevisiae. Genetics. 2002;160(1):111–22. doi: 10.1093/genetics/160.1.111 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Malone RE, Haring SJ, Foreman KE, Pansegrau ML, Smith SM, Houdek DR, et al. The signal from the initiation of meiotic recombination to the first division of meiosis. Eukaryot Cell. 2004;3(3):598–609. doi: 10.1128/EC.3.3.598-609.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Saito K, Sakai C, Kawasaki T, Sakai N. Telomere distribution pattern and synapsis initiation during spermatogenesis in zebrafish. Dev Dyn. 2014;243(11):1448–56. doi: 10.1002/dvdy.24166 [DOI] [PubMed] [Google Scholar]
52.Colaiácovo MP, MacQueen AJ, Martinez-Perez E, McDonald K, Adamo A, La Volpe A, et al. Synaptonemal complex assembly in C. elegans is dispensable for loading strand-exchange proteins but critical for proper completion of recombination. Dev Cell. 2003;5(3):463–74. doi: 10.1016/s1534-5807(03)00232-6 [DOI] [PubMed] [Google Scholar]
53.MacQueen AJ, Phillips CM, Bhalla N, Weiser P, Villeneuve AM, Dernburg AF. Chromosome sites play dual roles to establish homologous synapsis during meiosis in C. elegans. Cell. 2005;123(6):1037–50. doi: 10.1016/j.cell.2005.09.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Rog O, Dernburg AF. Direct Visualization Reveals Kinetics of Meiotic Chromosome Synapsis. Cell Rep. 2015;10(10):1639–45. doi: 10.1016/j.celrep.2015.02.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Saito K, Siegfried KR, Nüsslein-Volhard C, Sakai N. Isolation and cytogenetic characterization of zebrafish meiotic prophase I mutants. Dev Dyn. 2011;240(7):1779–92. doi: 10.1002/dvdy.22661 [DOI] [PubMed] [Google Scholar]
56.Imai Y, Saito K, Takemoto K, Velilla F, Kawasaki T, Ishiguro K-I, et al. Sycp1 Is Not Required for Subtelomeric DNA Double-Strand Breaks but Is Required for Homologous Alignment in Zebrafish Spermatocytes. Front Cell Dev Biol. 2021;9:664377. doi: 10.3389/fcell.2021.664377 [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Mou H, Smith JL, Peng L, Yin H, Moore J, Zhang X-O, et al. CRISPR/Cas9-mediated genome editing induces exon skipping by alternative splicing or exon deletion. Genome Biol. 2017;18(1):108. doi: 10.1186/s13059-017-1237-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Ramanagoudr-Bhojappa R, Carrington B, Ramaswami M, Bishop K, Robbins GM, Jones M, et al. Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility. PLoS Genet. 2018;14(12):e1007821. doi: 10.1371/journal.pgen.1007821 [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Kochakpour N, Moens PB. Sex-specific crossover patterns in Zebrafish (Danio rerio). Heredity (Edinb). 2008;100(5):489–95. doi: 10.1038/sj.hdy.6801091 [DOI] [PubMed] [Google Scholar]
60.Singer A, Perlman H, Yan Y, Walker C, Corley-Smith G, Brandhorst B. Sex-specific recombination rates in zebrafish (Danio rerio). Genetics. 2002;160:649–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Moens PB. Zebrafish: chiasmata and interference. Genome. 2006;49(3):205–8. doi: 10.1139/g06-021 [DOI] [PubMed] [Google Scholar]
62.Tung KS, Roeder GS. Meiotic chromosome morphology and behavior in zip1 mutants of Saccharomyces cerevisiae. Genetics. 1998;149(2):817–32. doi: 10.1093/genetics/149.2.817 [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Tessé S, Storlazzi A, Kleckner N, Gargano S, Zickler D. Localization and roles of Ski8p protein in Sordaria meiosis and delineation of three mechanistically distinct steps of meiotic homolog juxtaposition. Proc Natl Acad Sci U S A. 2003;100(22):12865–70. doi: 10.1073/pnas.2034282100 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Wilson CA, High SK, McCluskey BM, Amores A, Yan Y, Titus TA, et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 2014;198(3):1291–308. doi: 10.1534/genetics.114.169284 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Kossack ME, Draper BW. Genetic regulation of sex determination and maintenance in zebrafish (Danio rerio). Curr Top Dev Biol. 2019;134:119–49. doi: 10.1016/bs.ctdb.2019.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Uchida D, Yamashita M, Kitano T, Iguchi T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J Exp Biol. 2002;205(Pt 6):711–8. doi: 10.1242/jeb.205.6.711 [DOI] [PubMed] [Google Scholar]
67.Dranow DB, Hu K, Bird AM, Lawry ST, Adams MT, Sanchez A, et al. Bmp15 Is an Oocyte-Produced Signal Required for Maintenance of the Adult Female Sexual Phenotype in Zebrafish. PLoS Genet. 2016;12(9):e1006323. doi: 10.1371/journal.pgen.1006323 [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Rodríguez-Marí A, Cañestro C, Bremiller RA, Nguyen-Johnson A, Asakawa K, Kawakami K, et al. Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis. PLoS Genet. 2010;6(7):e1001034. doi: 10.1371/journal.pgen.1001034 [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Shive HR, West RR, Embree LJ, Azuma M, Sood R, Liu P, et al. brca2 in zebrafish ovarian development, spermatogenesis, and tumorigenesis. Proc Natl Acad Sci U S A. 2010;107(45):19350–5. doi: 10.1073/pnas.1011630107 [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Takemoto K, Imai Y, Saito K, Kawasaki T, Carlton PM, Ishiguro KI. Sycp2 is essential for synaptonemal complex assembly, early meiotic recombination and homologous pairing in zebrafish spermatocytes. PLoS Genet. 2020;16:e1008640. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Blokhina YP, Frees MA, Nguyen A, Sharifi M, Chu DB, Bispo K, et al. Rad21l1 cohesin subunit is dispensable for spermatogenesis but not oogenesis in zebrafish. PLoS Genet. 2021;17(6):e1009127. doi: 10.1371/journal.pgen.1009127 [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Rodríguez-Marí A, Wilson C, Titus TA, Cañestro C, BreMiller RA, Yan Y-L, et al. Roles of brca2 (fancd1) in oocyte nuclear architecture, gametogenesis, gonad tumors, and genome stability in zebrafish. PLoS Genet. 2011;7(3):e1001357. doi: 10.1371/journal.pgen.1001357 [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Selman K, Wallace RA, Sarka A, Qi X. Stages of oocyte development in the zebrafish, Brachydanio rerio. J Morphol. 1993;218:203–24. [DOI] [PubMed] [Google Scholar]
74.Pan Y-J, Tong S-K, Hsu C-W, Weng J-H, Chung B-C. Zebrafish Establish Female Germ Cell Identity by Advancing Cell Proliferation and Meiosis. Front Cell Dev Biol. 2022;10:866267. doi: 10.3389/fcell.2022.866267 [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Webster KA, Schach U, Ordaz A, Steinfeld JS, Draper BW, Siegfried KR. Dmrt1 is necessary for male sexual development in zebrafish. Dev Biol. 2017;422(1):33–46. doi: 10.1016/j.ydbio.2016.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Gonzales JMJ, Law SHW. Feed and feeding regime affect growth rate and gonadosomatic index of adult zebrafish (Danio rerio). Zebrafish. 2013;10:532–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Leal MC, Cardoso ER, Nóbrega RH, Batlouni SR, Bogerd J, França LR, et al. Histological and stereological evaluation of zebrafish (Danio rerio) spermatogenesis with an emphasis on spermatogonial generations. Biol Reprod. 2009;81(1):177–87. doi: 10.1095/biolreprod.109.076299 [DOI] [PubMed] [Google Scholar]
78.Hans F, Dimitrov S. Histone H3 phosphorylation and cell division. Oncogene. 2001;20(24):3021–7. doi: 10.1038/sj.onc.1204326 [DOI] [PubMed] [Google Scholar]
79.Eaker S, Pyle A, Cobb J, Handel MA. Evidence for meiotic spindle checkpoint from analysis of spermatocytes from Robertsonian-chromosome heterozygous mice. J Cell Sci. 2001;114(Pt 16):2953–65. doi: 10.1242/jcs.114.16.2953 [DOI] [PubMed] [Google Scholar]
80.de Vries FAT, de Boer E, van den Bosch M, Baarends WM, Ooms M, Yuan L, et al. Mouse Sycp1 functions in synaptonemal complex assembly, meiotic recombination, and XY body formation. Genes Dev. 2005;19(11):1376–89. doi: 10.1101/gad.329705 [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Sansam CL, Pezza RJ. Connecting by breaking and repairing: mechanisms of DNA strand exchange in meiotic recombination. FEBS J. 2015;282(13):2444–57. doi: 10.1111/febs.13317 [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Prince JP, Martinez-Perez E. Functions and Regulation of Meiotic HORMA-Domain Proteins. Genes (Basel). 2022;13(5):777. doi: 10.3390/genes13050777 [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Fukuda T, Daniel K, Wojtasz L, Toth A, Höög C. A novel mammalian HORMA domain-containing protein, HORMAD1, preferentially associates with unsynapsed meiotic chromosomes. Exp Cell Res. 2010;316(2):158–71. doi: 10.1016/j.yexcr.2009.08.007 [DOI] [PubMed] [Google Scholar]
84.Wojtasz L, Daniel K, Roig I, Bolcun-Filas E, Xu H, Boonsanay V. Mouse HORMAD1 and HORMAD2, two conserved meiotic chromosomal proteins, are depleted from synapsed chromosome axes with the help of TRIP13 AAA-ATPase. PLoS Genet. 2009;5:e1000702. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Schramm S, Fraune J, Naumann R, Hernandez-Hernandez A, Höög C, Cooke HJ, et al. A novel mouse synaptonemal complex protein is essential for loading of central element proteins, recombination, and fertility. PLoS Genet. 2011;7(5):e1002088. doi: 10.1371/journal.pgen.1002088 [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Gómez-H L, Felipe-Medina N, Sánchez-Martín M, Davies OR, Ramos I, García-Tuñón I, et al. C14ORF39/SIX6OS1 is a constituent of the synaptonemal complex and is essential for mouse fertility. Nat Commun. 2016;7:13298. doi: 10.1038/ncomms13298 [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Bolcun-Filas E, Hall E, Speed R, Taggart M, Grey C, de Massy B, et al. Mutation of the mouse Syce1 gene disrupts synapsis and suggests a link between synaptonemal complex structural components and DNA repair. PLoS Genet. 2009;5(2):e1000393. doi: 10.1371/journal.pgen.1000393 [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ, Wang PJ. Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. J Cell Biol. 2006;173(4):497–507. doi: 10.1083/jcb.200603063 [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Yuan L, Liu J-G, Hoja M-R, Wilbertz J, Nordqvist K, Höög C. Female germ cell aneuploidy and embryo death in mice lacking the meiosis-specific protein SCP3. Science. 2002;296(5570):1115–8. doi: 10.1126/science.1070594 [DOI] [PubMed] [Google Scholar]
90.MacQueen AJ, Hochwagen A. Checkpoint mechanisms: the puppet masters of meiotic prophase. Trends in Cell Biology. 2011;21:393–400. [DOI] [PubMed] [Google Scholar]
91.Turner JMA, Mahadevaiah SK, Ellis PJI, Mitchell MJ, Burgoyne PS. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Dev Cell. 2006;10(4):521–9. doi: 10.1016/j.devcel.2006.02.009 [DOI] [PubMed] [Google Scholar]
92.Mahadevaiah SK, Bourc’his D, de Rooij DG, Bestor TH, Turner JMA, Burgoyne PS. Extensive meiotic asynapsis in mice antagonises meiotic silencing of unsynapsed chromatin and consequently disrupts meiotic sex chromosome inactivation. J Cell Biol. 2008;182(2):263–76. doi: 10.1083/jcb.200710195 [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Cloutier JM, Mahadevaiah SK, ElInati E, Nussenzweig A, Tóth A, Turner JMA. Histone H2AFX Links Meiotic Chromosome Asynapsis to Prophase I Oocyte Loss in Mammals. PLoS Genet. 2015;11(10):e1005462. doi: 10.1371/journal.pgen.1005462 [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Ichijima Y, Ichijima M, Lou Z, Nussenzweig A, Camerini-Otero RD, Chen J, et al. MDC1 directs chromosome-wide silencing of the sex chromosomes in male germ cells. Genes Dev. 2011;25: 959–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
95.Jaramillo-Lambert A, Engebrecht J. A single unpaired and transcriptionally silenced X chromosome locally precludes checkpoint signaling in the Caenorhabditis elegans germ line. Genetics. 2010;184(3):613–28. doi: 10.1534/genetics.109.110338 [DOI] [PMC free article] [PubMed] [Google Scholar]
96.Ooi SL, Priess JR, Henikoff S. Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans. PLoS Genet. 2006;2:e97. [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Bean CJ, Schaner CE, Kelly WG. Meiotic pairing and imprinted X chromatin assembly in Caenorhabditis elegans. Nat Genet. 2004;36(1):100–5. doi: 10.1038/ng1283 [DOI] [PMC free article] [PubMed] [Google Scholar]
98.Kelly WG, Schaner CE, Dernburg AF, Lee M-H, Kim SK, Villeneuve AM, et al. X-chromosome silencing in the germline of C. elegans. Development. 2002;129(2):479–92. doi: 10.1242/dev.129.2.479 [DOI] [PMC free article] [PubMed] [Google Scholar]
99.Van Eenennaam AL, Murray JD, Medrano JF. Synaptonemal complex analysis in spermatocytes of white sturgeon,AcipensertransmontanusRichardson (Pisces, Acipenseridae), a fish with a very high chromosome number. Genome. 1998;41(1):51–61. doi: 10.1139/g97-101 [DOI] [Google Scholar]
100.Mestriner CA, Galetti PM Jr, Valentini SR, Ruiz IR, Abel LD, Moreira-Filho O, et al. Structural and functional evidence that a B chromosome in the characid fish Astyanax scabripinnis is an isochromosome. Heredity (Edinb). 2000;85 ( Pt 1):1–9. doi: 10.1046/j.1365-2540.2000.00702.x [DOI] [PubMed] [Google Scholar]
101.Silva DMZ de A, Araya-Jaime C, Yamashita M, Vidal MR, Oliveira C, Porto-Foresti F, et al. Meiotic self-pairing of the Psalidodon (Characiformes, Characidae) iso-B chromosome: A successful perpetuation mechanism. Genet Mol Biol. 2021;44(3):e20210084. doi: 10.1590/1678-4685-GMB-2021-0084 [DOI] [PMC free article] [PubMed] [Google Scholar]
102.Takehana Y, Naruse K, Hamaguchi S, Sakaizumi M. Evolution of ZZ/ZW and XX/XY sex-determination systems in the closely related medaka species, Oryzias hubbsi and O. dancena. Chromosoma. 2007;116(5):463–70. doi: 10.1007/s00412-007-0110-z [DOI] [PubMed] [Google Scholar]
103.Fedder J. Sex determination and male differentiation in southern swordtail fishes: Evaluation from an evolutionary perspective. G. 2023;8:407. [Google Scholar]
104.Ravi V, Venkatesh B. The Divergent Genomes of Teleosts. Annu Rev Anim Biosci. 2018;6:47–68. doi: 10.1146/annurev-animal-030117-014821 [DOI] [PubMed] [Google Scholar]
105.Tasnim M, Wahlquist P, Hill JT. Zebrafish: unraveling genetic complexity through duplicated genes. Developmental Genes and Evolution. 2024;234:99–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
106.Zhou L, Gui J. Natural and artificial polyploids in aquaculture. Aquac Fish. 2017;2:103–11. [Google Scholar]
107.Li XC, Barringer BC, Barbash DA. The pachytene checkpoint and its relationship to evolutionary patterns of polyploidization and hybrid sterility. Heredity (Edinb). 2009;102(1):24–30. doi: 10.1038/hdy.2008.84 [DOI] [PubMed] [Google Scholar]
108.del Pozo JC, Ramirez-Parra E. Whole genome duplications in plants: an overview from Arabidopsis. J Exp Bot. 2015;66(22):6991–7003. doi: 10.1093/jxb/erv432 [DOI] [PubMed] [Google Scholar]
109.Wijnker E, Schnittger A. Control of the meiotic cell division program in plants. Plant Reprod. 2013;26(3):143–58. doi: 10.1007/s00497-013-0223-x [DOI] [PMC free article] [PubMed] [Google Scholar]
110.De Jaeger-Braet J, Krause L, Buchholz A, Schnittger A. Heat stress reveals a specialized variant of the pachytene checkpoint in meiosis of Arabidopsis thaliana. Plant Cell. 2022;34(1):433–54. doi: 10.1093/plcell/koab257 [DOI] [PMC free article] [PubMed] [Google Scholar]
111.Mezzasalma M, Brunelli E, Odierna G, Guarino FM. Evolutionary and Genomic Diversity of True Polyploidy in Tetrapods. Animals (Basel). 2023;13(6):1033. doi: 10.3390/ani13061033 [DOI] [PMC free article] [PubMed] [Google Scholar]
112.Svartman M, Stone G, Stanyon R. Molecular cytogenetics discards polyploidy in mammals. Genomics. 2005;85(4):425–30. doi: 10.1016/j.ygeno.2004.12.004 [DOI] [PubMed] [Google Scholar]
113.Mable BK. Why polyploidy is rarer in animals than in plants: myths and mechanisms. Biol J Linn Soc Lond. 2004;82:453–66. [Google Scholar]
114.Mable BK, Alexandrou MA, Taylor MI. Genome duplication in amphibians and fish: an extended synthesis. J Zool. 2011;284:151–82. [Google Scholar]
115.Siegfried KR, Nüsslein-Volhard C. Germ line control of female sex determination in zebrafish. Dev Biol. 2008;324(2):277–87. doi: 10.1016/j.ydbio.2008.09.025 [DOI] [PubMed] [Google Scholar]
116.Islam KN, Modi MM, Siegfried KR. The Zebrafish Meiotic Cohesin Complex Protein Smc1b Is Required for Key Events in Meiotic Prophase I. Front Cell Dev Biol. 2021;9:714245. doi: 10.3389/fcell.2021.714245 [DOI] [PMC free article] [PubMed] [Google Scholar]
117.Botthof JG, Bielczyk-Maczyńska E, Ferreira L, Cvejic A. Loss of the homologous recombination gene rad51 leads to Fanconi anemia-like symptoms in zebrafish. Proc Natl Acad Sci U S A. 2017;114(22):E4452–61. doi: 10.1073/pnas.1620631114 [DOI] [PMC free article] [PubMed] [Google Scholar]
118.Marcet-Ortega M, Pacheco S, Martínez-Marchal A, Castillo H, Flores E, Jasin M, et al. p53 and TAp63 participate in the recombination-dependent pachytene arrest in mouse spermatocytes. PLoS Genet. 2017;13(6):e1006845. doi: 10.1371/journal.pgen.1006845 [DOI] [PMC free article] [PubMed] [Google Scholar]
119.Feitsma H, Leal MC, Moens PB, Cuppen E, Schulz RW. Mlh1 deficiency in zebrafish results in male sterility and aneuploid as well as triploid progeny in females. Genetics. 2007;175(4):1561–9. doi: 10.1534/genetics.106.068171 [DOI] [PMC free article] [PubMed] [Google Scholar]
120.Ou Y, Li H, Li J, Dai X, He J, Wang S. Formation of different polyploids through disrupting meiotic crossover frequencies based on cntd1 knockout in zebrafish. Molecular Biol Evolution. 2024;41:msae047. [DOI] [PMC free article] [PubMed] [Google Scholar]
121.Poss KD, Nechiporuk A, Stringer KF, Lee C, Keating MT. Germ cell aneuploidy in zebrafish with mutations in the mitotic checkpoint gene mps1. Genes Dev. 2004;18(13):1527–32. doi: 10.1101/gad.1182604 [DOI] [PMC free article] [PubMed] [Google Scholar]
122.Liu Y, Kossack ME, McFaul ME, Christensen LN, Siebert S, Wyatt SR, et al. Single-cell transcriptome reveals insights into the development and function of the zebrafish ovary. Elife. 2022;11:e76014. doi: 10.7554/eLife.76014 [DOI] [PMC free article] [PubMed] [Google Scholar]
123.Hill JT, Demarest BL, Bisgrove BW, Su Y-C, Smith M, Yost HJ. Poly peak parser: Method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products. Dev Dyn. 2014;243(12):1632–6. doi: 10.1002/dvdy.24183 [DOI] [PMC free article] [PubMed] [Google Scholar]
124.Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, et al. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 2024;52(W1):W521–5. doi: 10.1093/nar/gkae241 [DOI] [PMC free article] [PubMed] [Google Scholar]
125.Rhodes J, Amsterdam A, Sanda T, Moreau LA, McKenna K, Heinrichs S, et al. Emi1 maintains genomic integrity during zebrafish embryogenesis and cooperates with p53 in tumor suppression. Mol Cell Biol. 2009;29(21):5911–22. doi: 10.1128/MCB.00558-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
126.Asana Marican HT, Sun LWH, Shen H. A Simple Method to Establish Metaphase Chromosomes from Individual Zebrafish Embryos. Zebrafish. 2021;18(5):338–41. doi: 10.1089/zeb.2021.0014 [DOI] [PubMed] [Google Scholar]
127.Preibisch S, Saalfeld S, Tomancak P. Globally optimal stitching of tiled 3D microscopic image acquisitions. Bioinformatics. 2009;25(11):1463–5. doi: 10.1093/bioinformatics/btp184 [DOI] [PMC free article] [PubMed] [Google Scholar]
128.Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596(7873):583–9. doi: 10.1038/s41586-021-03819-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Targeted mutation of syce2 and sycp1 via CRISPR/Cas9.

(PDF)

pgen.1011656.s001.pdf^{(312.7KB, pdf)}

S2 Fig. EZ and LZ stages from syce2^+/+ and syce2^-/- spermatocytes.

Magnified images from EZ and LZ stages from Fig 2A and 2B.

(PDF)

pgen.1011656.s002.pdf^{(1.8MB, pdf)}

S3 Fig. Identification of wild-type diplotene spermatocytes.

(PDF)

pgen.1011656.s003.pdf^{(6.1MB, pdf)}

S4 Fig. dmrt1 mutation does not affect chromosome co-alignment.

(PDF)

pgen.1011656.s004.pdf^{(9.3MB, pdf)}

S5 Fig. Ovaries and testes from syce2^+/+ and syce2^-/- animals.

Brightfield images of ovaries (A) and testes (B) in situ that were used to calculate the gonadosomatic index (GSI) for each sex.

(PDF)

pgen.1011656.s005.pdf^{(7.8MB, pdf)}

S6 Fig. Ovaries and testes from sycp1^+/+ and sycp1^-/- animals.

Brightfield images of ovaries (A) and testes (B) in situ that were used to calculate the gonadosomatic index (GSI) for each sex. Graphs are the same as in Fig S5.

(PDF)

pgen.1011656.s006.pdf^{(9.1MB, pdf)}

S7 Fig. Cleaved caspase-3 positive cells in a sycp1^-/- testis.

(PDF)

pgen.1011656.s007.pdf^{(9.2MB, pdf)}

S8 Fig. yH2AX staining in sycp1^-/- testes and oocytes.

(PDF)

pgen.1011656.s008.pdf^{(5.9MB, pdf)}

S9 Fig. Model of chromosome events during meiotic prophase.

(PDF)

pgen.1011656.s009.pdf^{(354.8KB, pdf)}

S1 File. Master data table with graph values.

(XLSX)

pgen.1011656.s010.xlsx^{(110.8KB, xlsx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pgen.1011656.ref001] 1.Mann U, Shiff B, Patel P. Reasons for worldwide decline in male fertility. Curr Opin Urol. 2020;30(3):296–301. doi: 10.1097/MOU.0000000000000745 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref002] 2.Maor-Sagie E, Cinnamon Y, Yaacov B, Shaag A, Goldsmidt H, Zenvirt S, et al. Deleterious mutation in SYCE1 is associated with non-obstructive azoospermia. J Assist Reprod Genet. 2015;32(6):887–91. doi: 10.1007/s10815-015-0445-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref003] 3.Nabi S, Askari M, Rezaei-Gazik M, Salehi N, Almadani N, Tahamtani Y. A rare frameshift mutation in SYCP1 is associated with human male infertility. Mol Hum Reprod. 2022;28:gaac009. [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref004] 4.Pashaei M, Rahimi Bidgoli MM, Zare-Abdollahi D, Najmabadi H, Haji-Seyed-Javadi R, Fatehi F, et al. The second mutation of SYCE1 gene associated with autosomal recessive nonobstructive azoospermia. J Assist Reprod Genet. 2020;37(2):451–8. doi: 10.1007/s10815-019-01660-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref005] 5.García-Martínez OI, Geisinger A, de Los Santos E, Santiñaque FF, Folle GA, Pórfido JL, et al. Mouse modeling of familial human SYCE1 c.197-2A>G splice site mutation leads to meiotic recombination failure and non-obstructive azoospermia. Mol Hum Reprod. 2025;31(1):gaaf002. doi: 10.1093/molehr/gaaf002 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref006] 6.Steinthorsdottir V, Halldorsson BV, Jonsson H, Palsson G, Oddsson A, Westergaard D, et al. Variant in the synaptonemal complex protein SYCE2 associates with pregnancy loss through effect on recombination. Nat Struct Mol Biol. 2024;31(4):710–6. doi: 10.1038/s41594-023-01209-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref007] 7.De Vries L, Behar DM, Smirin-Yosef P, Lagovsky I, Tzur S, Basel-Vanagaite L. Exome Sequencing Reveals SYCE1 Mutation Associated With Autosomal Recessive Primary Ovarian Insufficiency. J Clin Endocrinol Metab. 2014;99:E2129–32. [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref008] 8.Zhe J, Ye D, Chen X, Liu Y, Zhou X, Li Y, et al. Consanguineous Chinese Familial Study Reveals that a Gross Deletion that Includes the SYCE1 Gene Region Is Associated with Premature Ovarian Insufficiency. Reprod Sci. 2020;27(2):461–7. doi: 10.1007/s43032-019-00037-0 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref009] 9.Zhang F, Liu M, Gao J. Alterations in synaptonemal complex coding genes and human infertility. Int J Biol Sci. 2022;18(5):1933–43. doi: 10.7150/ijbs.67843 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref010] 10.Bergerat A, de Massy B, Gadelle D, Varoutas PC, Nicolas A, Forterre P. An atypical topoisomerase II from Archaea with implications for meiotic recombination. Nature. 1997;386(6623):414–7. doi: 10.1038/386414a0 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref011] 11.Keeney S, Giroux CN, Kleckner N. Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell. 1997;88(3):375–84. doi: 10.1016/s0092-8674(00)81876-0 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref012] 12.Shinohara M, Oh SD, Hunter N, Shinohara A. Crossover assurance and crossover interference are distinctly regulated by the ZMM proteins during yeast meiosis. Nat Genet. 2008;40(3):299–309. doi: 10.1038/ng.83 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref013] 13.Martini E, Diaz RL, Hunter N, Keeney S. Crossover homeostasis in yeast meiosis. Cell. 2006;126:285–95. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref014] 14.Joshi N, Barot A, Jamison C, Börner GV. Pch2 links chromosome axis remodeling at future crossover sites and crossover distribution during yeast meiosis. PLoS Genet. 2009;5(7):e1000557. doi: 10.1371/journal.pgen.1000557 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref015] 15.Sym M, Roeder GS. Crossover interference is abolished in the absence of a synaptonemal complex protein. Cell. 1994;79(2):283–92. doi: 10.1016/0092-8674(94)90197-x [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref016] 16.Rosu S, Libuda DE, Villeneuve AM. Robust crossover assurance and regulated interhomolog access maintain meiotic crossover number. Science. 2011;334(6060):1286–9. doi: 10.1126/science.1212424 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref017] 17.Zakharyevich K, Tang S, Ma Y, Hunter N. Delineation of joint molecule resolution pathways in meiosis identifies a crossover-specific resolvase. Cell. 2012;149:334–47. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref018] 18.Lynn A, Soucek R, Börner GV. ZMM proteins during meiosis: crossover artists at work. Chromosome Res. 2007;15(5):591–605. doi: 10.1007/s10577-007-1150-1 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref019] 19.Pazhayam NM, Turcotte CA, Sekelsky J. Meiotic Crossover Patterning. Frontiers in Cell and Developmental Biology. 2021;9:681123. doi: 10.3389/fcell.2021.681123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref020] 20.von Wettstein D, Rasmussen SW, Holm PB. The synaptonemal complex in genetic segregation. Annu Rev Genet. 1984;18:331–413. doi: 10.1146/annurev.ge.18.120184.001555 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref021] 21.Adams IR, Davies OR. Meiotic Chromosome Structure, the Synaptonemal Complex, and Infertility. Annu Rev Genomics Hum Genet. 2023;24:35–61. doi: 10.1146/annurev-genom-110122-090239 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref022] 22.Cahoon CK, Hawley RS. Regulating the construction and demolition of the synaptonemal complex. Nat Struct Mol Biol. 2016;23(5):369–77. doi: 10.1038/nsmb.3208 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref023] 23.Bolcun-Filas E, Costa Y, Speed R, Taggart M, Benavente R, De Rooij DG, et al. SYCE2 is required for synaptonemal complex assembly, double strand break repair, and homologous recombination. J Cell Biol. 2007;176(6):741–7. doi: 10.1083/jcb.200610027 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref024] 24.Davies OR, Maman JD, Pellegrini L. Structural analysis of the human SYCE2-TEX12 complex provides molecular insights into synaptonemal complex assembly. Open Biol. 2012;2(7):120099. doi: 10.1098/rsob.120099 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref025] 25.Dunce JM, Dunne OM, Ratcliff M, Millán C, Madgwick S, Usón I. Structural basis of meiotic chromosome synapsis through SYCP1 self-assembly. Nature Structural & Molecular Biology. 2018;25:557–69. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref026] 26.Dunce JM, Salmon LJ, Davies OR. Structural basis of meiotic chromosome synaptic elongation through hierarchical fibrous assembly of SYCE2-TEX12. Nat Struct Mol Biol. 2021;28(8):681–93. doi: 10.1038/s41594-021-00636-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref027] 27.Hamer G, Wang H, Bolcun-Filas E, Cooke HJ, Benavente R, Höög C. Progression of meiotic recombination requires structural maturation of the central element of the synaptonemal complex. J Cell Sci. 2008;121(Pt 15):2445–51. doi: 10.1242/jcs.033233 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref028] 28.Humphryes N, Leung W-K, Argunhan B, Terentyev Y, Dvorackova M, Tsubouchi H. The Ecm11-Gmc2 complex promotes synaptonemal complex formation through assembly of transverse filaments in budding yeast. PLoS Genet. 2013;9(1):e1003194. doi: 10.1371/journal.pgen.1003194 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref029] 29.Page SL, Khetani RS, Lake CM, Nielsen RJ, Jeffress JK, Warren WD, et al. Corona is required for higher-order assembly of transverse filaments into full-length synaptonemal complex in Drosophila oocytes. PLoS Genet. 2008;4(9):e1000194. doi: 10.1371/journal.pgen.1000194 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref030] 30.Subramanian VV, Hochwagen A. The meiotic checkpoint network: step-by-step through meiotic prophase. Cold Spring Harb Perspect Biol. 2014;6(10):a016675. doi: 10.1101/cshperspect.a016675 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref031] 31.Barchi M, Mahadevaiah S, Di Giacomo M, Baudat F, de Rooij DG, Burgoyne PS, et al. Surveillance of different recombination defects in mouse spermatocytes yields distinct responses despite elimination at an identical developmental stage. Mol Cell Biol. 2005;25(16):7203–15. doi: 10.1128/MCB.25.16.7203-7215.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref032] 32.Di Giacomo M, Barchi M, Baudat F, Edelmann W, Keeney S, Jasin M. Distinct DNA-damage-dependent and -independent responses drive the loss of oocytes in recombination-defective mouse mutants. Proc Natl Acad Sci U S A. 2005;102(3):737–42. doi: 10.1073/pnas.0406212102 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref033] 33.Pacheco S, Marcet-Ortega M, Lange J, Jasin M, Keeney S, Roig I. The ATM signaling cascade promotes recombination-dependent pachytene arrest in mouse spermatocytes. PLoS Genet. 2015;11(3):e1005017. doi: 10.1371/journal.pgen.1005017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref034] 34.Rinaldi VD, Bolcun-Filas E, Kogo H, Kurahashi H, Schimenti JC. The DNA Damage Checkpoint Eliminates Mouse Oocytes with Chromosome Synapsis Failure. Mol Cell. 2017;67(6):1026-1036.e2. doi: 10.1016/j.molcel.2017.07.027 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref035] 35.Baudat F, Manova K, Yuen JP, Jasin M, Keeney S. Chromosome synapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11. Mol Cell. 2000;6(5):989–98. doi: 10.1016/s1097-2765(00)00098-8 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref036] 36.Bhalla N, Dernburg AF. A conserved checkpoint monitors meiotic chromosome synapsis in Caenorhabditis elegans. Science. 2005;310(5754):1683–6. doi: 10.1126/science.1117468 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref037] 37.Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N. Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans. Genetics. 2016;204(3):987–97. doi: 10.1534/genetics.116.191494 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref038] 38.Lascarez-Lagunas LI, Herruzo E, Grishok A, San-Segundo PA, Colaiácovo MP. DOT-1.1-dependent H3K79 methylation promotes normal meiotic progression and meiotic checkpoint function in C. elegans. PLoS Genet. 2020;16(10):e1009171. doi: 10.1371/journal.pgen.1009171 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref039] 39.Garcia-Muse T, Galindo-Diaz U, Garcia-Rubio M, Martin JS, Polanowska J, O’Reilly N, et al. A Meiotic Checkpoint Alters Repair Partner Bias to Permit Inter-sister Repair of Persistent DSBs. Cell Rep. 2019;26(3):775-787.e5. doi: 10.1016/j.celrep.2018.12.074 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref040] 40.Storlazzi A, Xu L, Schwacha A, Kleckner N. Synaptonemal complex (SC) component Zip1 plays a role in meiotic recombination independent of SC polymerization along the chromosomes. Proc Natl Acad Sci U S A. 1996;93(17):9043–8. doi: 10.1073/pnas.93.17.9043 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref041] 41.Zavec AB, Lesnik U, Komel R, Comino A. The Saccharomyces cerevisiae gene ECM11 is a positive effector of meiosis. FEMS Microbiol Lett. 2004;241(2):193–9. doi: 10.1016/j.femsle.2004.10.020 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref042] 42.Chen X, Gaglione R, Leong T, Bednor L, de Los Santos T, Luk E, et al. Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80. PLoS Genet. 2018;14(11):e1007832. doi: 10.1371/journal.pgen.1007832 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref043] 43.Prugar E, Burnett C, Chen X, Hollingsworth NM. Coordination of Double Strand Break Repair and Meiotic Progression in Yeast by a Mek1-Ndt80 Negative Feedback Loop. Genetics. 2017;206(1):497–512. doi: 10.1534/genetics.117.199703 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref044] 44.Chen X, Suhandynata RT, Sandhu R, Rockmill B, Mohibullah N, Niu H, et al. Phosphorylation of the Synaptonemal Complex Protein Zip1 Regulates the Crossover/Noncrossover Decision during Yeast Meiosis. PLoS Biol. 2015;13(12):e1002329. doi: 10.1371/journal.pbio.1002329 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref045] 45.Joyce EF, McKim KS. Drosophila PCH2 is required for a pachytene checkpoint that monitors double-strand-break-independent events leading to meiotic crossover formation. Genetics. 2009;181(1):39–51. doi: 10.1534/genetics.108.093112 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref046] 46.Joyce EF, McKim KS. Chromosome axis defects induce a checkpoint-mediated delay and interchromosomal effect on crossing over during Drosophila meiosis. PLoS Genet. 2010;6(8):e1001059. doi: 10.1371/journal.pgen.1001059 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref047] 47.France MG, Enderle J, Röhrig S, Puchta H, Franklin FCH, Higgins JD. ZYP1 is required for obligate cross-over formation and cross-over interference in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 2021;118:e2021671118. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref048] 48.Blokhina YP, Nguyen AD, Draper BW, Burgess SM. The telomere bouquet is a hub where meiotic double-strand breaks, synapsis, and stable homolog juxtaposition are coordinated in the zebrafish, Danio rerio. PLoS Genet. 2019;15(1):e1007730. doi: 10.1371/journal.pgen.1007730 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref049] 49.Kee K, Keeney S. Functional interactions between SPO11 and REC102 during initiation of meiotic recombination in Saccharomyces cerevisiae. Genetics. 2002;160(1):111–22. doi: 10.1093/genetics/160.1.111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref050] 50.Malone RE, Haring SJ, Foreman KE, Pansegrau ML, Smith SM, Houdek DR, et al. The signal from the initiation of meiotic recombination to the first division of meiosis. Eukaryot Cell. 2004;3(3):598–609. doi: 10.1128/EC.3.3.598-609.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref051] 51.Saito K, Sakai C, Kawasaki T, Sakai N. Telomere distribution pattern and synapsis initiation during spermatogenesis in zebrafish. Dev Dyn. 2014;243(11):1448–56. doi: 10.1002/dvdy.24166 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref052] 52.Colaiácovo MP, MacQueen AJ, Martinez-Perez E, McDonald K, Adamo A, La Volpe A, et al. Synaptonemal complex assembly in C. elegans is dispensable for loading strand-exchange proteins but critical for proper completion of recombination. Dev Cell. 2003;5(3):463–74. doi: 10.1016/s1534-5807(03)00232-6 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref053] 53.MacQueen AJ, Phillips CM, Bhalla N, Weiser P, Villeneuve AM, Dernburg AF. Chromosome sites play dual roles to establish homologous synapsis during meiosis in C. elegans. Cell. 2005;123(6):1037–50. doi: 10.1016/j.cell.2005.09.034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref054] 54.Rog O, Dernburg AF. Direct Visualization Reveals Kinetics of Meiotic Chromosome Synapsis. Cell Rep. 2015;10(10):1639–45. doi: 10.1016/j.celrep.2015.02.032 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref055] 55.Saito K, Siegfried KR, Nüsslein-Volhard C, Sakai N. Isolation and cytogenetic characterization of zebrafish meiotic prophase I mutants. Dev Dyn. 2011;240(7):1779–92. doi: 10.1002/dvdy.22661 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref056] 56.Imai Y, Saito K, Takemoto K, Velilla F, Kawasaki T, Ishiguro K-I, et al. Sycp1 Is Not Required for Subtelomeric DNA Double-Strand Breaks but Is Required for Homologous Alignment in Zebrafish Spermatocytes. Front Cell Dev Biol. 2021;9:664377. doi: 10.3389/fcell.2021.664377 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref057] 57.Mou H, Smith JL, Peng L, Yin H, Moore J, Zhang X-O, et al. CRISPR/Cas9-mediated genome editing induces exon skipping by alternative splicing or exon deletion. Genome Biol. 2017;18(1):108. doi: 10.1186/s13059-017-1237-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref058] 58.Ramanagoudr-Bhojappa R, Carrington B, Ramaswami M, Bishop K, Robbins GM, Jones M, et al. Multiplexed CRISPR/Cas9-mediated knockout of 19 Fanconi anemia pathway genes in zebrafish revealed their roles in growth, sexual development and fertility. PLoS Genet. 2018;14(12):e1007821. doi: 10.1371/journal.pgen.1007821 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref059] 59.Kochakpour N, Moens PB. Sex-specific crossover patterns in Zebrafish (Danio rerio). Heredity (Edinb). 2008;100(5):489–95. doi: 10.1038/sj.hdy.6801091 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref060] 60.Singer A, Perlman H, Yan Y, Walker C, Corley-Smith G, Brandhorst B. Sex-specific recombination rates in zebrafish (Danio rerio). Genetics. 2002;160:649–57. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref061] 61.Moens PB. Zebrafish: chiasmata and interference. Genome. 2006;49(3):205–8. doi: 10.1139/g06-021 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref062] 62.Tung KS, Roeder GS. Meiotic chromosome morphology and behavior in zip1 mutants of Saccharomyces cerevisiae. Genetics. 1998;149(2):817–32. doi: 10.1093/genetics/149.2.817 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref063] 63.Tessé S, Storlazzi A, Kleckner N, Gargano S, Zickler D. Localization and roles of Ski8p protein in Sordaria meiosis and delineation of three mechanistically distinct steps of meiotic homolog juxtaposition. Proc Natl Acad Sci U S A. 2003;100(22):12865–70. doi: 10.1073/pnas.2034282100 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref064] 64.Wilson CA, High SK, McCluskey BM, Amores A, Yan Y, Titus TA, et al. Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains. Genetics. 2014;198(3):1291–308. doi: 10.1534/genetics.114.169284 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref065] 65.Kossack ME, Draper BW. Genetic regulation of sex determination and maintenance in zebrafish (Danio rerio). Curr Top Dev Biol. 2019;134:119–49. doi: 10.1016/bs.ctdb.2019.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref066] 66.Uchida D, Yamashita M, Kitano T, Iguchi T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J Exp Biol. 2002;205(Pt 6):711–8. doi: 10.1242/jeb.205.6.711 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref067] 67.Dranow DB, Hu K, Bird AM, Lawry ST, Adams MT, Sanchez A, et al. Bmp15 Is an Oocyte-Produced Signal Required for Maintenance of the Adult Female Sexual Phenotype in Zebrafish. PLoS Genet. 2016;12(9):e1006323. doi: 10.1371/journal.pgen.1006323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref068] 68.Rodríguez-Marí A, Cañestro C, Bremiller RA, Nguyen-Johnson A, Asakawa K, Kawakami K, et al. Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis. PLoS Genet. 2010;6(7):e1001034. doi: 10.1371/journal.pgen.1001034 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref069] 69.Shive HR, West RR, Embree LJ, Azuma M, Sood R, Liu P, et al. brca2 in zebrafish ovarian development, spermatogenesis, and tumorigenesis. Proc Natl Acad Sci U S A. 2010;107(45):19350–5. doi: 10.1073/pnas.1011630107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref070] 70.Takemoto K, Imai Y, Saito K, Kawasaki T, Carlton PM, Ishiguro KI. Sycp2 is essential for synaptonemal complex assembly, early meiotic recombination and homologous pairing in zebrafish spermatocytes. PLoS Genet. 2020;16:e1008640. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref071] 71.Blokhina YP, Frees MA, Nguyen A, Sharifi M, Chu DB, Bispo K, et al. Rad21l1 cohesin subunit is dispensable for spermatogenesis but not oogenesis in zebrafish. PLoS Genet. 2021;17(6):e1009127. doi: 10.1371/journal.pgen.1009127 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref072] 72.Rodríguez-Marí A, Wilson C, Titus TA, Cañestro C, BreMiller RA, Yan Y-L, et al. Roles of brca2 (fancd1) in oocyte nuclear architecture, gametogenesis, gonad tumors, and genome stability in zebrafish. PLoS Genet. 2011;7(3):e1001357. doi: 10.1371/journal.pgen.1001357 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref073] 73.Selman K, Wallace RA, Sarka A, Qi X. Stages of oocyte development in the zebrafish, Brachydanio rerio. J Morphol. 1993;218:203–24. [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref074] 74.Pan Y-J, Tong S-K, Hsu C-W, Weng J-H, Chung B-C. Zebrafish Establish Female Germ Cell Identity by Advancing Cell Proliferation and Meiosis. Front Cell Dev Biol. 2022;10:866267. doi: 10.3389/fcell.2022.866267 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref075] 75.Webster KA, Schach U, Ordaz A, Steinfeld JS, Draper BW, Siegfried KR. Dmrt1 is necessary for male sexual development in zebrafish. Dev Biol. 2017;422(1):33–46. doi: 10.1016/j.ydbio.2016.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref076] 76.Gonzales JMJ, Law SHW. Feed and feeding regime affect growth rate and gonadosomatic index of adult zebrafish (Danio rerio). Zebrafish. 2013;10:532–40. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref077] 77.Leal MC, Cardoso ER, Nóbrega RH, Batlouni SR, Bogerd J, França LR, et al. Histological and stereological evaluation of zebrafish (Danio rerio) spermatogenesis with an emphasis on spermatogonial generations. Biol Reprod. 2009;81(1):177–87. doi: 10.1095/biolreprod.109.076299 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref078] 78.Hans F, Dimitrov S. Histone H3 phosphorylation and cell division. Oncogene. 2001;20(24):3021–7. doi: 10.1038/sj.onc.1204326 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref079] 79.Eaker S, Pyle A, Cobb J, Handel MA. Evidence for meiotic spindle checkpoint from analysis of spermatocytes from Robertsonian-chromosome heterozygous mice. J Cell Sci. 2001;114(Pt 16):2953–65. doi: 10.1242/jcs.114.16.2953 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref080] 80.de Vries FAT, de Boer E, van den Bosch M, Baarends WM, Ooms M, Yuan L, et al. Mouse Sycp1 functions in synaptonemal complex assembly, meiotic recombination, and XY body formation. Genes Dev. 2005;19(11):1376–89. doi: 10.1101/gad.329705 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref081] 81.Sansam CL, Pezza RJ. Connecting by breaking and repairing: mechanisms of DNA strand exchange in meiotic recombination. FEBS J. 2015;282(13):2444–57. doi: 10.1111/febs.13317 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref082] 82.Prince JP, Martinez-Perez E. Functions and Regulation of Meiotic HORMA-Domain Proteins. Genes (Basel). 2022;13(5):777. doi: 10.3390/genes13050777 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref083] 83.Fukuda T, Daniel K, Wojtasz L, Toth A, Höög C. A novel mammalian HORMA domain-containing protein, HORMAD1, preferentially associates with unsynapsed meiotic chromosomes. Exp Cell Res. 2010;316(2):158–71. doi: 10.1016/j.yexcr.2009.08.007 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref084] 84.Wojtasz L, Daniel K, Roig I, Bolcun-Filas E, Xu H, Boonsanay V. Mouse HORMAD1 and HORMAD2, two conserved meiotic chromosomal proteins, are depleted from synapsed chromosome axes with the help of TRIP13 AAA-ATPase. PLoS Genet. 2009;5:e1000702. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref085] 85.Schramm S, Fraune J, Naumann R, Hernandez-Hernandez A, Höög C, Cooke HJ, et al. A novel mouse synaptonemal complex protein is essential for loading of central element proteins, recombination, and fertility. PLoS Genet. 2011;7(5):e1002088. doi: 10.1371/journal.pgen.1002088 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref086] 86.Gómez-H L, Felipe-Medina N, Sánchez-Martín M, Davies OR, Ramos I, García-Tuñón I, et al. C14ORF39/SIX6OS1 is a constituent of the synaptonemal complex and is essential for mouse fertility. Nat Commun. 2016;7:13298. doi: 10.1038/ncomms13298 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref087] 87.Bolcun-Filas E, Hall E, Speed R, Taggart M, Grey C, de Massy B, et al. Mutation of the mouse Syce1 gene disrupts synapsis and suggests a link between synaptonemal complex structural components and DNA repair. PLoS Genet. 2009;5(2):e1000393. doi: 10.1371/journal.pgen.1000393 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref088] 88.Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ, Wang PJ. Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. J Cell Biol. 2006;173(4):497–507. doi: 10.1083/jcb.200603063 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref089] 89.Yuan L, Liu J-G, Hoja M-R, Wilbertz J, Nordqvist K, Höög C. Female germ cell aneuploidy and embryo death in mice lacking the meiosis-specific protein SCP3. Science. 2002;296(5570):1115–8. doi: 10.1126/science.1070594 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref090] 90.MacQueen AJ, Hochwagen A. Checkpoint mechanisms: the puppet masters of meiotic prophase. Trends in Cell Biology. 2011;21:393–400. [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref091] 91.Turner JMA, Mahadevaiah SK, Ellis PJI, Mitchell MJ, Burgoyne PS. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Dev Cell. 2006;10(4):521–9. doi: 10.1016/j.devcel.2006.02.009 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref092] 92.Mahadevaiah SK, Bourc’his D, de Rooij DG, Bestor TH, Turner JMA, Burgoyne PS. Extensive meiotic asynapsis in mice antagonises meiotic silencing of unsynapsed chromatin and consequently disrupts meiotic sex chromosome inactivation. J Cell Biol. 2008;182(2):263–76. doi: 10.1083/jcb.200710195 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref093] 93.Cloutier JM, Mahadevaiah SK, ElInati E, Nussenzweig A, Tóth A, Turner JMA. Histone H2AFX Links Meiotic Chromosome Asynapsis to Prophase I Oocyte Loss in Mammals. PLoS Genet. 2015;11(10):e1005462. doi: 10.1371/journal.pgen.1005462 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref094] 94.Ichijima Y, Ichijima M, Lou Z, Nussenzweig A, Camerini-Otero RD, Chen J, et al. MDC1 directs chromosome-wide silencing of the sex chromosomes in male germ cells. Genes Dev. 2011;25: 959–71. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref095] 95.Jaramillo-Lambert A, Engebrecht J. A single unpaired and transcriptionally silenced X chromosome locally precludes checkpoint signaling in the Caenorhabditis elegans germ line. Genetics. 2010;184(3):613–28. doi: 10.1534/genetics.109.110338 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref096] 96.Ooi SL, Priess JR, Henikoff S. Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans. PLoS Genet. 2006;2:e97. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref097] 97.Bean CJ, Schaner CE, Kelly WG. Meiotic pairing and imprinted X chromatin assembly in Caenorhabditis elegans. Nat Genet. 2004;36(1):100–5. doi: 10.1038/ng1283 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref098] 98.Kelly WG, Schaner CE, Dernburg AF, Lee M-H, Kim SK, Villeneuve AM, et al. X-chromosome silencing in the germline of C. elegans. Development. 2002;129(2):479–92. doi: 10.1242/dev.129.2.479 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref099] 99.Van Eenennaam AL, Murray JD, Medrano JF. Synaptonemal complex analysis in spermatocytes of white sturgeon,AcipensertransmontanusRichardson (Pisces, Acipenseridae), a fish with a very high chromosome number. Genome. 1998;41(1):51–61. doi: 10.1139/g97-101 [DOI] [Google Scholar]

[pgen.1011656.ref100] 100.Mestriner CA, Galetti PM Jr, Valentini SR, Ruiz IR, Abel LD, Moreira-Filho O, et al. Structural and functional evidence that a B chromosome in the characid fish Astyanax scabripinnis is an isochromosome. Heredity (Edinb). 2000;85 ( Pt 1):1–9. doi: 10.1046/j.1365-2540.2000.00702.x [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref101] 101.Silva DMZ de A, Araya-Jaime C, Yamashita M, Vidal MR, Oliveira C, Porto-Foresti F, et al. Meiotic self-pairing of the Psalidodon (Characiformes, Characidae) iso-B chromosome: A successful perpetuation mechanism. Genet Mol Biol. 2021;44(3):e20210084. doi: 10.1590/1678-4685-GMB-2021-0084 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref102] 102.Takehana Y, Naruse K, Hamaguchi S, Sakaizumi M. Evolution of ZZ/ZW and XX/XY sex-determination systems in the closely related medaka species, Oryzias hubbsi and O. dancena. Chromosoma. 2007;116(5):463–70. doi: 10.1007/s00412-007-0110-z [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref103] 103.Fedder J. Sex determination and male differentiation in southern swordtail fishes: Evaluation from an evolutionary perspective. G. 2023;8:407. [Google Scholar]

[pgen.1011656.ref104] 104.Ravi V, Venkatesh B. The Divergent Genomes of Teleosts. Annu Rev Anim Biosci. 2018;6:47–68. doi: 10.1146/annurev-animal-030117-014821 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref105] 105.Tasnim M, Wahlquist P, Hill JT. Zebrafish: unraveling genetic complexity through duplicated genes. Developmental Genes and Evolution. 2024;234:99–116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref106] 106.Zhou L, Gui J. Natural and artificial polyploids in aquaculture. Aquac Fish. 2017;2:103–11. [Google Scholar]

[pgen.1011656.ref107] 107.Li XC, Barringer BC, Barbash DA. The pachytene checkpoint and its relationship to evolutionary patterns of polyploidization and hybrid sterility. Heredity (Edinb). 2009;102(1):24–30. doi: 10.1038/hdy.2008.84 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref108] 108.del Pozo JC, Ramirez-Parra E. Whole genome duplications in plants: an overview from Arabidopsis. J Exp Bot. 2015;66(22):6991–7003. doi: 10.1093/jxb/erv432 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref109] 109.Wijnker E, Schnittger A. Control of the meiotic cell division program in plants. Plant Reprod. 2013;26(3):143–58. doi: 10.1007/s00497-013-0223-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref110] 110.De Jaeger-Braet J, Krause L, Buchholz A, Schnittger A. Heat stress reveals a specialized variant of the pachytene checkpoint in meiosis of Arabidopsis thaliana. Plant Cell. 2022;34(1):433–54. doi: 10.1093/plcell/koab257 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref111] 111.Mezzasalma M, Brunelli E, Odierna G, Guarino FM. Evolutionary and Genomic Diversity of True Polyploidy in Tetrapods. Animals (Basel). 2023;13(6):1033. doi: 10.3390/ani13061033 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref112] 112.Svartman M, Stone G, Stanyon R. Molecular cytogenetics discards polyploidy in mammals. Genomics. 2005;85(4):425–30. doi: 10.1016/j.ygeno.2004.12.004 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref113] 113.Mable BK. Why polyploidy is rarer in animals than in plants: myths and mechanisms. Biol J Linn Soc Lond. 2004;82:453–66. [Google Scholar]

[pgen.1011656.ref114] 114.Mable BK, Alexandrou MA, Taylor MI. Genome duplication in amphibians and fish: an extended synthesis. J Zool. 2011;284:151–82. [Google Scholar]

[pgen.1011656.ref115] 115.Siegfried KR, Nüsslein-Volhard C. Germ line control of female sex determination in zebrafish. Dev Biol. 2008;324(2):277–87. doi: 10.1016/j.ydbio.2008.09.025 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref116] 116.Islam KN, Modi MM, Siegfried KR. The Zebrafish Meiotic Cohesin Complex Protein Smc1b Is Required for Key Events in Meiotic Prophase I. Front Cell Dev Biol. 2021;9:714245. doi: 10.3389/fcell.2021.714245 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref117] 117.Botthof JG, Bielczyk-Maczyńska E, Ferreira L, Cvejic A. Loss of the homologous recombination gene rad51 leads to Fanconi anemia-like symptoms in zebrafish. Proc Natl Acad Sci U S A. 2017;114(22):E4452–61. doi: 10.1073/pnas.1620631114 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref118] 118.Marcet-Ortega M, Pacheco S, Martínez-Marchal A, Castillo H, Flores E, Jasin M, et al. p53 and TAp63 participate in the recombination-dependent pachytene arrest in mouse spermatocytes. PLoS Genet. 2017;13(6):e1006845. doi: 10.1371/journal.pgen.1006845 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref119] 119.Feitsma H, Leal MC, Moens PB, Cuppen E, Schulz RW. Mlh1 deficiency in zebrafish results in male sterility and aneuploid as well as triploid progeny in females. Genetics. 2007;175(4):1561–9. doi: 10.1534/genetics.106.068171 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref120] 120.Ou Y, Li H, Li J, Dai X, He J, Wang S. Formation of different polyploids through disrupting meiotic crossover frequencies based on cntd1 knockout in zebrafish. Molecular Biol Evolution. 2024;41:msae047. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref121] 121.Poss KD, Nechiporuk A, Stringer KF, Lee C, Keating MT. Germ cell aneuploidy in zebrafish with mutations in the mitotic checkpoint gene mps1. Genes Dev. 2004;18(13):1527–32. doi: 10.1101/gad.1182604 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref122] 122.Liu Y, Kossack ME, McFaul ME, Christensen LN, Siebert S, Wyatt SR, et al. Single-cell transcriptome reveals insights into the development and function of the zebrafish ovary. Elife. 2022;11:e76014. doi: 10.7554/eLife.76014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref123] 123.Hill JT, Demarest BL, Bisgrove BW, Su Y-C, Smith M, Yost HJ. Poly peak parser: Method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products. Dev Dyn. 2014;243(12):1632–6. doi: 10.1002/dvdy.24183 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref124] 124.Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, et al. The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Res. 2024;52(W1):W521–5. doi: 10.1093/nar/gkae241 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref125] 125.Rhodes J, Amsterdam A, Sanda T, Moreau LA, McKenna K, Heinrichs S, et al. Emi1 maintains genomic integrity during zebrafish embryogenesis and cooperates with p53 in tumor suppression. Mol Cell Biol. 2009;29(21):5911–22. doi: 10.1128/MCB.00558-09 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref126] 126.Asana Marican HT, Sun LWH, Shen H. A Simple Method to Establish Metaphase Chromosomes from Individual Zebrafish Embryos. Zebrafish. 2021;18(5):338–41. doi: 10.1089/zeb.2021.0014 [DOI] [PubMed] [Google Scholar]

[pgen.1011656.ref127] 127.Preibisch S, Saalfeld S, Tomancak P. Globally optimal stitching of tiled 3D microscopic image acquisitions. Bioinformatics. 2009;25(11):1463–5. doi: 10.1093/bioinformatics/btp184 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011656.ref128] 128.Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596(7873):583–9. doi: 10.1038/s41586-021-03819-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Distinct cellular and reproductive consequences of meiotic chromosome synapsis defects in syce2 and sycp1 mutant zebrafish

Iván Olaya

Ilara N Yilmaz

Naima Nour-Kasally

Ross E Charboneau

Bruce W Draper

Sean M Burgess

Roles

Abstract

Author summary

Introduction

Results

Targeted mutation of syce2 and sycp1

Loss of Syce2 leads to asynapsis of interstitial regions of homologous chromosomes

Fig 2. Loss of Syce2 function results in asynapsed interstitial regions.

Formation and loss of co-aligned axes in sycp1-/- spermatocytes resembles wild-type chromosome behavior

Fig 3. Formation and loss of co-alignment in sycp1-/- spermatocytes.

Co-aligned axes but not synapsis in sycp1-/- oocytes

Different reproductive outcomes in syce2-/- and sycp1-/- mutants despite severe synapsis defects

Fig 4. syce2-/- and sycp1-/- mutants have different reproductive outcomes.

Sex ratios are altered in sycp1-/- mutants but not syce2-/- mutants

Fig 5. Normal sex ratios and gonad development in syce2-/- mutants but not sycp1-/- mutants.

Extending the sex-determination window by mutating dmrt1 rescues the male bias of sycp1-/- mutants

Spermatogenesis is blocked in sycp1-/- but not syce2-/- mutants

Fig 6. Spermatogenesis arrests at metaphase I/II in sycp1-/- males but not syce2-/- males.

Univalents are more common in sycp1-/- than syce2-/- mutants

Less efficient DSB repair in syce2-/- and sycp1-/- mutants

Fig 7. Inefficient DSB repair in syce2-/- and sycp1-/- mutants during prophase.

Hormad1 persists in partially synapsed syce2-/- bivalents

Fig 8. Sycp1 localization to synapsed-like regions is not sufficient for Hormad1 removal.

Discussion

Materials and methods

Ethics statement

Zebrafish husbandry

Mutant generation and identification

Genotyping

Protein alignment

RT-PCR

Sex ratios

Chromosome spread preparation and staining

Whole mount gonad and staining

Metaphase spreads

Imaging

Quantification of mean synapsed length and Sycp1 fluorescence intensity

Interaxis distance

Number of co-aligned sub-telomeric regions

Fertility testing and embryo tracking

Oocyte area

Caspase and metaphase area

Gonadosomatic index

Statistics

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Formation and loss of co-aligned axes in sycp1^-/- spermatocytes resembles wild-type chromosome behavior

Fig 3. Formation and loss of co-alignment in sycp1^-/- spermatocytes.

Co-aligned axes but not synapsis in sycp1^-/- oocytes

Different reproductive outcomes in syce2^-/- and sycp1^-/- mutants despite severe synapsis defects

Fig 4. syce2^-/- and sycp1^-/- mutants have different reproductive outcomes.

Sex ratios are altered in sycp1^-/- mutants but not syce2^-/- mutants

Fig 5. Normal sex ratios and gonad development in syce2^-/- mutants but not sycp1^-/- mutants.

Extending the sex-determination window by mutating dmrt1 rescues the male bias of sycp1^-/- mutants

Spermatogenesis is blocked in sycp1^-/- but not syce2^-/- mutants

Fig 6. Spermatogenesis arrests at metaphase I/II in sycp1^-/- males but not syce2^-/- males.

Univalents are more common in sycp1^-/- than syce2^-/- mutants

Less efficient DSB repair in syce2^-/- and sycp1^-/- mutants

Fig 7. Inefficient DSB repair in syce2^-/- and sycp1^-/- mutants during prophase.

Hormad1 persists in partially synapsed syce2^-/- bivalents