MiR-21 and MiR-155 Expressions in Oral Squamous Cell Carcinoma: A Retrospective Study in Mexican Patients using FFPE Biopsies

ABSTRACT

Aim:

Oral squamous cell carcinoma (OSCC) is a prevalent malignancy with poor survival outcomes, particularly in regions with high tobacco use and less early detection. MicroRNAs (miRNAs) such as miR-21 and miR-155 have been implicated in tumor progression and viral oncogenesis. This study aimed to evaluate the expressions of miR-21 and miR-155 in OSCC tissues and their association with histological differentiation and HPV infection in a Mexican population.

Materials and Methods:

This retrospective cross-sectional study included 30 OSCC cases and 30 age- and sex-matched healthy oral tissue controls. Total RNA was extracted from formalin-fixed paraffin-embedded tissue samples, and miR-21 and miR-155 levels were quantified using RT-qPCR. HPV genotyping (types 16 and 18) was performed via endpoint PCR. Statistical analysis included Mann–Whitney U test, Kruskal–Wallis test, and Fisher’s exact test. Effect sizes were calculated using Glass’s delta, and a significance level of P < 0.05 was applied.

Results:

MiR-21 and miR-155 were significantly upregulated in OSCC tissues compared to controls (P < 0.001 for both), with large effect sizes (Glass’s δ = 3.78 and 2.63, respectively). No significant association was found between miRNA expression levels and tumor differentiation grade (P > 0.05). HPV was detected in 26.6% of OSCC samples, with HPV-16 being the most frequent subtype. A significant association was observed between HPV positivity and tobacco use (P = 0.002), but not with miRNA expression levels.

Conclusion:

The overexpression of miR-21 and miR-155 in OSCC supports their potential as diagnostic biomarkers in oral cancer. While their levels were not significantly associated with tumor grade or HPV status, their consistent elevation in malignant tissues warrants further investigation into their mechanistic role in OSCC pathogenesis and their applicability in biomarker panels for early detection, especially in Latin American populations.

INTRODUCTION

Oral squamous cell carcinoma (OSCC) is the most prevalent cancer in the oral and maxillofacial area; its incidence is second after nasopharyngeal carcinoma.[1,2] Among the risk factors associated with this disease are the following: smoking or chewing tobacco, alcohol consumption, inappropriate oral hygiene, chronic mechanical trauma, as well as infection by human papillomavirus (HPV).[3]

Alterations in the texture, color, size, contour, integrity, or mobility of oral structures are the potential suspicious signs of OSCC. According to the American Cancer Society, asymptomatic individuals aged 20–40 should undergo head and neck cancer screenings every 3 years, while those over 40 should be screened annually. Individuals at high risk, such as smokers and alcohol consumers, are advised to have yearly examinations regardless of age.[4]

In México, the number of OSCC cases could be underestimated due to deficiencies in the health system such as the lack of a timely histopathological diagnosis. Therefore, the use of molecular markers could be a support for a timely diagnosis. In this sense, microRNAs are noncoding RNA molecules between 19 and 25 nucleotides in size, which function as post-transcriptional regulators of genes.[5] MicroRNAs have been used as molecular markers to diagnose diseases because they are detectable and quantifiable in cells, tissues, and organs, including blood tissues.[6] Because tumor cells can shed microRNAs into the bloodstream, these biomarkers have great potential for the timely diagnosis of many types of cancer.[7]

In cancer, there are metabolic changes including cellular inflammation, a phenomenon that modifies the expression patterns of microRNA-21 (MiR-21); and the subsequent activation of signaling pathways such as IRS/PI3K, IGF-1R/AKT, and mTOR, which promotes cell cycle progression, as well as cell angiogenesis, proliferation, and metastasis.[8] The increase in MiR-21 has been observed in the progression of oral carcinoma lesions and seems to reduce the expression of programmed cell death 4 (PDCD4) in OSCC, at the level of tumor size and depth.[9,10] Another microRNA of interest is MiR-155, an inhibitor of gene expression such as the following: SHIP1, WEE1, VHL, and TP53INP1 and genes from the PU.1, BCL2, and SOX families, involved in tumorigenesis processes.[11,12] This microRNA serves as a proto-oncogene, whose overexpression has been linked to OSCC development as well as its progression and prognosis.[13,14]

Considering this background, both microRNAs could be biomarkers for OSCC taking into account the potential of these microRNAs in the early diagnosis of cancer,[15,16] especially in resource-limited settings. Therefore, MiR-21 and MiR-155 were measured in formalin-fixed paraffin-embedded (FFPE) from patients diagnosed with OSCC. Expression levels of microRNAs were analyzed against samples from healthy patients as well as the grade of histological differentiation. All patients were from the Mexican Altiplano Region.

MATERIALS AND METHODS

SELECTION OF SAMPLES

Specimens of 30 paraffin-embedded biopsies from patients diagnosed with OSCC between 2017 and 2020 were selected. As the number of available cases was limited in that period, 30 samples were also collected for the control group, which corresponded to oral mucosa samples from healthy subjects with indications for extraction of a lower third molar; all participants consented to participate in the study and signed an informed consent. The controls were confirmed by histological diagnosis. Only samples that had a complete clinical history were included. Inclusion criteria consisted of simples from adults aged 18 years or older who had a complete clinical history. Control group patients who did not sign the informed consent or declined participation were excluded from the study. Before this project was executed, bioethical approval was obtained from a bioethics committee complying with the guidelines of Helsinki Declaration (approval number 58-16, CONBIOETICA-24-CEI-001-20160427, General Hospital Ignacio Morones Prieto, City of San Luis Potosí).

RNA ISOLATION FROM PARAFFIN-EMBEDDED BIOPSIES

For RNA isolation, an FFPE RNA purification kit was used, following the supplier’s instructions (Norgen Biotek Corp, Ontario, Canada). Briefly, for deparaffinization, it was cut into 20-µm-thick sections from the tissue block with a microtome. Each section was cut from the interior to minimize RNA damage and then was transferred into an RNase-free microcentrifuge tube. 1 mL of xylene was added, vortexed, and incubated at 50°C for 5 min. Subsequently, the sample was centrifuged at 14,000 × g in a refrigerated microcentrifuge (HERMLE Labortechnik GmbH model Z216MK, USA) for 2 min. After this, the xylene was removed, and 1 mL of absolute ethanol was added to the pellet and mixed with a vortex. The sample was centrifuged again for 2 min at 14,000 × g, and the ethanol was removed. The procedure was carried out two times, and afterward, the pellet was air-dried at room temperature until the ethanol was completely evaporated. For lysate preparation, 300 µL of digestion buffer (buffer A) and 10 µL of proteinase K were added and mixed using a vortex and was incubated 15 min at 55°C, 15 min at 80°C for 15 min and vortexing. Finally, 300 µL of buffer RL and 600 µL of absolute ethanol were added. Total RNA was recovered after passing it through a minicolumn using wash and elution solutions, respectively. The recovered RNA was aliquoted to 25 ng/ µL.

EXPRESSION OF MICRORNAS BY RT-QPCR

The expressions of MiR-21 and MiR-155 were analyzed by real-time RT-qPCR assay using TaqMan probes. Previously, cDNA was obtained using TaqMan^® MiRNA Reverse Transcription Kit and MiRNA-specific stem-loop primers (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. The cDNA was subsequently amplified (Real-time PCR assay, Applied Biosystems, Foster City, CA, USA), according to the following reaction mixture: 450 ng/μL of cDNA (4.5 μL), 5 μL of TaqMan Universal PCR Master Mix, and 0.5 μL of TaqMan MiRNA Assay primers (Applied Biosystems, Foster City, CA, USA). The amplification conditions were as follows: a previous denaturation step at 95°C for 10 min, 40 cycles at 95°C (15 s), and 60°C (60 s). All samples were analyzed in duplicate. The relative miRNA expression values were individually normalized to cel-MiR-39 and calculated by 2^−Ct.[17]

HPV TYPING

DNA purification was carried out using the Wizard^® Genomic DNA Purification Kit (Promega). Only HPV-16 and HPV-18 were typed considering that they are very high-risk genotypes. The sequence of the oligonucleotides used is as follows: direct oligonucleotide E6-HPV-16: 5′-AATGTTTCAGGACCCACAGG-3′ and reverse oligonucleotide E6-HPV-16: 5′ - GTTGCTTG CAGTACACACATTC-3′; direct oligonucleotide E6-HPV-18: 5′ -ACCCTACAAGCTACCTGATCT-3′ and reverse oligonucleotide E6-HPV-18: 5′ - ACCTCTGTAAGTTCCAATACTGTC3′. For real-time PCR amplification, a StepOne Real-Time PCR System was used (Thermo Fisher Scientific). The reaction mixture for the PCR was as follows: 7 PMol/µL and 5 PMol/µL of the direct and reverse oligonucleotide, respectively; 5 µL of SYBR Green (Real-time PCR Master Mix, Thermo Fisher Scientific), and 50 ng/µL of DNA previously purified from the samples. The mixture was adjusted to a final volume of 10 µL with sterile H₂O. The amplification conditions were as follows: an initial cycle at 95°C for 15 min and 40 cycles at 95°C for 5 s, 60°C for 30 s, and a final step at 72°C for 15 s. A negative control was performed consisting of a PCR without DNA; while a positive control consisted of the amplification of a fragment of the human β-globin gene using the following oligonucleotides: PCO4: 5-CAACTTCATCCACGTTCACC −3′, and GH20: 5′-GAAGAGCCAAGGACAGGTAC-3.

HISTOPATHOLOGICAL IMAGING AND ANALYSIS OF THIN TISSUE SLICES

The diagnosis was confirmed by a pathologist using light microscopy, according to the grade of histological differentiation,[18] taking into account the similarity or lack of similarity with the Malpighian epithelium from which it is derived. Three grades of histological differentiation in OSCC were considered: well, moderately, and poorly differentiated [Table 1].

Table 1.

Classification of grades of histological differentiation by light microscopy

Grades	Microscopic images of histological slides	Classification criteria
Well-differentiated		Morphology is like the Malpighian squamous epithelium from which it is derived. Tumor cells retain their ability to produce keratin, generating pearls or corneal globules in well-defined areas. Mitoses are moderate, and there is little cellular atypia. A peritumoral infiltrate appears frequently. Cancer cells with a nucleus–cytoplasm relationship between 0.5 and 0.7, cells with keratinized reddish or orange cytoplasm.
Moderately differentiated		Increase in mitosis and decrease in cellular keratinization. Loss of their ability to produce corneal globules. The tumor infiltrate is decreasing. There are few cells with hyperchromatic nuclei, and the nucleus–cytoplasm ratio is greater than or equal to 0.7
Poorly differentiated		Cells with loss of keratoblastic activity and similarity to the cells from which they come. Breakdown of intercellular adhesion facilitating metastasis. Very different morphology to epithelial cells. Loss of the nucleus–cytoplasm ratio, which is greater than 0.7; they have a hyperchromatic nucleus and unrecognizable shapes.

Parameters based on Broder’s histological classification, modified by the World Health Organization in 2005.[18]

STATISTICAL ANALYSIS

Means and standard deviations were calculated for the parametric variables studied,

and frequencies and percentages were reported for some variables. Likewise, variables were compared between cases and controls though a Fisher’s exact test. Nonparametric tests were used both to compare microRNA expressions between cases and controls, as well as among the grade of histological differentiation (Mann–Whitney U and Kruskal–Wallis tests, respectively). The effect size (strength of a relationship between variables) was calculated using Glass’s δ with the formula: δ = (M1-M2)/SD control, where M1 and M2 represent the average of the cases and controls respectively,

and SD control is the standard deviation of the control group.

P values less than 0.05 were considered statistically significant. All results were analyzed using an SPSS Version 23.0 statistic software package.

RESULTS

A case–control retrospective study was carried out including 30 samples from patients diagnosed with OSCC, and 30 control samples corresponding to healthy subjects with indications for extraction of a lower third molar. Table 2 shows the comparative analysis between cases and controls. Age was statistically different between the two groups; the highest frequency of cases occurred in the age group between 60 and 79 years. Educational level and smoking habits also statistically differed between groups; the cases had a lower educational level and higher tobacco consumption. The cancerous lesions were significantly located in the tongue.

Table 2.

Description of the study group

	Case group mean (±SD) n (%)	Control group mean (±SD) n (%)	P-value
Age (years)	60.7 (17.43)	32.9 (12.93)	<0.001
<20	–	3 (10)
20–39	4 (13.3)	18 (60)
40–59	9 (30)	8 (26.7)
60–79	13 (43.3)	1 (3.3)
˃80	4 (13.3)	–
Total	30 (100)	30 (100)	<0.001
Gender
Men	20 (66.6)	14 (46.6)
women	10 (33.4)	16 (53.4)	0.1923
Education level*
Less than basic	4 (13.3)	–
Basic and intermediate	22 (73.4)	13 (43.3)
Advanced	4 (13.3)	17 (56.7)	<0.001
Body mass index	26.2 (19.0)	24.9 (4.1)	0.36
Tobacco consumption
Yes	20 (65)	7 (23.3)
No	10 (35)	23 (76.7)	0.0016
Localization of cancer
Lower lip	3 (10)	–	–
Tongue	19 (63.4)	–
Mandibular	3 (10)	–
Maxilla	3 (10)	–
Hard palate	1 (3.3)	–
Floor of mouth	1 (3.3)	–

^*According to the international standard classification of education (ISCED)

The histological differentiation grade classification was performed by microscopic analysis of histological slides [Table 1]; 63.3% of the carcinomas were moderately differentiated, 26.7% well differentiated, and only 10% poorly differentiated. Tobacco consumption was reported for all classifications, while alcohol consumption was reported only for well and moderate differentiation. Likewise, HPV 16 was detected in samples of all classifications, but HPV 18 was detected only in well and moderately differentiated carcinomas. Both types, 16 and 18 were detected in a single sample of moderately differentiated carcinoma [Table 3].

Table 3.

Grade of oral squamous cell carcinoma and risk factors associated

Grade of histological differentiation n (%)		Risk factors
		Tobacco consumption*	Alcohol consumption*	HPV infection*
				HPV16	HPV18	HPV16 + 18
Well differentiated	8 (26.7)	2	2	2	1	–
Moderately differentiated	19 (63.3)	11	12	1	5	1
Poorly differentiated	3 (10)	1	0	1	–	–

^*Number of individuals

The relative expressions of MiR-21 and MiR-55 were significantly higher in cases than in controls [Figure 1]. A large effect size with a Glass’s delta value ≥ 0.8 was observed for the expressions of both microRNAs analyzed between the two study groups. However, when the expression levels of these microRNAs were analyzed in the case group by grade of histological differentiation, no statistically significant differences were observed among well, moderately, and poorly differentiated carcinomas [Figure 2].

Figure 1.

Comparison of the relative expression of MiR-21 (panel A) and MiR-55 (panel B) between case and control groups. *Mann–Whitney U test

Figure 2.

Comparison of the relative expression of MiR-21 (panel A) and MiR-55 (panel B) among the grade of histological differenciation. Kruskal–Wallis test

DISCUSSION

The incidence of OSCC in México is increasing and reaches up to 5% among malignant neoplasms.[19] The insufficient Latin American public healthcare systems as well as lack of timely diagnosis favors this statistic. Under this context, we proposed a retrospective study to identify molecular markers such as microRNAs isolated from paraffin-embedded biopsies and evaluate expression levels between OSCC cases and controls, in samples of patients coming from the Altiplano region of México. MiR-21 and MiR-155 were chosen because they are noncoding RNAs involved in the development of cancer.[20]

Samples from 30 patients diagnosed with OSCC were compared against 30 samples from healthy individuals. As seen in Table 1, the frequency of cases is greater with older age, and the male cases were twice as many as the female cases, in accordance with reports that indicate age and male sex are risk factors for OSCC.[21,22] Also, the educational level is a factor that influences oral health;[23] indeed, the cases had a lower educational level compared to the controls. Another risk factor involved in OSCC is tobacco consumption;[24] in this study, the frequency of smoking was higher among cases than among controls. Regarding the localization of cancer, 63.4% of cancerous lesions were located on the tongue, as reported in India, where oral tongue cancer had the highest incidence[25] OSCC was classified by the grade of histological differentiation, well, moderately, and poorly differentiated according to the Broder’s histological classification, modified by the World Health Organization in 2005 [Table 1].[18]

Regarding head and neck carcinomas, there are carcinomas associated with HPV called classic because they are caused by tobacco and alcohol consumption, being mainly squamous in nature. HPV 16 is the most prevalent virus in oropharynx squamous carcinoma, detected in 70% of cases, followed by HPV 33 and HPV 18.[26] Regarding carcinoma of the oral cavity and larynx, HPV 16 is also the most prevalent virus (25–30% of cases).[26] In fact, HPV 16 and 18 have been detected in some samples [Table 3]; however, we only used oligonucleotides for the detection of these two types. Therefore, those samples where these viral types were not detected could contain other HVPs such as AR, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68.[27]

Expression levels of MiR-21 and MiR-55 were compared between cases and controls, as well as among grades of histological differentiation for OSCC. Both MiRNAs were overexpressed in cases, but no differences were observed by grade of histological differentiation [Figures 1 and 2]. MiR-21 is involved in the oncogenic process since this MiRNA has different target genes regulating tumorigenesis. Previous studies have reported an overexpression of MiR-21 in tissue specimens of OSCC from different sub-sites including the tongue, buccal mucosa, and gingivo buccal sulcus,[28,29] as well as in plasma where MiR-21 was associated with tumor size, metastasis, and local invasion.[30] Also, MiR-21 expression has been associated with poor patient survival.[31] However, differential expression of MiR-21 in saliva from patients with OSCC could not be detected up to this point.[32]

In addition, MiR-155 is regulator of inflammatory pathways and contributes to the pathogenesis of several cancers.[33] MiR-155 can modulate the immune response and the cell cycle though the downregulation of INPP5D and WEE1 G2 checkpoint kinase, respectively.[12] Specifically in OCSS, MiR-155 is overexpressed and consequently negatively regulates p27Kip1, a molecule that inhibits cell proliferation by cell cycle arrest in the G1 phase.[34] The overexpression of MiR-155 has been observed both in cell cultures as well as tumor tissues from patients with OCSS.[35,36]

In concordance with these findings reported, both MiR-21 and MiR-155 were mostly expressed in samples from patients with OSCC. In fact, some meta-analyses propose that MiR-21 and MiR-155 could be promising prognostic and predictive biomarkers of survival for head and neck squamous cell carcinomas.[37,38]

The relationship between OCSS–miRNAs-VPH has been little studied. VPH can specifically change the expressions of tumor and oncogenic suppressor miRNAs, which in turn can promote tumor progression. Additionally, virus interaction with miRNAs aids in the evasion of cell regulatory mechanisms and resistance to apoptosis, which makes it easier for oral epithelial cells to undergo malignant changes.[39,40] MiR-21 may contribute to HPV-mediated carcinogenesis by influencing cellular processes; this is increased in cervical cancer. Given HPV16 is the most prevalent form of HPV in OSCC and cervical squamous cell carcinomas, and that this viral type is an important risk factor for these types of cancer because of their persistent nature, MiR-21 could be a relevant marker for prognosis.[41,42,43]

On the other hand, nowadays, the application of the HPV vaccine is a great tool to prevent all HPV cancers.[44] In addition to helping identify diagnostic and prognostic biomarkers, understanding these molecular mechanisms provides new insights for the development of targeted therapies for HPV-associated OSCC.

Some limitations of this study are as follows: a discrete sample size; the data are from a single geographic region, limiting generalizability of findings to other populations; and in vitro assays were not performed to corroborate expression levels in cell lines. In conclusion, this is the first report of OCSS in the Mexican Altiplano Region where two microRNAs were measured from paraffin-embedded biopsies, finding an overexpression of MiR-21 and MiR-155. Our results aim to contribute to the improvement of early detection of oral cancer in México; the integration of MiRNA-based screening may improve early detection of OCSS in marginalized communities and complement existing diagnostic approaches.

CONFLICTS OF INTEREST

There are no conflicts of interest.

ETHICAL POLICY AND INSTITUTIONAL REVIEW BOARD STATEMENT

This study was approved by a bioethics committee of the General Hospital Ignacio Morones Prieto of San Luis Potosí, approval number: CONBIOETICA-24-CEI-001-20160427, 58-16, in compliance with the Helsinki Declaration.

PATIENT DECLARATION OF CONSENT

Not applicable.

DATA AVAILABILITY STATEMENT

The data set used in the current study is available upon request at ja.alegriatorres@ugto.mx.

Authors contributions

Not applicable.

SUPPLEMENTARY DATA

RNA purification and RT-qPCR. RNA was used at a concentration of 200 ng/μL and transcribed to cDNA using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster city, CA, EUA). The reaction mixture had a total volume of 15 µL, which contained 7 µL of MasterMix, 3 µL of 5X probe, and 5 µL of diethylpyrocarbonate. The reaction was carried out in the Techer TC-512 Thermal Cycler equipment under the following conditions: 16°C for 30 min, 42°C for 30 min, 85°C for 5 min and stored until use at 4°C. cDNA quantification was performed using BioTek’s PowerWave HT Microplate equipment. MiRNA expression was determined by qRT-PCR using TaqMan probes. The cDNA was used at a concentration of 200 ng/µL.

Probes sequences. The probes used were MiR -21 (5´-UAGCUUAUCAGACUGAUG-3´) and MiR-155 (5´-UUAAUGCUAAUCGUGAUAGGGG UU-3´), and MiR-U6 was used as an endogenous control. For each sample, 8 µL of MasterMix was prepared, and 2 µL of cDNA was added, for a total volume of 10 µL. Amplification was done in 40-well microplates. PCR conditions were as follows: 95 °C for 10 min, followed by 40 cycles at 95 °C for 10 s and 60 °C for 1 min utilizando el equipo StepOne Real-Time PCR systems (Applied Biosystems, Thermo Fisher).

Ct calculation. Relative expression was calculated using the comparative threshold (Ct) method, for which ΔΔCt was obtained to obtain the relative expression of the miRNAs studied. The determinations were performed in duplicate.

2-^ΔΔCt

2 = Represents the maximum efficiency of PCR.

Ct= Cycle in which there is a detectable amount of DNA, that is, it exceeds the basal fluorescence threshold.

Calculation of ΔΔCt:

ΔCt = Ct problem gene – Ct endogenous gene.

ΔΔCt= ΔCt cases – ΔCt control

The result shows the relative increase in the number of transcripts of a stimulated or supplemented gene with respect to the gene without the disease.

Funding Statement

Nil.