Skip to main content
Poultry Science logoLink to Poultry Science
. 2025 Aug 29;104(11):105755. doi: 10.1016/j.psj.2025.105755

Effects of silencing or overexpression of ZIP3 and ZIP5 on zinc absorption as zinc sulfate or zinc proteinate and related gene expressions in primary duodenal epithelial cells of broilers

Chunyu Cao a,1, Yun Hu a,1, Liang Huang b, Weiyun Zhang a, Xi Lin c, Wei Wu a, Tingting Li a, Xiaoyan Cui a, Shengchen Wang a, Liyang Zhang b, Xugang Luo a,
PMCID: PMC12433513  PMID: 40902351

Abstract

Three Experiments were conducted to explore whether zrt/irt-like protein 3 (ZIP3) and ZIP5 were directly involved in zinc (Zn) absorption as Zn proteinate with moderate chelation strength (ZnP M) in broiler primary duodenal epithelial cells. In Experiment 1, siRNAs against ZIP3 or ZIP5 were transfected into cells, and the most effective siRNA was selected. In Experiment 2, with or without the most potent siRNA, cells were exposed to a basal medium without Zn (Control) or added with 400 umol/L of Zn as Zn sulfate (ZnS) or ZnP M for 120 min. In Experiment 3, with or without the recombinant adenovirus plasmid encoding ZIP3 or ZIP5, cells were treated with the same mediums as in Experiment 2. The data from Experiment 1 demonstrated that the si-230/si-1384 was the most effective (P < 0.0001) in reducing ZIP3/ZIP5 mRNA expression. The results from Experiment 2 showed that ZIP3 silencing did not affect (P > 0.05) Zn absorption for the added ZnS, but decreased (P < 0.05) Zn absorption for the added ZnP M. The ZIP5 silencing reduced (P < 0.05) Zn absorption for the addition of either ZnS or ZnP M, where the decrease of Zn absorption was higher for ZnP M than for ZnS. The results in Experiment 3 showed that ZIP3 overexpression did not influence (P > 0.05) Zn absorption for the added ZnS, but increased (P < 0.05) Zn absorption for the added ZnP M. The ZIP5 overexpression promoted (P < 0.05) Zn absorption for the addition of either ZnS or ZnP M, but the promotion of Zn absorption was greater for ZnP M than for ZnS. Additionally, ZnP M enhanced (P < 0.05) ZIP3 or ZIP5 protein expression, and ZnS increased (P < 0.05) ZIP5 protein expression, regardless of ZIP3 or ZIP5 silencing or overexpression. It is concluded that both ZIP3 and ZIP5 directly participate in Zn absorption as ZnP M, and ZIP5 is also involved in Zn absorption as ZnS within the cells.

Keywords: Zn absorption, ZnP M, ZIP3 and ZIP5, Gene expression, Broiler primary Duodenal epithelial cell

Introduction

Zinc (Zn) is a vital trace mineral and plays a crucial role in supporting the normal physiological functions of animals (Diao et al., 2021; Dong et al., 2022). As a component or activating factor of more than 300 enzymes or functional proteins in the body, Zn is involved in the syntheses of DNA, RNA and protein in the body, which can affect signal transduction and hormone synthesis and secretion, regulate the homeostasis of redox system and cytokine secretion, and improve antioxidant and immune functions (Salim et al., 2008; Navidshad et al., 2016; Hu et al., 2024a). The Zn deficiency in poultry diets can lead to decreased growth performance and impaired antioxidant or immune functions (Swiatkiewicz and Koreleski, 2001; Ogbuewu and Mbajiorgu, 2023; Hu et al., 2024b). Typically, Zn is supplemented in broiler diets to prevent Zn deficiency and meet Zn requirements of animals for growth and many other aspects.

The Zn source added to poultry diets is often inorganic Zn sulfate (ZnS). Nevertheless, ZnS has low absorption and utilization efficiencies in livestock and poultry, and unabsorbed Zn is excreted out of the body and causes potential environmental pollution (Zhang et al., 2022). Therefore, in the past few years, there has been an increasing interest in developing and applying alternative sources of Zn that are more bioavailable and less likely to cause environmental pollution, such as organic Zn sources (Hollis et al., 2005; Huang et al., 2009; Huang et al., 2009, 2013; Yu et al., 2017; Winiarska-Mieczan et al., 2024). Previous studies have shown that Zn bioavailability differs among inorganic sources and organic Zn has a higher bioavailability and Zn absorption than inorganic Zn, due to different solubilities and stronger resistance to anti-nutritional factors such as phytic acid in feeds (Cao et al., 2000a, b; Schlegel and Windisch, 2006; Li et al., 2019). Cao et al. (2000a, b) found that Zn bioavailability of Zn oxide was significantly lower than those of ZnS, basic ZnS and basic Zn chloride in broiler chicks because of its low solubilities in 2% citric acid and neutral ammonium citrate solutions, and Zn bioavailabilities of organic Zn sources in broiler chicks and lambs were negatively correlated with their solubilities in a pH 5 buffer solution and a pH 2 buffer solution, respectively. Li et al. (2019) reported that compared to ZnS, Zn-binding peptides could partially counteract the inhibitory effect of phytic acid on Zn absorption in Caco-2 cells. Schlegel and Windisch (2006) demonstrated that the bioavailability of dietary Zn glycinate in rats was superior to that of ZnS, primarily because its absorption potential remained high even when strong antinutritional factors such as phytic acid were present in the diet. Our previous studies indicated that organic Zn sources had varying bioavailabilities and Zn absorptions for broilers, which is determined by their quotient of formation (Qf) values (chelation strengths) between Zn and ligands (Huang et al., 2009, 2013; Yu et al., 2010, 2017; Hu et al., 2022). It was found that Zn absorptions of organic Zn sources with moderate or strong Qf values were more effective than those of ZnS and the organic Zn source with weak Qf value in ligated duodenal segments or the intestine of broilers (Yu et al., 2010, 2017; Hu et al., 2022), and these differences were more profound under high phytate condition (Yu et al., 2010). Huang et al. (2009, 2013) discovered that the organic Zn proteinate characterized by a moderate Qf value exhibited greater bioavailability for broilers compared to both ZnS and organic Zn sources that had weak or strong Qf values, particularly under high phytate diet. Nevertheless, specific modes of the Zn absorption as the organic Zn source with the moderate Qf are not known. Therefore, understanding the absorption modes of the organic Zn with moderate Qf in the small intestine of broilers could aid in developing more absorbable organic Zn sources for broiler production.

Both Zn transporters (ZnTs) and zrt/irt-like proteins (ZIPs) are the two functionally complementary solute transporters involved in assimilating Zn from the lumen of the small intestine (Yang et al., 2017; Ikeda et al., 2022; Feng et al., 2024). In mammals, 10 ZnT transporters (ZnT1-ZnT10) and 14 ZIP transporters (ZIP1-ZIP14) have been identified. The ZnTs transport the Zn from the cytosol to intracellular vesicles or the extracellular compartments, whereas ZIPs carries Zn in the opposite direction to ZnTs (Kambe et al., 2004; Myers et al., 2017). In our latest studies, we found that Zn proteinate with moderate chelation strength (ZnP M) enhanced Zn absorption in broilers' small intestine (Hu et al., 2022; Hu et al., 2023) or primary duodenal epithelial cells compared with the ZnS, which might be associated with the increase of ZIP3 and ZIP5 protein expression levels (Hu et al., 2024a). Kelleher and Lönnerdal (2005) reported that ZIP3 silencing decreased the uptake of Zn by mammary epithelial cells. Nagamatsu et al. (2022) observed that ZIP5 overexpression increased Zn content in the human osteosarcoma cells. The above studies suggested that ZIP3 and ZIP5 might be essential for Zn absorption. However, it is not clear whether ZIP3 and ZIP5 directly participate in Zn absorption as ZnP M in broilers' small intestine.

Therefore, we hypothesized that ZIP3 or ZIP5 silencing would reduce Zn absorption in the form of ZnP M compared to ZnS, and ZIP3 or ZIP5 overexpression would increase Zn absorption in the form of ZnP M compared to ZnS, and thus both ZIP3 and ZIP5 play a direct role in promoting Zn absorption as ZnP M in broiler primary duodenal epithelial cells. To verify the hypothesis mentioned above, the current study aimed to explore how ZIP3 and ZIP5 gene silencing or overexpression affects Zn absorption as ZnS or ZnP M and their gene expressions in broiler primary duodenal epithelial cells.

Materials and methods

Animal ethics

Experimental protocols were approved by the Animal Ethics Committee of Yangzhou University (approval number: SYXK (Su) 2021-0027).

Separation and culture of primary duodenal epithelial cells of broiler embryos

Eighteen-day-old broiler embryos were utilized to extract the duodenal epithelial cells as previously described (Zhang et al., 2018). Duodenal cells were selected because our previous studies have demonstrated that Zn absorption is a saturable carrier-mediated process in ligated duodenal segments, and organic Zn absorption is significantly higher than inorganic Zn absorption in ligated duodenal segments or primary duodenal epithelial cells of broilers, coinciding with increased expressions of ZIP3 and ZIP5 (Yu et al., 2010, 2017; Hu et al., 2022, 2024a). The separated duodenal epithelial cells were plated in six-well Transwell plates (3450, Corning, USA), and then incubated in a complete culture medium prepared with DMEM/F12 medium (Gibco, Grand Island, USA) and supplemented with 3% fetal bovine serum, 1% penicillin-streptomycin solution, 20 ng/mL epidermal growth factor, 100 μg/mL heparin sodium, and 5 μg/mL insulin. The cells were cultured at 37°C in a carbon dioxide incubator (Heracell 150i, Thermo, USA) with 5% CO2 for 48 h in Experiment 1 and for 50 h in Experiments 2 and 3 (with Zn treatment during the final 2 h).

Experimental design, cell culture, sample collections, and preparations

Experiment 1 was conducted to determine the inhibitory efficiencies of siRNAs against ZIP3 or ZIP5 in order to select the most effective siRNAs to be used for subsequent Experiments. Firstly, the DSIR platform (http://biodev.extra.cea.fr/DSIR/DSIR.html) was employed to design initial siRNAs, then the three top-scoring sequences targeting either ZIP3 or ZIP5 were selected, and finally commercially synthesized by GenePharma (Shanghai, China). The specific primer sequences are shown in Table 1. This Experiment consisted of two sub-Experiments 1A and 1B. There were a total of 5 treatments in a completely randomized design for each sub-Experiment with 6 replicate wells for each treatment. The treatments in sub-Experiment 1A included blank group (Blank), negative control siRNA group (NC), si-230, si-551 and si-989 groups. A blank control was used to exclude the toxicity or non-specific effect of the transfection process itself, while a negative control siRNA (such as one with a scrambled sequence) was used to rule out off-target effect caused by the siRNA. The treatments in sub-Experiment 1B included Blank, NC, si-1384, si-1980 and si-2186 groups. Once the primary duodenal epithelial cells of broilers grew to 80% confluence at 12 h after seeding and during cultivation, the transfection into duodenal epithelial cells was performed using GoldenTran-R transfection reagent (Jinchuan Technology, Changchun, China) according to the following specifications on cell transfection. Measurements of trans-epithelial electrical resistance (TEER) and phenol red transmittance were conducted employing the methodologies described in prior studies to evaluate the duodenal epithelial cells' integrity at 36 h of transfection (48 h following seeding) (Cao et al., 2020; Hu et al., 2024a). A commercial lactate dehydrogenase (LDH) kit (Nanjing Jiancheng Bioengineering Institute, China) was utilized to evaluate the LDH activity within the complete culture medium, serving as an indicator of cell integrity at 36 h post-transfection. The absorption model was deemed successful only when the monolayers of duodenal epithelial cells achieved a TEER greater than 300 Ω cm², a phenol red transmittance of less than 5%, and LDH activity under 400 U/L (Zhang et al., 2018; Hu et al., 2024a). In Experiment 1A, the results showed that the TEER values and phenol red transmittances for the cells were measured at 405 ± 7 Ω·cm² and 1.58 ± 0.12% (n = 3), while in Experiment 1B, the corresponding values were 408 ± 7 Ω·cm² and 1.32 ± 0.26 % at 36 h of transfection, respectively. The LDH activities in the complete culture medium were 340 ± 35 U/L (n = 3) in Experiment 1A, and 321 ± 17 U/L (n = 3) in Experiment 1B at 36 h of transfection, respectively. These data indicated that siRNA transfection didn't influence the cell monolayers' integrity of the duodenal epithelium at 36 h of transfection. Then the cells were collected and prepared as described before (Hu et al., 2024a) for assays of the mRNA expression level of ZIP3 or ZIP5.

Table 1.

The siRNA primers used for the target and reference genes.

Target and reference genes siRNAs Sense (5´→3´) Anti-sense (5´→3´)
ZIP31 si-230 CUGCCAAAGUGCUGUGUCUTT AGACACAGCACUUUGGCAGTT
si-551 AGACACAGCACUUUGGCAGTT AGACACAGCACUUUGGCAGTT
si-989 CCGGCAACAUCACUUCUCUTT AGAGAAGUGAUGUUGCCGGTT
ZIP51 si-1384 CAGCUGAUCUGGUGUGGAUTT AUCCACACCAGAUCAGCUGTT
si-1980 CCCGGGUGUUUGCCAAGAUTT AUCUUGGCAAACACCCGGGTT
si-2186 CAACAGAAGAGGGAGUAGATT UCUACUCCCUCUUCUGUUGTT
NC1 NC-siRNA UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
FAM1 FAM-siRNA FAM-UUCUCCGAACGUGUCACGUTT FAM-ACGUGACACGUUCGGAGAATT
1

ZIP3, Zrt-irt-like protein 3; ZIP5, Zrt-irt-like protein 5; NC, negative control; FAM, fluorescein phosphoramidite.

Experiment 2 was carried out to explore the effect of ZIP3 or ZIP5 silencing on Zn absorption and related indices in broiler primary duodenal epithelial cells in order to address whether ZIP3 or ZIP5 was directly involved in Zn absorption as ZnP M using the above absorption model. Therefore, Experiment 2 contained two sub-Experiments 2A and 2B. A completely randomized design involving a 2 (cell type) × 3 (Zn source) factorial arrangement of treatments was used in both Experiments 2A and 2B. The 2 cell types were control cells transfected with NC-siRNA and ZIP3 or ZIP5 silenced cells (transfected with si-230 or si-1384). The 3 Zn sources were no Zn, ZnS (ZnSO4.7H2O) and ZnP M (feed grade, Qf=51.6, with a Zn content of 17.09% as per analysis), respectively, and the supplemental Zn level was 400 μmol/L based on the results of Hu et al. (2024a). Therefore, there were in total 6 treatments in each sub-Experiment with 6 replicates for each treatment. At 36 h of transfection, the cells were thrice rinsed with 37°C DMEM/F12 media. Then, 1.5 mL of the complete culture media with no Zn addition (2.69/3.06 μmol/L Zn according to analysis in Experiments 2A/2B) or Zn-supplemented 400 μmol/L Zn as ZnS (394/391 μmol/L Zn according to analysis in Experiments 2A/2B) or ZnP M (393/391 μmol/L Zn according to analysis in Experiments 2A/2B) was added to the apical chamber of each well in the 6-well Transwell plates. Moreover, 2.6 mL of DMEM/F12 media (1.58/1.59 μmol/L Zn according to analysis in Experiments 2A/2B) with no Zn addition was added to its receiver chamber. Following Zn treatments, the cells underwent incubation within a carbon dioxide incubator (Heracell 150i, Thermo, USA) for 120 min according to our earlier study (Hu et al., 2024a). At 120 min of incubation, all DMEM/F12 medium (approximately 2.6 mL) were collected from the receiver chamber of each well to measure Zn concentration. The cell monolayers' integrity was also evaluated as previously described. The cells were collected and prepared as described before (Hu et al., 2024a) for determining ZIP3 or ZIP5 mRNA and protein expression levels.

A preliminary Experiment was conducted to examine the effect of adenovirus infection on broiler primary duodenal epithelial cells' integrity before Experiment 3. The data showed that the TEER value was 398 ± 14 Ω·cm2 and phenol red transmittance was 1.97 ± 0.15 % (n = 3) of the cells, and the complete culture medium's LDH activity was 331 ± 24 U/L (n = 3) at 36 h of adenovirus infection (48 h following seeding), indicating that adenovirus infection did not influence the monolayer integrity of cells. Then, Experiment 3 was carried out to explore how ZIP3 or ZIP5 overexpression affected Zn absorption and related indices in broilers' duodenal epithelial cells. Experiment 3 consisted of two sub-Experiments 3A and 3B. A completely randomized design involving a 2 (cell type) × 3 (Zn source) factorial arrangement of treatments was used in both Experiments 3A and 3B. The 2 cell types were control cells infected with the empty adenovirus and ZIP3 or ZIP5 overexpressed cells with recombinant adenovirus plasmid encoding ZIP3 or ZIP5. The 3 Zn sources and the supplemental Zn level were the same as in Experiment 2. Therefore, there were totally 6 treatments in each sub-Experiment with 6 replicates for each treatment. At 36 h of infection, the cells were treated with 1.5 mL of the complete culture media with no Zn addition (3.03/3.05 μmol/L Zn according to analysis in Experiments 3A/3B) or Zn-supplemented 400 μmol/L Zn as ZnS (400/395 μmol/L Zn according to analysis in Experiments 3A/3B) or ZnP M (398/402 μmol/L Zn according to analysis in Experiments 3A/3B) and 2.6 mL of DMEM/F12 media with no Zn addition (1.72/1.39 μmol/L Zn according to analysis in Experiments 3A/3B) for 120 min as described in Experiment 2. At 120 min of incubation, all DMEM/F12 medium (approximately 2.6 mL) were collected from the receiver chamber of each well to measure Zn concentration. The cell monolayers' integrity was also evaluated as previously described. The cells were collected and prepared as described before (Hu et al., 2024a) for determining ZIP3 or ZIP5 mRNA and protein expression levels.

Specifications on cell transfection and infection

For siRNA Experiments, when broiler primary duodenal epithelial cells reached 80% confluence, transfection was performed in line with the instructions of GoldenTran-R transfection reagent. Firstly, 4 μL of siRNA and 46 μL of Opti-MEM medium were mixed to prepare siRNA dilution, and 4 μL of GoldenTran-R and 46 μL of Opti-MEM medium were mixed to prepare transfection reagent working solution. Then 50 μL of siRNA dilution and 50 μL of transfection reagent working solution were combined and kept at room temperature for a period of 20 min to create siRNA complex solution. Finally, 100 μL of siRNA complex solution was added to the 6-well Transwell plate, and then mixed and cultured in the incubator of 37°C and 5% CO2. The FAM-siRNA was utilized to verify the transfection efficiency of siRNAs at 36 h of transfection in the duodenal epithelial cells. Transfection efficiency is the percentage of target cells that successfully take up nucleic acids in total cells, serving as a key metric for evaluating RNA interference experiment success (Demir et al., 2025). Target cells and total cells were measured using a flow cytometry (B-R-V, Beckman Coulter, USA) (Li et al., 2022).

For overexpression Experiments, the 3*107pfu titer of the empty adenovirus and the recombinant adenovirus plasmid encoding chicken ZIP3 or ZIP5 gene were added to the complete culture medium when broiler primary duodenal epithelial cells had grown to 80% confluence. The infection efficiency of adenovirus was measured in the duodenal epithelial cells at 36 h of adenovirus infection. The infection efficiency is the percentage of target cells that successfully take up nucleic acids in total cells, serving as a key metric for evaluating overexpression experiment success (Chen et al., 2002). Target cells and total cells were measured using a flow cytometry (B-R-V, Beckman Coulter, USA) (Lucas et al., 2003). The empty adenovirus and the recombinant adenovirus plasmid encoding chicken ZIP3 or ZIP5 gene by AdEasy-1 adenovirus vector system were constructed by WZ Biosciences Inc. (Shandong, China).

Calculation of Zn absorption amount

According to previous studies (Li et al., 2013; Hu et al., 2024a), Zn levels of pre- and post-incubations in the culture media were analyzed via an Agilent Technologies 5110 plasma emission spectrometer (Agilent, Australia), and the formula for calculating the amount of Zn absorption is as follows:

The amount of Zn absorption (nmol/cm²) = [Zn content in the Zn-treated receiver chamber medium (μmol/L) × chamber medium volume (2.6 mL)] / each well's receiver chamber area (4.67 cm²) in the 6-well Transwell plate.

Real-time quantitative PCR (RT-qPCR)

Total RNA was extracted from duodenal epithelial cells using TRIzol reagent (Life Technologies, USA), and then RNA was reversely transcribed into cDNA using HiScript II Q Select RT SuperMix kit (Vazyme, China) (Hu et al., 2024a). The RT-qPCR was performed using an Applied Biosystems 7500 Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) (Hu et al., 2024b). All primers are listed in Table 2, and they were synthesized by Qingke Biotechnology (Nanjing, China). The target gene's relative mRNA expression was determined via the 2-ΔΔCT method (Livak and Schmittgen, 2001), with β-actin and GAPDH serving as housekeeping genes.

Table 2.

Primer sequences used for RT-qPCR.

Genes GenBank ID Primer sequences (5′→3′) Product length (bp) Annealing temperatures (°C)
ZIP31 XM_015299966.2 F: CATACATCCAGGAGGCAGAGG 246 58.4
R: CCTGGATGATCTTGACGGGG 57.4
ZIP51 XM_025145573.1 F: CCAAGATGAAACGCACGCAA 284 58.2
R: TAAGCTGCGACCAAGTCCTG 58.8
GAPDH1 NM_204305.1 F: CTTTGGCATTGTGGAGGGTC 128 53.2
R: ACGCTGGGATGATGTTCTGG 52.8
β-actin NM_205518.1 F: ACCTGAGCGCAAGTACTCTGTCT 169 53.5
R: CATCGTACTCCTGCTTGCTGAT 52.7
1

ZIP3, Zrt-irt-like protein 3; ZIP5, Zrt-irt-like protein 5; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse.

Western blotting

Total protein from duodenal epithelial cells was extracted with a pre-cooled RIPA lysis buffer as previously reported (Cao et al., 2020; Hu et al., 2024a). The protein concentrations were assessed via Pierce BCA Protein Assay Kit (Thermo, USA). Thirty micrograms of total protein were separated on 10% SDS-PAGE and probed with the primary antibody of ZIP3 (ab254868, Abcam, diluted 1:500) or ZIP5 (ab105194, Abcam, diluted 1:1000). The protein bands were imaged and visualized with an ECL system (Tanon, Shanghai, China), and band intensities were measured using Tanon Gis 1D software (Tanon, Shanghai, China). The β-tubulin was selected as an internal reference.

Statistical analyses

The data of Experiments 1A and 1B were analyzed by one-way ANOVA using the GLM program of SAS (2013) (version 9.4, SAS Institute Inc). All data in Experiments 2A, 2B, 3A and 3B were analyzed by two-way ANOVA using the GLM program, and the statistical model included cell type, Zn source and their interaction. The LSD method was used to compare the significant differences among the treatment groups. Each replicate was used as an Experimental unit. Significant differences were set at P < 0.05.

Results

SiRNA transfection efficiency and inhibitory efficacies of SiRNAs (Experiment 1)

For siRNA Experiments, the transfection efficiency of FAM-siRNA was 34.6 ± 0.5% (n = 3) at 36 h of transfection. As depicted in Fig. 1A, the treatment produced an impact (P < 0.0001) on ZIP3 mRNA expression level in broiler primary duodenal epithelial cells. Compared with all of other groups, the si-230 group reduced (P < 0.05) ZIP3 mRNA expression level. There were no differences (P > 0.05) among Blank, si-551 and si-989 groups and among Blank, NC, and si-551 groups. In comparison to NC group, si-989 group had higher (P < 0.05) ZIP3 mRNA expression levels.

Fig. 1.

Fig 1

Effect of siRNAs transfection treatment on ZIP3 or ZIP5 mRNA expression in primary duodenal epithelial cells of broilers (Experiment 1). A) ZIP3 mRNA expression; B) ZIP5 mRNA expression. The mRNA expression levels were calculated as the relative quantities (RQ) of the target gene mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2−ΔΔCT method. Different letters indicated significant differences among treatments (P < 0.05). Data are means ± SE (n = 5-6).

As depicted in Fig. 1B, the treatment affected (P < 0.0001) ZIP5 mRNA expression level in broiler primary duodenal epithelial cells. Compared with all of other groups, the si-1384 group decreased (P < 0.05) ZIP5 mRNA expression level. There were no differences (P > 0.05) among Blank, NC and si-2186 groups and among NC, si-1980 and si-2186 groups. The ZIP5 mRNA expression level was higher (P < 0.05) in the si-1980 group than in the Blank group.

Effect of ZIP3 silencing on Zn absorption amount and related indices in broiler primary duodenal epithelial cells under different Zn Sources (Experiment 2A)

The broiler primary duodenal epithelial cells' integrity was unaffected by Zn source, cell type, and their interaction, as indicated by the unchanged (P > 0.43) TEER value, phenol red transmittance, and LDH activity (Table 3). Thereupon, the subsequent Zn absorption and ZIP3 expression results in this Experiment are reliable.

Table 3.

Effect of ZIP3 silencing on TEER value and phenol red transmittance of primary cultured duodenal epithelial cells and LDH activity in the complete culture medium under different Zn sources (Experiment 2A).

Cell type Added Zn source TEER2 value (Ω.cm2) Phenol red transmittance (%) LDH2 activity (U/L)
Normal cells1 No Zn 414 1.60 158
ZnS2 412 1.66 131
ZnP M2 407 1.72 130
ZIP3 silenced cells1 No Zn 406 1.68 140
ZnS 409 1.69 126
ZnP M 409 1.73 138
Pooled SE 12 0.17 16
P-value Cell type 0.7538 0.7987 0.7071
Zn source 0.9749 0.8942 0.4347
Cell type × Zn source 0.9105 0.9820 0.7167
1

Data represent the means of 3 replicates (n = 3).

2

LDH, lactate dehydrogenase; TEER, the trans-epithelial electrical resistance; ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6).

As depicted in Fig. 2, cell type played a significant role (P < 0.0001) in ZIP3 mRNA and protein expression levels in broiler primary duodenal epithelial cells. The ZIP3 protein expression level was influenced (P < 0.0001) by Zn source, but ZIP3 mRNA expression level remained unaffected (P = 0.3435). Cell type × Zn source interaction didn’t influence (P > 0.13) the aforementioned indices. Compared with normal cells, ZIP3 silenced cells decreased (P < 0.0001) ZIP3 mRNA and protein expression levels. Compared with no Zn and ZnS, ZnP M increased (P < 0.05) ZIP3 protein expression level. However, no difference was found (P > 0.05) between no Zn and ZnS. Cell type, Zn source, and their interaction affected (P < 0.0001) Zn absorption amount in broilers' duodenal epithelial cells. Contrasted with normal cells, ZIP3 silenced cells decreased (P < 0.05) Zn absorption amount with the addition of ZnP M, however, there were no differences (P > 0.05) between normal cells and ZIP3 silenced cells with no added Zn or added ZnS.

Fig. 2.

Fig 2

Effect of ZIP3 silencing on Zn absorption amount and ZIP3 expression in primary duodenal epithelial cells of broilers under different Zn sources (Experiment 2A). A)ZIP3 mRNA expression; B) ZIP3 protein expression; C) The amount of Zn absorption. The ZIP3 mRNA expression level was calculated as the relative quantities (RQ) of the ZIP3 mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2−ΔΔCT method. The ZIP3 protein expression level was calculated as the relative quantities (RQ) of the ZIP3 protein band intensity to the β-tubulin protein band intensity. ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6). Different letters indicated significant differences among treatments (P < 0.05). Data are means ± SE (n = 5-6).

Effect of ZIP5 silencing on Zn absorption amount and related indices in broiler primary duodenal epithelial cells under different Zn sources (Experiment 2B)

The broiler primary duodenal epithelial cells' integrity was unaffected by Zn source, cell type, and their interaction, as indicated by the unchanged (P > 0.13) TEER value, phenol red transmittance, and LDH activity (Table 4). Thereupon, the subsequent Zn absorption and ZIP5 expression results in this Experiment are reliable.

Table 4.

Effect of ZIP5 silencing on TEER value and phenol red transmittance of primary cultured duodenal epithelial cells and LDH activity in the complete culture medium under different Zn sources (Experiment 2B).

Cell type Added Zn source TEER2 value (Ω.cm2) Phenol red transmittance (%) LDH2 activity (U/L)
Normal cells1 No Zn 430 1.62 167
ZnS2 420 1.69 140
ZnP M2 422 1.64 138
ZIP5 silenced cells1 No Zn 428 1.66 150
ZnS 423 1.72 135
ZnP M 424 1.69 146
Pooled SE 2 0.03 16
P-value Cell type 0.7743 0.1259 0.7219
Zn source 0.2598 0.1379 0.4211
Cell type × Zn source 0.8601 0.9204 0.7542
1

Data represent the means of 3 replicates (n = 3).

2

LDH, lactate dehydrogenase; TEER, the trans-epithelial electrical resistance; ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6).

As depicted in Fig. 3, cell type played a significant role (P < 0.0001) in ZIP5 mRNA and protein expression levels in broiler primary duodenal epithelial cells. The ZIP5 protein expression level was influenced (P < 0.0001) by Zn source, but ZIP5 mRNA expression level remained unaffected (P = 0.9743). Cell type × Zn source interaction didn’t influence (P > 0.06) the aforementioned indices. Compared with normal cells, ZIP5 silenced cells reduced (P < 0.0001) ZIP5 mRNA and protein expression levels. Compared with no Zn, either ZnS or ZnP M enhanced (P < 0.05) ZIP5 protein expression level, and ZnP M caused a greater increase (P < 0.05) in ZIP5 protein level than ZnS. Cell type, Zn source, and their interaction affected (P < 0.0001) Zn absorption amount in broilers' duodenal epithelial cells. The ZIP5 silenced cells decreased (P < 0.05) Zn absorption amount with the addition of either ZnS or ZnP M compared to normal cells with no significance (P > 0.05) for no added Zn, however, the decrease of Zn absorption was higher for ZnP M than for ZnS.

Fig. 3.

Fig 3

Effect of ZIP5 silencing on Zn absorption amount and ZIP5 expression in primary duodenal epithelial cells of broilers under different Zn sources (Experiment 2B). A)ZIP5 mRNA expression; B) ZIP5 protein expression; C) The amount of Zn absorption. The ZIP5 mRNA expression level was calculated as the relative quantities (RQ) of the ZIP5 mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2−ΔΔCT method. The ZIP5 protein expression level was calculated as the relative quantities (RQ) of the ZIP5 protein band intensity to the β-tubulin protein band intensity. ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6). Different letters indicated significant differences among treatments (P < 0.05). Data are means ± SE (n= 5-6).

Effect of ZIP3 overexpressing on Zn absorption amount and related indices in broiler primary duodenal epithelial cells under different Zn sources (Experiment 3A)

For the ZIP3 overexpression Experiment, the infection efficiencies of the empty adenovirus and the adenovirus plasmid encoding chicken ZIP3 were 21.7 ± 0.8% and 17.5 ± 0.7% (n = 3), respectively. As depicted in Table 5, cell type, Zn source, and their interaction had no impacts (P > 0.16) on the TEER value, phenol red transmittance and LDH activity, indicating that cell type and Zn source did not affect broiler primary duodenal epithelial cells' integrity. Thereupon, the subsequent Zn absorption and ZIP3 expression results in this Experiment are reliable.

Table 5.

Effect of ZIP3 overexpression on TEER value and phenol red transmittance of primary cultured duodenal epithelial cells and LDH activity in the complete culture medium under different Zn sources (Experiment 3A).

Cell type Added Zn source TEER2 value (Ω.cm2) Phenol red transmittance (%) LDH2 activity (U/L)
Normal cells1 No Zn 405 1.76 160
ZnS2 405 1.77 157
ZnP M2 395 1.69 149
ZIP3 overexpressed cells1 No Zn 404 1.80 160
ZnS 403 1.74 166
ZnP M 410 1.66 167
Pooled SE 11 0.10 7
P-value Cell type 0.6687 0.6687 0.1629
Zn source 0.9832 0.9832 0.8954
Cell type × Zn source 0.6915 0.6915 0.4867
1

Data represent the means of 3 replicates (n = 3).

2

LDH, lactate dehydrogenase; TEER, the trans-epithelial electrical resistance; ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6).

As depicted in Fig. 4, cell type played a significant role (P < 0.0001) in ZIP3 mRNA and protein expression levels in broiler primary duodenal epithelial cells. The Zn source exerted an influence (P < 0.0001) on ZIP3 protein expression level, but had no impact on (P = 0.3645) ZIP3 mRNA expression level. Cell type × Zn source interaction didn’t influence (P > 0.24) the aforementioned indices. Compared with normal cells, ZIP3 overexpressed cells enhanced (P < 0.0001) ZIP3 mRNA and protein expression levels. Compared to no Zn and ZnS, ZnP M enhanced (P < 0.05) ZIP3 protein expression level. Nevertheless, no difference (P > 0.05) was found between no Zn and ZnS. Cell type, Zn source, and their interaction affected (P < 0.0001) Zn absorption amount in broilers' duodenal epithelial cells. Contrasted with normal cells, ZIP3 overexpressed cells increased (P < 0.05) Zn absorption amount with the addition of ZnP M, however, there were no differences (P > 0.05) between normal cells and ZIP3 overexpressed cells with no added Zn or added ZnS.

Fig. 4.

Fig 4

Effect of ZIP3 overexpression on Zn absorption amount and ZIP3 expression in primary duodenal epithelial cells of broilers under different Zn sources (Experiment 3A). A)ZIP3 mRNA expression; B) ZIP3 protein expression; C) The amount of Zn absorption. The ZIP3 mRNA expression level was calculated as the relative quantities (RQ) of the ZIP3 mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2−ΔΔCT method. The ZIP3 protein expression level was calculated as the relative quantities (RQ) of the ZIP3 protein band intensity to the β-tubulin protein band intensity. ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6). Different letters indicated significant differences among treatments (P < 0.05). Data are means ± SE (n = 5-6).

Effect of ZIP5 overexpressing on Zn absorption amount and related indices in broiler primary duodenal epithelial cells under different Zn sources (Experiment 3B)

For the ZIP5 overexpression Experiment, the infection efficiencies of the empty adenovirus and the recombinant adenovirus plasmid encoding chicken ZIP5 were 22.2 ± 1.4% and 15.7 ± 0.6% (n = 3), respectively. As depicted in Table 6, cell type, Zn source, and their interaction had no impacts (P > 0.62) on the TEER value, phenol red transmittance and LDH activity. These results indicated that cell type and Zn source did not affect broiler primary duodenal epithelial cells' integrity. Therefore, the data of Zn absorption and ZIP5 expression in Experiment 3B are valid.

Table 6.

Effect of ZIP5 overexpression on TEER value and phenol red transmittance of primary cultured duodenal epithelial cells and LDH activity in the complete culture medium under different Zn sources (Experiment 3B).

Cell type Added Zn source TEER2 value (Ω.cm2) Phenol red transmittance (%) LDH2 activity (U/L)
Normal cells1 No Zn 413 1.88 152
ZnS2 404 1.90 146
ZnP M2 408 1.84 158
ZIP5 overexpressed cells1 No Zn 408 1.79 150
ZnS 404 1.85 152
ZnP M 402 1.90 153
Pooled SE 9 0.08 6
P-value Cell type 0.6228 0.6641 0.9667
Zn source 0.7476 0.8852 0.6319
Cell types × Zn source 0.9542 0.6744 0.6652
1

Data represent the means of 3 replicates (n = 3).

2

LDH, lactate dehydrogenase; TEER, the trans-epithelial electrical resistance; ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6).

As depicted in Fig. 5, cell type played a significant role (P < 0.0001) in ZIP5 mRNA and protein expression levels in broiler primary duodenal epithelial cells. The Zn source exerted an influence (P < 0.0001) on ZIP5 protein expression level, but had no impact on (P = 0.1026) ZIP5 mRNA expression level. Cell type × Zn source interaction didn’t influence (P > 0.66) the aforementioned indices. Compared to normal cells, ZIP5 overexpressed cells enhanced (P < 0.0001) ZIP5 mRNA and protein expression levels. Compared to no Zn, either ZnS or ZnP M enhanced (P < 0.05) ZIP5 protein expression level, and ZnP M caused a greater increase (P < 0.05) in ZIP5 protein level than ZnS. Cell type, Zn source, and their interaction affected (P < 0.0001) Zn absorption amount in broilers' duodenal epithelial cells. Contrasted with normal cells, ZIP5 overexpressed cells increased (P < 0.05) Zn absorption amount with the addition of either ZnS or ZnP M with no significance (P > 0.05) for no added Zn, but the increase of Zn absorption was greater for ZnP M than for ZnS.

Fig. 5.

Fig 5

Effect of ZIP5 overexpression on Zn absorption amount and ZIP5 expression in primary duodenal epithelial cells of broilers under different Zn sources (Experiment 3B). A)ZIP5 mRNA expression; B) ZIP5 protein expression; C) The amount of Zn Absorption. The ZIP5 mRNA expression level was calculated as the relative quantities (RQ) of the ZIP5 mRNA to the geometric mean of β-actin and GAPDH mRNA using the 2−ΔΔCT method. The ZIP5 protein expression level was calculated as the relative quantities (RQ) of the ZIP5 protein band intensity to the β-tubulin protein band intensity. ZnS, Zn sulfate; ZnP M, Zn proteinate with moderate chelation strength (Qf = 51.6). Different letters indicated significant differences among treatments (P < 0.05). Data are means ± SE (n= 5-6).

Discussion

The results from the current study demonstrated that ZIP3 silencing or overexpression significantly decreased or increased Zn absorption for the added ZnP M, and ZIP5 silencing or overexpression remarkably reduced or promoted Zn absorption for the addition of either ZnS or ZnP M, but the reduction or promotion of Zn absorption was stronger for ZnP M than for ZnS in broiler primary duodenal epithelial cells. In addition, ZnP M enhanced ZIP3 or ZIP5 protein expression compared to the Contorl and ZnS, and ZnS increased ZIP5 protein expression compared to the Control, regardless of ZIP3 or ZIP5 silencing or overexpression. The above results have obviously demonstrated that both ZIP3 and ZIP5 directly participated in promoting the absorption of Zn in the form of ZnP M within broiler primary duodenal epithelial cells, which supports our hypothesis. Furthermore, ZIP5 was also involved in the absorption of Zn in the form of ZnS. These findings have not been reported previously, and provided novel scientific bases and insights for how to enhance the absorption of Zn in the duodenum of broilers as well as for developing and utilizing the highly available new organic Zn in the form of ZnP M in commercial broiler operations. However, how to make use of alternative transporters to increase Zn absorption from the diets fed to broilers still needs further studies.

The RNA interference (RNAi) is a method for gene function studies by suppressing the specific gene expression (Gumienny and Zavolan, 2015; Tarashima et al., 2016; Zhao et al., 2016). It is worth noting that most primary cells are notoriously difficult to transfect, with transfection efficiencies often below 1% using common transfection reagents. In fact, although the transfection efficiency was below 40% in this study, the si230 and si1384 were effective in suppressing the mRNA expression levels of ZIP3 and ZIP5 in broiler primary duodenal epithelial cells, respectively. This may be related to the high specificity of siRNA sequences, which can efficiently and accurately bind to target genes despite of low transfection efficiency, thereby achieving effective silencing (Filipowicz, 2005). In addition, as transfection efficiency with plasmids is generally low in primary duodenal epithelial cells of broilers, we employed homologous recombination with the plasmid using the AdEasy adenovirus packaging system (Khalil and Gout, 2012). Although the infection efficiency was still below 40%, but the mRNA and protein expression levels of ZIP3 and ZIP5 were significantly increased in broilers' duodenal epithelial cells after infected with adenovirus-packed ZIP3 or ZIP5, respectively. The potent gene expression stems from the adenovirus's high-copy number genome and powerful promoter, even when the infection efficiency is low (Imaizumi et al., 2022).

The ZIP3 exists widely in various tissues of animals and is a member of the Zn transporter family. Dufner-Beattie et al. (2006) found that mice are more susceptible to Zn deficiency when the ZIP3 gene was absent, suggesting that the ZIP3 play a role in Zn uptake. The ZIP5 is stably expressed in intestinal cells and localized on the basolateral surface (Dufner-Beattie et al., 2004). Geiser et al. (2013) reported that ZIP5 participated in managing Zn excretion in mice. It was found in our recent study that ZnP M enhanced the Zn absorption in broiler primary duodenal epithelial cells contrasted with ZnS, which could be related to the increase of ZIP3 and ZIP5 protein expression levels (Hu et al., 2024a). However, whether ZIP3 and ZIP5 directly participated in Zn absorption in the form of ZnP M, has not been reported. Therefore, in the present study, loss- and gain-of-function approaches were used to validate the role of ZIP3 or ZIP5 in Zn absorption in the form of ZnP M in broiler primary duodenal epithelial cells. Firstly, silencing ZIP3 or ZIP5 remarkably decreased Zn absorption as ZnP M compare to ZnS; Secondly, ZIP3 or ZIP5 overexpression significantly increased the absorption of Zn as ZnP M compare to ZnS. These results indicated that ZIP3 and ZIP5 were directly involved in enhancing the Zn absorption as ZnP M in broiler primary duodenal epithelial cells. Although the bioavailability of organic Zn in poultry is well-established, studies on its absorption mechanisms remain limited. It is reported that Zn-amino acid complex and Zn proteinate had increased bioavailabilities in broilers compared to ZnS using tibial Zn content as a response parameter in practical corn-soybean meal diets (Cao et al., 2000b; Star et al., 2012). Brooks et al. (2013) showed that the bioavailability of Zn propionate in the corn-soy diet was higher than that of ZnS based on weight gain and tibial Zn content indices of broilers. It was found in studies from our laboratory that ZnP M was more available for broilers fed the conventional corn-soybean meal diet than both ZnS and organic Zn sources with weak or strong chelation strengths based on metallothionein mRNA expression level in pancreas (Huang et al., 2009, 2013). Zinc bioavailability is a reflection of combination of both Zn absorption at the intestine and Zn metabolic utilization at target tissues, and Zn absorption is the basis of Zn metabolic utilization. Therefore, one of main reasons why ZnP M is more available for broilers than ZnS is because compared with ZnS, ZnP M enhances the duodenal Zn absorption by promoting the expression of related Zn transporters (ZIP3 and ZIP5). This might also be one possible reason why other organic Zn sources are more available than inorganic ZnS.

Interestingly, we also found in this study that ZnP M significantly boosted ZIP3 or ZIP5 protein expression with no effect on ZIP3 or ZIP5 mRNA expression, regardless of ZIP3 or ZIP5 silencing or overexpression. These results further indicate that ZnP M promoted Zn absorption in broiler primary duodenal epithelial cells through up-regulating ZIP3 and ZIP5 protein expressions. However, specific molecular mechanisms of how ZnP M to up-regulate ZIP3 and ZIP5 protein expressions are not known. Therefore, further studies need be done to elucidate the above molecular mechanisms in broiler primary duodenal epithelial cells in the future.

In conclusion, both ZIP3 and ZIP5 directly participated in Zn absorption as ZnP M, and ZIP5 was also involved in Zn absorption as ZnS in primary duodenal epithelial cells of broilers. However, how to use alternative transporters of Zn proteinate to increase Zn absorption in diets fed to broiler chickens still needs further explorations.

CRediT authorship contribution statement

Chunyu Cao: Data curation, Writing – original draft, Formal analysis. Yun Hu: Writing – review & editing. Liang Huang: Resources. Weiyun Zhang: Formal analysis. Xi Lin: Writing – review & editing. Wei Wu: Formal analysis. Tingting Li: Formal analysis, Writing – review & editing. Xiaoyan Cui: Formal analysis, Writing – review & editing. Shengchen Wang: Formal analysis, Writing – review & editing. Liyang Zhang: Formal analysis. Xugang Luo: Writing – review & editing.

Disclosures

None of the authors have any conflicts of interest to declare.

Acknowledgments

This work was supported by the Key International Cooperation Program of the National Natural Science Foundation of China (32120103011), the National Natural Science Foundation of China (31972583), the Jiangsu Shuang Chuang Ren Cai program (JSSCRC2021541), the Jiangsu Shuang Chuang Tuan Dui program (JSSCTD202147) and the Initiation Funds of Yangzhou University for Distinguished Scientists.

Footnotes

The appropriate scientific section for the paper: Metabolism and Nutrition.

References

  1. Brooks M.A., Grimes J.L., Lloyd K.E., Verissimo S., Spears J.W. Bioavailability in chicks of zinc from zinc propionate. J. Appl. Poultry Res. 2013;22:153–159. [Google Scholar]
  2. Cao J., Henry P.R., Ammerman C.B., Miles R.D., Littell R.C. Relative bioavailability of basic zinc sulfate and basic zinc chloride for chicks. J. Appl. Poultry Res. 2000;9:513–517. [Google Scholar]
  3. Cao J., Henry P.R., Guo R., Holwerda R.K., Toth J.P., Littell R.C., Miles R.D., Ammerman C.B. Chemical characteristics and relative bioavailability of supplemental organic zinc sources for poultry and ruminants. J. Anim. Sci. 2000;78:2039–2054. doi: 10.2527/2000.7882039x. [DOI] [PubMed] [Google Scholar]
  4. Cao S.M., Zhang S.M., Liu G.Q., Zhang L.Y., Lu L., Zhang R.J., Liao X.D., Luo X.G. Kinetics of phosphorus absorption and expressions of related transporters in primary cultured duodenal epithelial cells of chick embryos. J. Anim. Physiol. An. N. 2020;104:237–244. doi: 10.1111/jpn.13260. [DOI] [PubMed] [Google Scholar]
  5. Chen Z., Ahonen M., Hämäläinen H., Bergelson J.M., Kähäri V.M., Lahesmaa R. High-efficiency gene transfer to primary T lymphocytes by recombinant adenovirus vectors. J. Immunol. Methods. 2002;260:79–89. doi: 10.1016/s0022-1759(01)00521-x. [DOI] [PubMed] [Google Scholar]
  6. Demir I., Çelik S.K., Bal K., Kaplan Ö., Sentürk S., Demir K., Gök M.K. Enhancing transfection efficiency of primary cell lines using different terminated PBAE structures without endcapping reaction. Colloid Polym. Sci. 2025;15 [Google Scholar]
  7. Diao H., Yan J.Y., Li S.W., Kuang S.Y., Wei X.L., Zhou M.J., Zhang J.X., Huang C.B., He P., Tang W.J. Effects of dietary zinc sources on growth performance and gut health of weaned piglets. Front. Microbiol. 2021;12:13. doi: 10.3389/fmicb.2021.771617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dong S.J., Zhang B., Ma Y., Chang H., Zheng Z.J., Zhao X.Y. Pumpkin skin polysaccharide-Zn(II) complex: preparation, characterization, and suppression of inflammation in zebrafish. Foods. 2022;11:17. doi: 10.3390/foods11172610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dufner-Beattie J., Huang Z.L., Geiser J., Xu W., Andrews G.K. Mouse ZIP1 and ZIP3 genes together are essential for adaptation to dietary zinc deficiency during pregnancy. Genesis. 2006;44:239–251. doi: 10.1002/dvg.20211. [DOI] [PubMed] [Google Scholar]
  10. Dufner-Beattie J., Kuo Y.M., Gitschier J., Andrews G.K. The adaptive response to dietary zinc in mice involves the differential cellular localization and zinc regulation of the zinc transporters ZIP4 and ZIP5. J. Biol. Chem. 2004;279:49082–49090. doi: 10.1074/jbc.M409962200. [DOI] [PubMed] [Google Scholar]
  11. Feng Y.R., Liu Y.D., Liu W.R., Ding X.Q., Kang Y.J. Zinc-glutathione mitigates alcohol-induced intestinal and hepatic injury by modulating intestinal zinc-transporters in mice. J. Nutr. Biochem. 2024;132:11. doi: 10.1016/j.jnutbio.2024.109697. [DOI] [PubMed] [Google Scholar]
  12. Filipowicz W. RNAi: the nuts and bolts of the RISC machine. Cell. 2005;122:17–20. doi: 10.1016/j.cell.2005.06.023. [DOI] [PubMed] [Google Scholar]
  13. Geiser J., De Lisle R.C., Andrews G.K. The zinc transporter Zip5 (Slc39a5) regulates intestinal zinc excretion and protects the pancreas against zinc toxicity. Plos One. 2013;8 doi: 10.1371/journal.pone.0082149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gumienny R., Zavolan M. Accurate transcriptome-wide prediction of microRNA targets and small interfering RNA off-targets with MIRZA-G. Nucleic. Acids Res. 2015;43:1380–1391. doi: 10.1093/nar/gkv050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hollis G.R., Carter S.D., Cline T.R., Crenshaw T.D., Cromwell G.L., Hill G.M., Kim S.W., Lewis A.J., Mahan D.C., Miller P.S., Stein H.H., Veum T.L. Effects of replacing pharmacological levels of dietary zinc oxide with lower dietary levels of various organic zinc sources for weanling pigs. J. Anim. Sci. 2005;83:2123–2129. doi: 10.2527/2005.8392123x. [DOI] [PubMed] [Google Scholar]
  16. Hu Y., Huang Y.H., Wang C.L., Zhang W.Y., Qu Y.C., Li D., Wu W., Gao F.Y., Zhu L., Wu B.X., Zhang L.Y., Cui X.Y., Li T.T., Geng Y.Q., Liao X.D., Luo X.G. The organic zinc with moderate chelation strength enhances the expression of related transporters in the jejunum and ileum of broilers. Poult. Sci. 2023;102:10. doi: 10.1016/j.psj.2023.102477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hu Y., Wang C.L., Wu W., Qu Y.C., Zhang W.Y., Li D., Zhu L., Gao F.Y., Wu B.X., Zhang L.Y., Cui X.Y., Li T.T., Geng Y.Q., Luo X.G. Organic zinc with moderate chelation strength enhances zinc absorption in the small intestine and expression of related transporters in the duodenum of broilers. Front. Physiol. 2022;13:12. doi: 10.3389/fphys.2022.952941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hu Y., Wu W., Huang L., Zhang L.Y., Cao C.Y., Zhang W.Y., Hu Y.Y., Cui X.Y., Li T.T., Wang S.C., Luo X.G. Zinc proteinate with moderate chelation strength enhances zinc absorption by up-regulating the expression of zinc and amino acid transporters in primary cultured duodenal epithelial cells of broiler embryos. J. Anim. Sci. 2024;102:skae204. doi: 10.1093/jas/skae204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hu Y.Y., Zhang W.Y., Yang K., Lin X., Liu H.C., Odle J., See M.T., Cui X.Y., Li T.T., Wang S.C., Liao X.D., Zhang L.Y., Li S.F., Hu Y., Luo X.G. Dietary Zn proteinate with moderate chelation strength alleviates heat stress-induced intestinal barrier function damage by promoting expression of tight junction proteins via the A20/NF-κb p65/MMP-2 pathway in the jejunum of broilers. J. Anim. Sci. Biotechnol. 2024;15:15. doi: 10.1186/s40104-024-01075-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huang Y.L., Lu L., Li S.F., Luo X.G., Liu B. Relative bioavailabilities of organic zinc sources with different chelation strengths for broilers fed a conventional corn-soybean meal diet. J. Anim. Sci. 2009;87:2038–2046. doi: 10.2527/jas.2008-1212. [DOI] [PubMed] [Google Scholar]
  21. Huang Y.L., Lu L., Xie J.J., Li S.F., Li X.L., Liu S.B., Zhang L.Y., Xi L., Luo X.G. Relative bioavailabilities of organic zinc sources with different chelation strengths for broilers fed diets with low or high phytate content. Anim. Feed Sci. Technol. 2013;179:144–148. [Google Scholar]
  22. Ikeda Y., Munekane M., Yamada Y., Kawakami M., Amano I., Sano K., Mukai T., Kambe T., Shitan N. Enhancing effect of Panax ginseng on Zip4-mediated zinc influx into the cytosol. J. Ginseng Res. 2022;46:248–254. doi: 10.1016/j.jgr.2021.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Imaizumi Y., Yoshida S., Kanegae Y., Eto K., Yoshida K. Enforced dual-specificity tyrosine-regulated kinase 2 expression by adenovirus-mediated gene transfer inhibits tumor growth and metastasis of colorectal cancer. Cancer Sci. 2022;113:960–970. doi: 10.1111/cas.15247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kambe T., Yamaguchi-Iwai Y., Sasaki R., Nagao M. Overview of mammalian zinc transporters. Cell Mol. Life Sci. 2004;61:49–68. doi: 10.1007/s00018-003-3148-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kelleher S.L., Lönnerdal B. Zip3 plays a major role in zinc uptake into mammary epithelial cells and is regulated by prolactin. Am. J. Physiol-cell. Ph. 2005;288:C1042–C1047. doi: 10.1152/ajpcell.00471.2004. [DOI] [PubMed] [Google Scholar]
  26. Khalil M., Gout I. Vol. 821. Humana Press Inc; 2012. pp. 87–103. (Overexpression or Downregulation of mTOR in Mammalian Cells). [DOI] [PubMed] [Google Scholar]
  27. Li J., Gong C., Wang Z., Gao R., Ren J., Zhou X., Wang H., Xu H., Xiao F., Cao Y., Zhao Y. Oyster-derived zinc-binding peptide modified by plastein reaction via zinc chelation promotes the intestinal absorption of zinc. Mar Drugs. 2019;17 doi: 10.3390/md17060341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Li T.T., Geng Y.Q., Hu Y., Zhang L.Y., Cui X.Y., Zhang W.Y., Gao F.Y., Liu Z.P., Luo X.G. Dentin matrix protein 1 silencing inhibits phosphorus utilization in primary cultured tibial osteoblasts of broiler chicks. Front. Vet. Sci. 2022;9:11. doi: 10.3389/fvets.2022.875140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li X.L., Xie J.J., Lu L., Zhang L.Y., Zhang L.Y., Zou Y.X., Wang Q.Y., Luo X.G., Li S.F. Kinetics of manganese transport and gene expressions of manganese transport carriers in Caco-2 cell monolayers. Biometals. 2013;26:941–953. doi: 10.1007/s10534-013-9670-y. [DOI] [PubMed] [Google Scholar]
  30. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  31. Lucas A., Kremer E.J., Hemmi S., Luis J., Vignon F.O., Lazennec G. Comparative transductions of breast cancer cells by three DNA viruses. Biochem. Bioph. Res. Co. 2003;309:1011–1016. doi: 10.1016/j.bbrc.2003.08.101. [DOI] [PubMed] [Google Scholar]
  32. Myers S., Shastri M.D., Adulcikas J., Sohal S.S., Norouzi S. Zinc and gastrointestinal disorders: a role for the zinc transporters zips and ZnTs. Curr. Pharm. Design. 2017;23:2328–2332. doi: 10.2174/1381612823666170124115850. [DOI] [PubMed] [Google Scholar]
  33. Nagamatsu S., Nishito Y., Yuasa H., Yamamoto N., Komori T., Suzuki T., Yasui H., Kambe T. Sophisticated expression responses of ZNT1 and MT in response to changes in the expression of. ZIPs. Sci. Rep. 2022;12:7334. doi: 10.1038/s41598-022-10925-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Navidshad B., Jabbari S., Gheshiagh F.M.A. The new progresses in Zn requirements of poultry. Iran. J. Appl. Sci. 2016;6:763–767. [Google Scholar]
  35. Ogbuewu I.P., Mbajiorgu C.A. Potentials of dietary zinc supplementation in improving growth performance, health status, and meat quality of broiler chickens. Biol. Trace Elem. Res. 2023;201:1418–1431. doi: 10.1007/s12011-022-03223-5. [DOI] [PubMed] [Google Scholar]
  36. Salim H.M., Jo C., Lee B.D. Zinc in broiler feeding and nutrition. Avian Biol. Res. 2008;1:5–18. [Google Scholar]
  37. Schlegel P., Windisch W. Bioavailability of zinc glycinate in comparison with zinc sulphate in the presence of dietary phytate in an animal model with 65Zn labelled rats. J. Anim. Physiol. An. N. 2006;90:216–222. doi: 10.1111/j.1439-0396.2005.00583.x. [DOI] [PubMed] [Google Scholar]
  38. Star L., van der Klis J.D., Rapp C., Ward T.L. Bioavailability of organic and inorganic zinc sources in male broilers. Poult. Sci. 2012;91:3115–3120. doi: 10.3382/ps.2012-02314. [DOI] [PubMed] [Google Scholar]
  39. Swiatkiewicz S., Koreleski J. Zinc as a trace element necessary in modern poultry production. Biuletyn Informacyjny Instytut Zootechniki. 2001;39:25–36. [Google Scholar]
  40. Tarashima N., Ando H., Kojima T., Kinjo N., Hashimoto Y., Furukawa K., Ishida T., Minakawa N. Gene silencing using 4′-thioDNA as an artificial template to synthesize short hairpin RNA without inducing a detectable innate immune response. Mol. Ther-nucl. Acids. 2016;5:e274. doi: 10.1038/mtna.2015.48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Winiarska-Mieczan A., Kwiecien M., Purwin C., Jachimowicz-Rogowska K., Borsuk-Stanulewicz M., Pogorzelska-Przybylek P., Kiczorowska B. Fatty acid profile and dietary value of thigh meat of broiler chickens receiving mineral or organic forms of Zn. Animals. 2024;14:1156. doi: 10.3390/ani14081156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yang P.F., Hong W.D., Zhou P., Chen B.L., Xu H.Y. Nano and bulk ZnO trigger diverse Zn-transport-related gene transcription in distinct regions of the small intestine in mice after oral exposure. Biochem. Bioph. Res. Co. 2017;493:1364–1369. doi: 10.1016/j.bbrc.2017.09.165. [DOI] [PubMed] [Google Scholar]
  43. Yu Y., Lu L., Wang R.L., Xi L., Luo X.G., Liu B. Effects of zinc source and phytate on zinc absorption by in situ ligated intestinal loops of broilers. Poult. Sci. 2010;89:2157–2165. doi: 10.3382/ps.2009-00486. [DOI] [PubMed] [Google Scholar]
  44. Yu Y., Lu L., Li S.F., Zhang L.Y., Luo X.G. Organic zinc absorption by the intestine of broilers in vivo. Brit. J. Nutr. 2017;117:1086–1094. doi: 10.1017/S0007114517001040. [DOI] [PubMed] [Google Scholar]
  45. Zhang S.M., Liao X.D., Lu L., Zhang L.Y., Luo X.G. Isolation and identification of duodenal epithelial cells of broiler embryos in vitro and its establishment and evaluation of primary cultured absorption model. Chin. J. Anim. Nutri. 2018;30:3159–3167. [Google Scholar]
  46. Zhang Y.F., Xie L.Y., Ding X.Q., Wang Y.Y., Xu Y.B., Li D.L., Liang S., Wang Y.X., Zhang L., Fu A.K., Zhan X. Mechanisms underlying the protective effect of maternal zinc (ZnSO4 or Zn-Gly) against heat stress-induced oxidative stress in chicken embryo. Antioxidants. 2022;11:15. doi: 10.3390/antiox11091699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhao M.D., Cheng J.L., Yan J.J., Chen F.Y., Sheng J.Z., Sun D.L., Chen J., Miao J., Zhang R.J., Zheng C.H., Huang H.F. Hyaluronic acid reagent functional chitosan-PEI conjugate with AQP2-siRNA suppressed endometriotic lesion formation. Int. J. Nanomed. 2016;11:1323–1336. doi: 10.2147/IJN.S99692. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES