Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Sep 15;45(10):e70341. doi: 10.1111/liv.70341

Reactive Oxygen Species‐Mediated TRPM2 Activation Facilitates Phagocytosis of Macrophages to Reverse Profibrotic Phenotype

Shaoying Zhang 1,2, Fanfan Liang 1,2, Dan Wan 1,2, Chongyu Zhang 1,2, Yinggang Zhang 1,2, Xurui Zhang 1,2, Na Huang 1,2, Keping Feng 1,2, Xiao Liang 1,2, Ni Guo 1,2, Chen Zhang 1,2, Zhe Zhou 1,2, Yuehua Li 3, Jing Geng 1,2, Pengfei Liu 1,2, Guangyao Kong 1,2, Shemin Lu 1,4, Zongfang Li 1,2,3,
PMCID: PMC12435147  PMID: 40952323

ABSTRACT

Background and Aims

Macrophages play plastic roles during fibrogenesis and fibrosis regression. Phagocytosis is considered a trigger for shifting macrophages from a profibrotic phenotype to a restorative phenotype. However, the underlying mechanism by which macrophages enhance phagocytosis remains unclear. Our present study investigated the role of reactive oxygen species (ROS)‐modulated TRPM2 activation in this process.

Methods

The changes of TRPM2 expression, ROS intensity, and macrophage phagocytosis were assessed in fibrogenesis and fibrosis regression models. RNA sequencing was utilised to reveal pathway enrichment caused by TRPM2, and the role of TRPM2 in enhancing phagocytosis was verified. The coordinate regulation of ROS‐TRPM2 in different functions of macrophages was demonstrated by modulating ROS intensity and TRPM2 expression. Mitochondrial dynamics changes induced by ROS‐stimulated TRPM2 activation were evaluated by analysing the expression of dynamics‐related molecules and mitochondrial imaging, and intervention in mitochondrial dynamics confirmed their impact on macrophage phagocytosis.

Results

Low‐intensity ROS stimulation up‐regulated the expression of TRPM2 and coordinately enhanced macrophage phagocytosis and the expression of matrix degradation‐related proteins (MMPs), a process akin to fibrosis regression. However, high‐intensity ROS inclined macrophages to produce more profibrotic cytokines, associating with oxidative stress caused by liver injury. ROS‐mediated TRPM2 activation mobilised Ca2+ and promoted mitochondrial fission; either inhibiting mitochondrial fission or chelating Ca2+ counteracted phagocytosis, as well as decreasing MMPs.

Conclusions

ROS‐TRPM2 coordinately regulate macrophage functions. During the liver fibrosis regression period, ROS‐induced activation of TRPM2 helps enhance macrophage phagocytosis and switches them to a restorative phenotype. Modulating this process may provide means for developing effective therapeutic strategies.

Keywords: fibrosis regression, macrophage, mitochondrial fission, phagocytosis, phenotypic transformation, TRPM2 (transient receptor potential melastatin 2)


Summary.

  • The response of TRPM2 to different intensities of ROS regulates the distinct activities of macrophages in liver fibrosis.

  • In the fibrogenesis period, macrophages with low expression of TRPM2 display profibrotic effects under the stimulation of a supersaturated intensity of ROS.

  • In the regression period, macrophages with robust expression of TRPM2 respond to appropriate intensity of ROS stimulation, which augments the phagocytosis of macrophages, promoting the transformation of macrophages towards a restorative phenotype.

1. Introduction

Fibrosis is a major determinant of clinical outcomes of chronic liver diseases with liver injury. Fibrogenesis is hallmarked by excessive accumulation of extracellular matrix (ECM) and is often accompanied by chronic inflammation, potentially progressing to cirrhosis, liver cancer and even liver failure. However, once the causative factors of liver injury are removed, liver fibrosis may lead to regression. Fibrogenesis is intensified by enhanced inflammatory signals and increased recruitment of activated immune cells, while the regression of fibrosis is achieved through the release of ECM‐degrading proteases such as MMPs [1, 2, 3, 4]. Achievable treatment strategies for liver diseases remain inadequate, highlighting the importance of further understanding of the pathogenesis in order to develop therapeutic strategies in terms of both inhibiting fibrosis formation and facilitating regression.

Hepatic macrophages account for the largest non‐parenchymal cell population in the liver and adaptively alter their phenotype and function at stages of fibrogenesis and fibrosis regression. In the stage of fibrogenesis, macrophages are the main effectors responsible for the secretion of inflammatory cytokines and chemokines and the generation of ROS to accelerate fibrosis [2, 4, 5]. When the fibrosis begins to regress, macrophages can degrade excessive ECM by secreting MMPs and engulfing collagen‐producing cells and cell debris to promote this process [1, 3, 4]. Although the molecular mechanism by which macrophages shift from profibrogenic to restorative phenotypes has not been fully revealed, phagocytosis is considered a trigger for this phenotypic transformation [6]. Therefore, elucidating the mechanism of macrophage phagocytosis enhancement is of paramount importance for regulating the functional transformation of macrophages.

Macrophage phagocytosis is an orderly process. Macrophages recognise phagocytosable substances through a variety of cell surface receptors, which then transmit intracellular signals that trigger cytoskeletal rearrangement and interaction with endocytic compartments, helping phagosome formation and maturation [7, 8]. Actin rearrangement is a constrict step in phagocytosis. Mitochondrial fission has been found capable of regulating actin rearrangement and phagocytosis by providing a promoting signal for liquid–liquid phase separation (LLPS), and LLPS helps assemble components of molecular clusters into distinct compartments to govern actin polymerisation [9]. As intracellular organelles which serve as powerhouses of cells, mitochondria play a crucial role in fueling immunity [10]. Presently, mounting evidence demonstrates that mitochondria are not only responsible for bioenergy supply, but also serve as signalling organelles to affect the functions of immune cells [11, 12]. Mitochondrial dynamics is a type of mitochondrial activity that involves continuous fission and fusion of the mitochondrial tubular network, and changes in mitochondrial dynamics is a way of transmitting signals for cell activities [13, 14]. Oxidative stress is a potent mitochondrial stressor that affects mitochondrial dynamics [15]. Studying the mechanism of enhanced phagocytosis in macrophages from the perspective of ROS‐mediated changes in mitochondrial dynamics may offer new insights into the regulation of macrophage phenotypic transformation.

TRPM2 is a metabolic and oxidative stress sensor, responds to H2O2, adenosine diphosphate ribose (ADPR), and reactive oxygen species (ROS), and translates information into ion fluxes, affecting Ca2+ signalling to trigger changes in cell activity [16]. Previous studies have found that TRPM2 is involved with diseases including ischaemic brain injury, infection and myeloid leukaemia by regulating the migration, infiltration, activation, cytokine production and proliferation or survival of immune cells [17, 18, 19, 20]. In liver injury conditions, TRPM2 has also been identified as a potential pharmacological target for attenuating liver dysfunction, inflammation and cell death, but most of its effects involve hepatocytes [21, 22]. Considering the strong expression of TRPM2 in immune cells of the phagocytic lineage and the vital role of macrophages in liver diseases, studying the changes in macrophage function induced by ROS‐TRPM2 coordinated signal transduction will add new knowledge to the role of TRPM2 in liver diseases.

This study demonstrates that ROS‐modulated TRPM2 activation mobilises Ca2+, promotes mitochondrial fission, and thereby enhances macrophage phagocytosis. The enhanced phagocytosis aids macrophages in shifting from a profibrotic phenotype to a restorative phenotype, and this phenotypic transformation facilitates liver fibrosis regression. These findings provide effective applications for controlling the progression of liver fibrosis.

2. Materials and Methods

2.1. Chemicals and Reagents

VybrantTM Phagocytosis Assay Kit (V6694), 5 (6)‐CFDA SE (CFSE, C1157) was from Invitrogen (CA, USA). Mito‐Tracker Green (C1048), Fluo‐4 AM (S1060), Dihydroethidium (DHE, S0063) and TUNEL apoptosis assay kit (C1088) were from Beyotime Biotechnology (Shanghai, China). Rhod‐2 AM (40776ES50), CellTrace Red CMTPX (40717ES50) was from Yeasen Biotechnology (Shanghai, China). 2‐Aminoethyl Diphenylborinate (2‐APB, S6657), mitochondrial division inhibitor‐1 (Mdivi‐1, S7162), BAPTA‐AM (S7534) were from Selleck (Shanghai, China). Mdivi‐1 (KM11230), N‐(P‐Amylcinnamoyl) Anthranilic Acid (KM6455), PJ34 (KM7621) were from KKL Med (VA, USA).

2.2. Mouse Models

Healthy male C57BL/6J mice aged 6–8 weeks were purchased from GemPharmatech Co. Ltd. (Nanjing, China). All animal experiments were ethically approved by the Biomedical Ethics Committee of Xi'an Jiaotong University (Approval number: 2021‐1165) on 3 March 2021. All institutional and national guidelines for the care and use of laboratory animals were followed. Mice were maintained under specific pathogen‐free facilities and under 12 h light–dark cycles. After a week of adaptive breeding, mice were randomly divided into the control group, liver fibrosis group and regression group.

Liver fibrosis was induced by intraperitoneal injection of CCl4 (0.4 μL/g body weight, diluted 1:3 in olive oil) twice a week for 6 weeks, and control mice were injected with the same volume of olive oil. For the fibrosis regression model, mice received CCl4 injections for 4 weeks, and then the liver samples were harvested 4 days or 2 weeks after the last injection. For TRPM2 or mitochondrial fission inhibition, mice in the fibrosis regression model were intraperitoneally injected with ACA (25 mg/kg) + PJ34 (5 mg/kg) or Mdivi‐1 (25 mg/kg) daily for 5 days.

2.3. Cell Culture

The mouse macrophage cell line, RAW264.7 (STR identification report is given in Document S1), was purchased from American Type Culture Collection (ATCC). RAW264.7 was cultured using high‐glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS, 100 U/mL penicillin, and 0.1 g/mL streptomycin in a humidified incubator (37°C. 5% CO2), and passaged every other day.

TRPM2 knockout RAW264.7 cells were created using the CRISPR/Cas9 method as described in our previous study [23]. The sgRNA sequences (5′–3′) are as follows:

Trpm2‐sgRNA‐A: 5′‐CACCGTTATACCCACGAGCAACACT‐3′.

Trpm2‐sgRNA‐B: 5′‐AAACAGTGTTGCTCGTGGGTATAAC‐3′.

For TRPM2 overexpression (TRPM2‐OE), vector GV492 was used, and the TRPM2‐OE lentivirus was constructed by Shanghai Genechem Co. Ltd. (Shanghai, China). The TRPM2‐OE lentivirus was used to infect RAW264.7 cells (MOI = 100), and the infected cells were subjected to puromycin selection and FACS to remove the negative cells.

The mouse hepatic stellate cell line JS‐1 was kindly provided by Prof. Jinsheng Guo of the Department of Gastroenterology and Hepatology, Zhongshan Hospital (Fudan University, China). The cells were maintained in DMEM containing 15% FBS.

The human monocyte cell line, THP‐1, was purchased from ATCC, maintained in DMEM containing 10% FBS, and induced into macrophages with PMA (100 ng/mL) for subsequent experiments.

Bone marrow‐derived macrophages (BMDMs) were prepared as described in our previous work [24].

2.4. BioParticle Phagocytosis Analysis

For FACS‐based measurement of phagocytosis, RAW264.7 cells were seeded in a 12‐well plate at a density of 1.5 × 105 cells/well, incubated for 24 h, and the cells were subjected to different treatments. Subsequently, the cells were collected, washed and resuspended with 300 μL pre‐warmed DMEM containing 2 μL Escherichia coli BioParticles, and then incubated at 37°C for 2 h. After that, the cells were washed extensively with cold PBS twice, and the fluorescence of extracellular particles was quenched by replacing the medium with PBS containing 7‐AAD shortly before FACS analysis. In some experiments indicated in the legends, cells were pretreated with 25 to 400 μM H2O2, 20 μM 2‐APB, 2.5–5 μM BAPTA‐AM and 50 μM Mdivi‐1 alone or in combination.

2.5. Phagocytosis of Apoptotic Hepatic Stellate Cells

Before coculture, JS1 cells in good condition were passaged and cultured for 24 h, then irradiated with UV for 3 h and collected by centrifuging at 13 000 rcf for 5 min. After then, RAW 264.7 (5.5 × 105) predyed with 2 μM CellTracker Red CMTPX dye (C34552, Invitrogen) was cocultured with UV‐irradiated JS1 (3 × 105) predyed with 2.5 μM CFSE (C34554, Invitrogen) in the presence of 100 μM H2O2 with 20 μM 2‐APB or 50 μM or not in a 35 mm dish. After 12–16 h, cells were gently blown down and collected for phagocytosis analysis or examined under fluorescence microscopy. Phagocytosis efficiency was determined as the percentage of CMTPX and CFSE double positive cells in total CMTPX+ cells by flow cytometry.

2.6. Statistical Analysis

All data are shown as the mean ± standard deviation (SD), and all statistical analysis was performed using Graphpad Prism 8 and IBM SPSS Statistics 25. Student's t test, one‐way ANOVA, and multiple comparisons (LSD) after ANOVA (the assumptions of normality and homogeneity of variances are satisfied), and Kruskal–Wallis H test (the assumption of homogeneity of variances is not satisfied) are performed for the statistical significance between and among groups. p < 0.05 is considered to be statistically significant.

3. Results

3.1. Hepatic Macrophages in the Regression Stage of Fibrosis Show High TRPM2 Expression and Strong Phagocytosis

Elucidating the initiation mechanism of fibrosis regression holds significant importance for formulating therapeutic strategies against liver fibrosis. Considering the established role of macrophage‐mediated phagocytosis of apoptotic cells and cell debris in facilitating fibrosis regression [3], we utilised liver fibrosis mouse models to investigate the regulatory mechanisms underlying macrophage phagocytosis and the initiation of its restoration phenotype during the process of fibrosis regression. In our mouse model of CCl4‐induced liver fibrosis, liver injury regression (R) occurred between 72 and 96 h after the last CCl4 injection, followed by more protracted regression (r) of residual fibrosis [25] (Figure 1A–D). The fibrogenesis stage (F) was characterised by the increased expression of proinflammatory and profibrotic cytokines and chemokines such as IL‐6, TNF‐α, TGF‐β, CCL2 and CCL7. As fibrosis began to regress (R), it showed upregulated expression of MMPs and downregulated expression of tissue inhibitor of metalloproteinases‐1 (TIMP1). Moreover, with the progression of regression (r), the levels of proinflammatory and profibrotic cytokines gradually decreased (Figure 1E,F). In a subsequent study, we chose the R stage as the critical point at which macrophages initiated their phenotypic transformation.

FIGURE 1.

FIGURE 1

The expression of MMPs is upregulated when liver fibrosis begins to regress. (A) Scheme of liver fibrosis and fibrosis regression model construction. Three days after 4 weeks of CCl4 injection, the liver fibrosis (F) group received a final injection of CCl4 and sampled the next day, the fibrosis regression (R) group was sampled the next day without CCl4 injection, and the post‐regression (r) group was sampled 2 weeks later without CCl4 injection. (B, C) The liver tissues in each group were harvested for photograph (B) and Sirius Red staining (C) to evaluate the severity of liver fibrosis. (D) The expression of collagens in each group was detected by RT‐qPCR. (E) The expression of cytokines and chemokines with proinflammatory and profibrotic functions was detected by RT‐qPCR. (F) The expression of collagen‐degradation related matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinase (TIMP‐1) was analysed by RT‐qPCR. *, ** and *** stand for p < 0.05, p < 0.01 and p < 0.001, respectively.

During the regression stage, macrophages did not accumulate in the liver as much as they did in the fibrogenesis stage (Figure S1A). However, both monocyte‐derived macrophages (MoMFs) and liver‐resident Kupffer cells (KCs) exhibited enhanced phagocytic capacity (Figure 2A). Enhanced phagocytosis enabled them to more effectively clear the apoptotic cells, resulting in fewer apoptotic cells in the regression stage (Figure 2B). Considering that several members of the TRP family have been reported to be associated with macrophage phagocytosis, we screened for TRP members that were highly expressed during the fibrosis regression stage and identified TRPM2 (Figure 2C). The higher expression of TRPM2 during the regression stage, compared to the fibrogenesis stage, was validated at both the mRNA and protein levels (Figure 2C,D), with particularly high expression observed in hepatic macrophages (Figure 2E, Figure S1B). Through the analysis of a human liver single‐cell RNA sequencing (scRNA‐seq) dataset (GSE136103), we found that TRPM2 is predominantly expressed in T cells and macrophages (Figure 2F). Further subdivision of macrophages into three subsets revealed that TRPM2 exhibits higher and comparable expression levels in MoMFs and KCs (Figure 2G). We also inquired into the mouse liver single‐cell sequencing data from the MCA database (https://bis.zju.edu.cn/MCA/). The results confirmed that TRPM2 was also highly expressed in mouse macrophages (Figure 2H). These data highlight the role of macrophage TRPM2 in the regression of liver fibrosis.

FIGURE 2.

FIGURE 2

Hepatic macrophages exhibit high TRPM2 expression and strong phagocytosis during the regression stage of fibrosis. (A) The phagocytic ratio of hepatic macrophages of each group was analysed by flow cytometry. (B) The apoptotic cells in the liver of each group were assessed by Tunel staining. (C) The expression of TRP family members in each group was analysed by RT‐qPCR. (D) The protein expression levels of TRPM2 in the liver tissues of each group were examined by immunoblot analysis. (E) Expression of TRPM2 in hepatic macrophages (Mφs) and hepatic cells excluding macrophages (No Mφs) were compared by RT‐qPCR. (F) Data of expression levels of TRPM2 in distinct clusters of liver cells at single cell level was analysed using the dataset GSE136103. (G) Data of expression levels of TRPM2 in distinct hepatic macrophage sub‐clusters at single cell level was analysed using the dataset GSE136103. (H) Data of expression levels of TRPM2 in distinct cell clusters and different organs at single cell level was inquired from the MCA database. *, ** and *** stand for p < 0.05, p < 0.01 and p < 0.001, respectively. ILC, innate lymphoid cell; KC, Kupffer cell; MoMF, monocyte‐derived macrophage; MP, macrophage; SAMac, scar‐associated macrophage.

3.2. TRPM2 Is Involved With the Phagocytosis of Macrophages

To investigate whether the upregulated expression of TRPM2 in macrophages during the fibrosis resolution stage is associated with their enhanced phagocytic capacity, we constructed RAW264.7 cells constitutively overexpressing TRPM2 (TRPM2‐OE) (Figure 3A) and utilised RNA sequencing to analyse their genome‐wide mRNA expression changes. GO and pathway analysis were performed to summarise the significant differences between TRPM2‐OE and Ctrl RAW264.7 cells. The results demonstrated that genes related to signalling pathways that play important roles in phagocytosis, including ERK, PI3K and Rho protein signal transduction [26], as well as genes associated with phagocytosis, such as actin cytoskeleton organisation, phagosome assembly and maturation [27], were enriched in TRPM2‐OE RAW264.7 (Figure 3B,C). Testing with FITC‐labelled E. coli BioParticles, RAW264.7 cells were confirmed to possess the ability to phagocytose (Figure S2). Then, we examined the effect of TRPM2 overexpression (OE) or knockout (KO) on macrophage phagocytosis. TRPM2‐OE dramatically enhanced phagocytosis (Figure 3D), and TRPM2‐KO (Figure 3E, KO‐2 and KO‐3, which exhibited superior knockout efficiency, were chosen for follow‐up studies) resulted in impaired cell phagocytosis (Figure 3F). Collectively, these results suggested a role for TRPM2 in regulating macrophage phagocytosis, and its impact on phagocytosis was not attributable to effects on cell viability (Figure 3G,H).

FIGURE 3.

FIGURE 3

TRPM2 is involved with the phagocytosis of macrophages. (A) Verification of the successful construction of constitutive TRPM2‐overexpression (TRPM2‐OE) RAW264.7 cells by immunoblot analysis. (B, C) RNA‐seq analysis was performed between Ctrl and TRPM2‐OE RAW264.7 cells to clarify potential activities and signalling in macrophages influenced by TRPM2. A volcano plot was created to show differentially expressed genes in Ctrl and TRPM2‐OE RAW264.7 cells (B). Besides, GO and pathway enrichment analysis was performed to summarise the significant differences between Ctrl and TRPM2‐OE RAW264.7 cells (C). (D) The phagocytic ratio of Ctrl and TRPM2‐OE RAW264.7 cells was analysed. (E) Verification of the successful construction of TRPM2‐knockout (TRPM2‐KO) RAW264.7 cells by immunoblot analysis. (F) The phagocytic ratio of Ctrl and TRPM2‐KO (KO‐2 and KO‐3) RAW264.7 cells was analysed. (G) The cell viability of Ctrl and TRPM2‐OE RAW264.7 cells was compared by CCK‐8. (H) The cell viability of Ctrl and TRPM2‐KO RAW264.7 cells was compared by CCK‐8. ** and *** stand for p < 0.01 and p < 0.001, respectively. Ctrl, normal RAW264.7 cells; H2O2, RAW264.7 cells treated with 100 μM H2O2; OE, TRPM2‐overexpression RAW264.7 cells; KO, TRPM2‐knockout RAW264.7 cells.

3.3. ROS Activates TRPM2 to Regulate Macrophage Phagocytosis

ROS serve as crucial signalling molecules to activate TRPM2. The role of high levels of ROS during liver injury has been widely recognised, and we also detected high levels of ROS in our CCl4‐induced fibrogenesis mouse model. However, in our fibrosis regression model, the livers exhibited higher levels of TRPM2 (Figure 2D) but lower levels of ROS compared to the liver fibrosis model (Figure 4A,B). Considering the stronger phagocytic capacity of hepatic macrophages during the regression phase (Figure 2A), we hypothesised that the regulation of macrophage phagocytosis by TRPM2 was related to the intensity of ROS, thereby enabling macrophages to play different roles during the progression and regression of liver fibrosis. After then, we attempted to utilise RAW264.7 cells to investigate the impact of this coordinated interaction between TRPM2 and ROS on macrophage function.

FIGURE 4.

FIGURE 4

ROS activates TRPM2 activation to regulate macrophage phagocytosis. (A, B) The ROS intensity in each group was assessed by DHE staining of either fresh frozen liver tissues (A) or tissue homogenate (B). (C, D) The phagocytic ratio of RAW264.7 cells was analysed by flow cytometry after 6 h (C) or 24 h (D) treatment with different concentrations of H2O2. Percentages of FITC+ cells that phagocytosed the Escherichia coli BioParticles were then calculated. (E) The protein expression level of TRPM2 after 6 h (upper) or 24 h (lower) treatment with 100 μM H2O2 was examined by immunoblot analysis. (F) The expression levels of scavenger receptors were detected by flow cytometry. The MFI of each scavenger receptor was calculated. (G) The phagocytic ratio of RAW264.7 cells was analysed by flow cytometry after 100 μM H2O2 treatment with or without 20 μM 2‐APB. (H) The phagocytic ratio of Ctrl and TRPM2‐KO RAW264.7 cells treated with or without 100 μM H2O2 was analysed. (I) The phagocytic ratio of Ctrl and TRPM2‐OE RAW264.7 cells treated with or without 100 μM H2O2 was analysed. *, ** and *** stand for p < 0.05, p < 0.01 and p < 0.001, respectively. Ctrl, normal RAW264.7 cells; H2O2, RAW264.7 cells treated with 100 μM H2O2; OE, TRPM2‐overexpression RAW264.7 cells; KO, TRPM2‐knockout RAW264.7 cells.

RAW264.7 cells were treated with increasing doses of H2O2 for 6 h and 24 h respectively, and then, their phagocytic capacity was evaluated. The 6‐h treatment enhanced phagocytosis at low doses but weakened it at a higher dose of 200 μM (Figure 4C), while the 24‐h treatment enhanced phagocytosis dose‐dependently (Figure 4D). Only at the highest concentration did H2O2 treatment slightly impair cell viability (Figure S3). The differences caused by different treatment durations may be due to the increased expression of TRPM2 induced by the 24‐h H2O2 treatment (Figure 4E), suggesting that adequate TRPM2 is required to respond to ROS‐induced phagocytosis. Meanwhile, H2O2 treatment also upregulated the expression levels of scavenger receptors like SCARA1 (CD204), CD36 and Tim4 (Figure 4F), all of which function as pattern recognition receptors for macrophages to mediate the clearance of pathogens, apoptotic cells, and modified lipoproteins.

Pre‐treatment with TRPM2 inhibitor or knockout of TRPM2 (TRPM2‐KO) impaired cell phagocytosis induced by 100 μM H2O2 (Figure 4G,H), and this was also verified in bone marrow‐derived macrophages (BMDMs, CD11b+F4/80+, Figure S4) and human THP‐1‐induced macrophages (Figure S5). Overexpression of TRPM2 dramatically enhanced the phagocytic capacity of macrophages, but treatment with 100 μM H2O2 only slightly increased the phagocytosis of TRPM‐OE cells (Figure 4I). This might be due to the inability of 100 μM H2O2 to provide the necessary signals for highly expressed TRPM2, thus failing to further enhance phagocytosis.

3.4. ROS and TRPM2 Coordinate to Regulate the Phenotypic Transformation of Macrophages

Having clarified the impact of ROS‐TRPM2 on macrophage phagocytosis, our next step is to simulate different intensities of reactive oxygen species (ROS) and varying expression levels of TRPM2 during the processes of liver fibrosis and its regression, in order to explore their effects on the plastic functions of macrophages. By treating RAW264.7 separately with high‐intensity (400 μM) and low‐intensity (100 μM) H2O2, we found that the low‐intensity H2O2 was more effective in upregulating the expression of TRPM2 (Figure 5A). This result was consistent with the conditions observed in the process of fibrosis regression (Figure 2D). The high‐intensity H2O2 showed a stronger capacity in increasing the expression of cytokines and chemokines with profibrotic and proinflammatory functions, but did not up‐regulate the expression of MMPs well (Figure 5B,C). In the TRPM2‐KO cells, the high‐intensity H2O2 exhibited an even stronger effect in increasing the expression of cytokines (Figure S6).

FIGURE 5.

FIGURE 5

ROS‐TRPM2 coordinate to regulate the phenotypic transformation of macrophages. (A) The expression of TRPM2 in RAW264.7 cells treated with 100 or 400 μM H2O2 for 24 h was detected by RT‐qPCR. (B) The expression of MMPs was analysed by RT‐qPCR among RAW264.7 cells treated with 100 or 400 μM H2O2. (C) The expression of proinflammatory and profibrotic cytokines and chemokines was analysed by RT‐qPCR among RAW264.7 cells treated with 100 or 400 μM H2O2. (D) The phagocytosis ability of RAW264.7 cells to apoptotic JS1 cells was analysed by flow cytometry after H2O2 treatment with or without 2‐APB. RAW264.7 cells that phagocytosing apoptotic JS1 cells were CFSE and CMTPX double positive. (E) Percentages of CFSE and CMTPX double positive cells were then calculated. (F) The expression of MMPs was analysed by RT‐qPCR among RAW264.7 cells treated with 100 or 400 μM H2O2 after phagocysing apoptotic JS1 cells. (G) The expression of proinflammatory and profibrotic cytokines and chemokines was analysed by RT‐qPCR among RAW264.7 cells treated with 100 or 400 μM H2O2 after phagocyting apoptotic JS1 cells. *, ** and *** stand for p < 0.05, p < 0.01 and p < 0.001, respectively.

We further designed to investigate the effect of phagocytosis on shifting the functions of macrophages. Clearance of the apoptotic hepatic stellate cells (HSCs) is a key step in the process of liver injury reversion [28, 29], and hepatic macrophages are capable of clearing them by phagocytosis. Therefore, we constructed the model of macrophages phagocytosing apoptotic HSC for testing. The apoptotic HSC cell line JS1 was obtained by UV irradiation (Figure S7A) and then labelled with green fluorescence. After co‐incubation with RAW264.7 cells labelled with red fluorescence, the phagocytosis of JS1 debris by RAW264.7 was detected as green‐red double‐positive (Figure 5D and S7B). Treatment with 100 μM H2O2 dramatically enhanced the phagocytosis of apoptotic HSCs by macrophages, whereas pre‐treatment with TRPM2 inhibitor 2‐APB attenuated this effect (Figure 5D,E).

H2O2‐induced phagocytosis helped upregulate the expression of MMP9, MMP12 and MMP13 even under the stimulation of high‐intensity H2O2, but did not gain much expression of cytokines and chemokines (Figure 5F,G). Treatment with TRPM2 inhibitor decreased the expression of MMPs, but it only showed an inhibition effect on cytokines such as IL‐6, TNF‐α and TGF‐β when their expression was successfully up‐regulated by H2O2 (Figure S7C). These data indicate that the effect of macrophage phagocytosis mediated by ROS‐TRPM2 coordination is responsible for the shift of macrophages into a restorative phenotype, which may facilitate the function of macrophages in liver fibrosis regression.

3.5. Mitochondrial Fission Plays a Role in Phagocytosis‐Promoted Phenotypic Transformation of Macrophages

TRPM2 has been recognised as transmitting information through Ca2+ signalling to trigger changes in cell activity. Therefore, we evaluated the role of Ca2+ signaling in ROS‐TRPM2 modulated macrophage phagocytosis. As expected, H2O2 treatment induced Ca2+ accumulation in both cytoplasm (Figure 6A,B) and mitochondria (Figure 6C,D). Compared to control cells, the accumulation of Ca2+ induced by H2O2 treatment was less in TRPM2‐KO cells, but greater in TRPM2‐OE cells (Figure S8A,B). Moreover, by utilising mitochondrial fluorescent staining and transmission electron microscopy (TEM), we observed that H2O2 treatment‐induced Ca2+ accumulation led to an increase in mitochondrial fission (Figure 6E,F). Chelation of Ca2+ by BAPTA suppressed mitochondrial fission while concurrently compromising the phagocytic capacity of macrophages enhanced by H2O2 treatment (Figure 6G, Figure S8C).

FIGURE 6.

FIGURE 6

ROS‐mediated TRPM2 activation mobilised Ca2+ and promoted mitochondrial fission. (A) Averaged time courses of [Ca2+]i changes indicated by MFI of Fluo4‐AM owing to H2O2 induced Ca2+ influx in RAW264.7. (B) Representative cytometry of cytoplasm Ca2+ intensity indicated by Fluo4‐AM probe in RAW264.7 treated with 100 or 400 μM H2O2 or not treated (Ctrl). MFI of Fluo4 was then calculated. NC, negative control, no Fluo‐4 labelled. (C) Representative cytometry of mitochondrial Ca2+ intensity indicated by Rhod2‐AM probe in RAW264.7 treated with 100 or 400 μM H2O2 or not treated (Ctrl). MFI of Rhod‐2 was then calculated. (D) The influence of H2O2 on mitochondrial Ca2+ intensity was imaged via live cell immunofluorescence assay. The mitochondrial calcium was indicated using Rhod2‐AM probe (Red), and the mitochondria was labelled using Mito‐Tracker Green. (E) The influence of H2O2 on mitochondrial fission was imaged via live cell immunofluorescence assay. The mitochondria were labelled using Mito‐Tracker Green, and the nuclei was labelled with DAPI. (F) Representative electron micrographs of mitochondria in Ctrl and H2O2‐treated RAW264.7 cells. (G) Representative cytometry of phagocytic ratio and mitochondrial morphology images of RAW264.7 treated with H2O2 and 2.5 or 5 μM BAPTA‐AM. Percentages of FITC+ cells that phagocytosed the Escherichia coli BioParticles were then calculated. (H) Changes of protein expression levels of mitochondrial fusion and fission signature molecules after H2O2 treatment was examined by immunoblot analysis. (I) The protein expression levels of mitochondrial fusion and fission signature molecules in H2O2 treated and untreated Ctrl and TRPM2‐OE RAW264.7 cells were examined by immunoblot analysis. (J) The protein expression levels of mitochondrial fusion and fission signature molecules in Ctrl and TRPM2‐KO RAW264.7 cells were examined by immunoblot analysis. (K) Representative electron micrographs of mitochondria in Ctrl, TRPM2‐OE and TRPM2‐KO RAW264.7 cells. *, ** and *** stand for p < 0.05, p < 0.01 and p < 0.001. Mito, Mito‐Tracker Green; −H2O2, RAW264.7 cells not treated with H2O2; +H2O2, RAW264.7 cells treated with H2O2.

At the protein expression level, we also found that macrophages treated with H2O2 expressed lower levels of mitochondrial fusion signature molecules such as OPA1, MFN2 and MFN1, and higher levels of mitochondrial fission signature molecules including FIS1 and DRP1, accompanied by increased phosphorylation of DRP1 at s616 (Figure 6H). The corresponding changes in mitochondrial dynamics‐related proteins were also observed in TRPM2‐OE and TRPM2‐KO macrophages. Compared with the normal control, TRPM2‐OE macrophages had decreased expression of OPA1, MFN1, and increased expression of FIS1 and DRP1. However, when treated with 100 μM H2O2, the expression of these proteins in TRPM2‐OE macrophages only slightly changed compared to normal controls (Figure 6I), suggesting that higher concentrations of H2O2 may be required to meet high levels of TRPM2 expression. In contrast, TRPM2‐KO macrophages had increased expression of MFN2 and MFN1, and decreased expression of FIS1 and DRP1 (Figure 6J). TEM observations also revealed that in TRPM2‐OE macrophages, mitochondria exhibited fission‐related morphologies resembling pinched dumbbells, whereas in TRPM2‐KO macrophages, mitochondria displayed increased fusion morphologies (Figure 6K).

To further clarify the role of mitochondrial fission in the regulation of TRPM2‐mediated macrophage phagocytosis, we conducted additional validations. At the cellular level, intervention with the mitochondrial fission inhibitor Mdivi‐1 (targeting DRP1) effectively reduced mitochondrial fission and counteracted macrophage phagocytosis (Figure 7A,B). Interestingly, the macrophage phagocytosis inhibition induced by Mdivi‐1 treatment more significantly suppressed the up‐regulated expression of MMPs caused by H2O2 treatment, while having minimal impact on cytokines and chemokines (Figure 7C,D), suggesting that it predominantly influenced the restorative phenotype of macrophages. At the animal level, treatment of mice with a liver fibrosis regression model using TRPM2 inhibitors (ACA + PJ34) or Mdivi‐1 both attenuated the phagocytic capacity of hepatic macrophages (Figure 7E) and inhibited fibrosis regression (Figure 7F). In summary, these results demonstrate that under the induction of ROS, TRPM2 enhances macrophage phagocytosis through Ca2+‐promoted mitochondrial fission, thereby promoting the transformation of macrophages towards a restorative phenotype.

FIGURE 7.

FIGURE 7

Mitochondrial fission plays a role in phagocytosis‐promoted phenotypic transformation of macrophages. (A, B) Representative cytometry of phagocytic ratio and mitochondrial morphology images of RAW264.7 treated with H2O2 and/or 50 μM Mdivi‐1. Percentages of FITC+ cells that phagocytosed the Escherichia coli BioParticles were then calculated. (C, D) The expression of MMPs (B) and cytokines/chemokines (C) was analysed by RT‐qPCR among RAW264.7 cells treated with H2O2 and Mdivi‐1. (E) Representative cytometry of phagocytic ratio of hepatic macrophages from different mouse groups. Percentages of FITC+ cells that phagocytosed the E. coli BioParticles were then calculated. (F) The expression of collagens and Acta2 in each group was detected by RT‐qPCR. *, ** and *** stand for p < 0.05, p < 0.01 and p < 0.001, respectively. Ctrl, mice received Oil injection; F, mice with liver fibrosis induced by CCl4 injection; R, mice developed liver fibrosis and then regressed for 5 days; R + ACA, mice of regression group treated with ACA and PJ34; R + Mdivi‐1, mice of regression group treated with Mdivi‐1.

4. Discussion

The phagocytic function of hepatic macrophages is indicated as a trigger for their phenotypic transformation from profibrotic to restorative and is crucial in the regulation of hepatic inflammation and fibrotic outcomes. Here, we demonstrate that the response of TRPM2 to different intensities of ROS regulates the distinct activities of macrophages. In the fibrogenesis period, macrophages with low expression of TRPM2 display proinflammatory and profibrotic effects under the stimulation of a supersaturated intensity of ROS. In the regression period, macrophages with robust expression of TRPM2 respond to appropriate intensity of ROS stimulation, which augments the phagocytosis of macrophages, promoting the transformation of macrophages towards a restorative phenotype. The enhancement of macrophage phagocytosis by ROS‐induced TRPM2 activation is achieved through mitochondrial fission facilitated by Ca2+ signalling. These results indicate that the coordinated regulation of TRPM2 and ROS may be an effective means to promote the transformation of macrophages towards the restorative phenotype, thereby facilitating the regression of liver injury. Therapeutically, our findings suggest the potential to develop therapeutic strategies that facilitate liver fibrosis regression by modulating rather than simply inhibiting oxidative stress.

The transient receptor potential channels (TRP channels) are a family of non‐specific cation channels widely distributed in various tissues and organs, and some of them have been considered as therapeutic targets for relieving oxidative stress‐related diseases, especially representing a versatile signalling mechanism that regulates fundamental physiological processes in the liver [30]. TRP channels are widely expressed in mammalian macrophages [31], mostly influencing the functional properties of macrophages by regulating their polarisation [17, 32, 33, 34, 35]. Some of the TRP channels are also reported to be involved in regulating macrophage phagocytosis. TRPV1 and TRPV2 promoted phagocytosis through the activation of AMPK/mTOR and PDK1/Akt signalling pathways respectively [36, 37]. TRPM7 was demonstrated to have a critical role in macrophage efferocytosis by triggering a pH‐dependent cationic current to sustain phagosomal acidification [38]. TRPV4, TRPM8, as well as TRPM2 were also proven to have a role in bacteria phagocytosis [39], but the regulatory mechanism remains to be uncovered. In our study, we demonstrate that ROS‐modulated activation of TRPM2 could facilitate the accumulation of both cytoplasmic and mitochondrial Ca2+, promote mitochondrial fission, and thereby enhance macrophage phagocytosis. These results provide new insights into the mechanisms of TRP channels in the regulation of macrophage phagocytosis.

Oxidative stress has long been recognised as a causative factor in pathologies of liver fibrosis [40]. ROS can directly activate HSCs or, alternatively, activate HSCs and fibroblasts by inducing inflammation or programmed cell death in hepatocytes [41]. These events cause ECM accumulation and drive the progression of liver fibrosis. Therefore, anti‐oxidative therapy and antioxidants are considered promising means of preventing and treating liver diseases. In mouse liver fibrosis models induced by bile duct ligation‐, CCl4‐, and thioacetamide chronic intoxication, as well as in vitro studies, compounds with antioxidant activity, such as nicotinic acid, caffeine, quercetin and stevioside, have been proven to prevent or reverse the accumulation of ECM proteins or the production of profibrogenic molecules [42, 43, 44, 45, 46]. However, our present study highlights the beneficial role of the coordination between ROS and TRPM2 in enhancing macrophage phagocytosis, which in turn promotes fibrosis regression. That is, during fibrogenesis, high‐intensity ROS induce a high‐load response of TRPM2 in macrophages, stimulating their proinflammatory and profibrotic effects. Once liver injury begins to regress, the level of ROS decreases to an appropriate level, which helps to up‐regulate the expression of TRPM2 in macrophages, promotes phagocytosis enhancement, and shifts macrophages towards a restorative phenotype. Given the possible beneficial effects of ROS in other tissues, controlling ROS rather than systemic antioxidant therapy may be a more favourable option.

Mitochondrial dynamics not only contribute to mitochondrial quality control, but also play a role in signal transduction and metabolism [30]. Imbalanced mitochondrial dynamics can disrupt mitochondrial function and lead to abnormal cellular fate. In macrophages, for example, modulation of mitochondrial dynamics in response to pathogens or innate immune stimuli such as proinflammatory cytokines, antibodies, and PAMPs has been shown to have an impact on various cell activities, including metabolic reprogramming, inflammatory responses, phagocytosis, and anti‐viral responses [13, 14, 47]. Oxidative stress is another stressor for inducing changes in mitochondrial dynamics, and this has been verified in smooth muscle and mesenchymal stem cells [40, 48]. In our study, we observed that the enhancement of macrophage phagocytosis after H2O2 treatment was accompanied by up‐regulation of mitochondrial fission‐related proteins and down‐regulation of fusion‐related proteins. The mitochondria of macrophages treated with H2O2 were more likely to present a fragmentation morphology. Blocking mitochondrial fission with DRP1 inhibitor dramatically reversed these conditions. However, while TRPM2‐OE and TRPM2‐KO changed the expression trends of mitochondrial fission‐related proteins accordingly, they did not completely change the expression trend of fusion‐related proteins as expected in our study. MFN1 and MFN2 are related to the outer mitochondrial membrane fusion, and OPA1 is the sole inner mitochondrial membrane protein [49]. Previous studies proved that OPA1 was unable to tubulate and fuse mitochondria lacking MFN1 but not MFN2 [50]. TRPM2‐OE enhanced the regulatory effect of TRPM2 on mitochondrial dynamics and down‐regulated both outer membrane (MFN1) and inner membrane (OPA1) fusion‐related proteins. TRPM2‐KO only up‐regulated the outer membrane fusion‐related proteins (MFN1 and MFN2), but not the inner membrane fusion‐related OPA1, suggesting that the effect of TRPM2 may be compensated by other mechanisms. Therefore, as a next step, the detailed mechanism through which TRPM2 regulates mitochondrial fission and the influence of mitochondrial fission on macrophage phenotypic transformation deserves further investigation.

In summary, our work demonstrates that the coordinated action of ROS‐TRPM2 in macrophages enhances phagocytosis through promoting mitochondrial fission, which contributes to the transformation of macrophages from a profibrotic phenotype to a restorative phenotype, thereby playing a role in the regression of liver fibrosis. Otherwise, during the stage of liver fibrosis, high‐intensity ROS prompts TRPM2 signalling to primarily stimulate the secretion of proinflammatory factors by macrophages. Our findings provide achievable ideas and targets for the control of liver fibrosis. TRPM2–based modulation of the functional switch of hepatic macrophages via biological engineering or targeted drugs is expected to alleviate liver fibrosis. Modern drug delivery technologies such as using protein carriers or polymeric nanoparticles which contain active drugs controlling oxidative stress and directly target hepatic macrophages might be promising approaches in the treatment of liver fibrosis.

Author Contributions

All authors contributed to the study conception and design. S.Z., F.L. and D.W. performed most of the experiments. Y.Z. helped with RT‐qPCR and western blotting analysis. C.Z. and K.F. helped with mouse breeding and animal model construction. X.Z. helped with the TRPM2‐KO cell construction. N.H. performed the immune‐histochemical experiments. X.L., N.G., C.Z. and Z.Z. helped with cell sorting and flow cytometry. Y.L., P.L. and J.G. helped interpret the data. S.Z. and F.L. generated the figures and wrote the manuscript. G.K. and S.L. provided meaningful suggestions and technical assistance. Z.L. designed and supervised the study. All authors read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1: STR report for RAW264.7 cell.

LIV-45-0-s003.pdf (1.4MB, pdf)

Data S2: Full images for figures presenting cropped images of western blotting results.

LIV-45-0-s002.pdf (2.5MB, pdf)

Figure S1: Frequencies and TRPM2 expression of macrophages in liver fibrosis and regression mouse models.

Figure S2: RAW264.7 cells have the ability to phagocytose Escherichia coli BioParticles.

Figure S3: H2O2 treatment has little effect on RAW264.7 cell viability.

Figure S4: TRPM2 is important for the phagocytosis of BMDMs.

Figure S5: TRPM2 is important for the phagocytosis of THP‐1 cells.

Figure S6: TRPM2‐KO facilitates the up‐regulation of proinflammatory cytokines by high‐intensity H2O2.

Figure S7: RAW264.7 cells have the ability to phagocytose apoptotic hepatic stellate cells.

Figure S8: TRPM2‐modulated Ca2+ accumulation promotes mitochondrial fission.

Table S1: Primer sequences.

LIV-45-0-s001.docx (2.6MB, docx)

Zhang S., Liang F., Wan D., et al., “Reactive Oxygen Species‐Mediated TRPM2 Activation Facilitates Phagocytosis of Macrophages to Reverse Profibrotic Phenotype,” Liver International 45, no. 10 (2025): e70341, 10.1111/liv.70341.

Handling Editor: Luca Valenti

Funding: This work was supported by the National Natural Science Foundation of China (no. 82101915, 82471849 and 91842307), the Innovation Capability Support Program of Shaanxi Province (no. 2025ZC‐KJXX‐93), the Natural Science Foundation of Shaanxi Province (no. 2023‐JC‐QN‐0918 and 2023‐JC‐YB‐647) and the Foundation of the Second Affiliated Hospital Xi'an Jiaotong University (no. YXJLRH2022099 and 2020YJ (ZYTS) 546‐01).

Shaoying Zhang and Fanfan Liang contributed equally to this work.

Data Availability Statement

The data that support the findings of this study are openly available in SRA database at https://submit.ncbi.nlm.nih.gov/subs/sra/SUB15534511/overview, reference number PRJNA1306199.

References

  • 1. Kisseleva T. and Brenner D., “Molecular and Cellular Mechanisms of Liver Fibrosis and Its Regression,” Nature Reviews Gastroenterology & Hepatology 18 (2021): 151–166, 10.1038/s41575-020-00372-7. [DOI] [PubMed] [Google Scholar]
  • 2. Dixon L. J., Barnes M., Tang H., Pritchard M. T., and Nagy L. E., “Kupffer Cells in the Liver,” Comprehensive Physiology 3, no. 2 (2013): 785–797, 10.1002/cphy.c120026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Kourtzelis I., Hajishengallis G., and Chavakis T., “Phagocytosis of Apoptotic Cells in Resolution of Inflammation,” Frontiers in Immunology 11 (2020): 553, 10.3389/fimmu.2020.00553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Wen Y., Lambrecht J., Ju C., and Tacke F., “Hepatic Macrophages in Liver Homeostasis and Diseases‐Diversity, Plasticity and Therapeutic Opportunities,” Cellular and Molecular Immunology 18, no. 1 (2021): 45–56, 10.1038/s41423-020-00558-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Kim S. Y., Jeong J. M., Kim S. J., et al., “Pro‐Inflammatory Hepatic Macrophages Generate ROS Through NADPH Oxidase 2 via Endocytosis of Monomeric TLR4‐MD2 Complex,” Nature Communications 8 (2017): 2247, 10.1038/s41467-017-02325-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Starkey Lewis P., Campana L., Aleksieva N., et al., “Alternatively Activated Macrophages Promote Resolution of Necrosis Following Acute Liver Injury,” Journal of Hepatology 73, no. 2 (2020): 349–360, 10.1016/j.jhep.2020.02.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Gordon S., “Phagocytosis: An Immunobiologic Process,” Immunity 44 (2016): 463–475, 10.1016/j.immuni.2016.02.026. [DOI] [PubMed] [Google Scholar]
  • 8. Freeman S. A. and Grinstein S., “Phagocytosis: Receptors, Signal Integration, and the Cytoskeleton,” Immunological Reviews 262 (2014): 193–215, 10.1111/imr.12212. [DOI] [PubMed] [Google Scholar]
  • 9. Li J., Ye Y., Liu Z., et al., “Macrophage Mitochondrial Fission Improves Cancer Cell Phagocytosis Induced by Therapeutic Antibodies and Is Impaired by Glutamine Competition,” Nature Cancer 3 (2022): 453–470, 10.1038/s43018-022-00354-5. [DOI] [PubMed] [Google Scholar]
  • 10. Mills E. L., Kelly B., and O'Neill L. A. J., “Mitochondria Are the Powerhouses of Immunity,” Nature Immunology 18 (2017): 488–498, 10.1038/ni.3704. [DOI] [PubMed] [Google Scholar]
  • 11. Mehta M. M., Weinberg S. E., and Chandel N. S., “Mitochondrial Control of Immunity: Beyond ATP,” Nature Reviews Immunology 17 (2017): 608–620, 10.1038/nri.2017.66. [DOI] [PubMed] [Google Scholar]
  • 12. Rambold A. S. and Pearce E. L., “Mitochondrial Dynamics at the Interface of Immune Cell Metabolism and Function,” Trends in Immunology 39 (2018): 6–18, 10.1016/j.it.2017.08.006. [DOI] [PubMed] [Google Scholar]
  • 13. Shen Y. L., Shi Y. Z., Chen G. G., et al., “TNF‐α Induces Drp1‐Mediated Mitochondrial Fragmentation During Inflammatory Cardiomyocyte Injury,” International Journal of Molecular Medicine 41 (2018): 2317–2327, 10.3892/ijmm.2018.3385. [DOI] [PubMed] [Google Scholar]
  • 14. Kapetanovic R., Afroz S. F., Ramnath D., et al., “Lipopolysaccharide Promotes Drp1‐Dependent Mitochondrial Fission and Associated Inflammatory Responses in Macrophages,” Immunology and Cell Biology 98 (2020): 528–539, 10.1111/imcb.12363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Chen S., Li Q., Shi H., Li F., Duan Y., and Guo Q., “New Insights Into the Role of Mitochondrial Dynamics in Oxidative Stress‐Induced Diseases,” Biomedicine & Pharmacotherapy 178 (2024): 117084, 10.1016/j.biopha.2024.117084. [DOI] [PubMed] [Google Scholar]
  • 16. Maliougina M. and El Hiani Y., “TRPM2: Bridging Calcium and ROS Signaling Pathways‐Implications for Human Diseases,” Frontiers in Physiology 14 (2023): 1217828, 10.3389/fphys.2023.1217828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Beceiro S., Radin J. N., Chatuvedi R., et al., “TRPM2 Ion Channels Regulate Macrophage Polarization and Gastric Inflammation During Helicobacter pylori Infection,” Mucosal Immunology 10 (2017): 493–507, 10.1038/mi.2016.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Chen S. J., Bao L., Keefer K., et al., “Transient Receptor Potential Ion Channel TRPM2 Promotes AML Proliferation and Survival Through Modulation of Mitochondrial Function, ROS, and Autophagy,” Cell Death & Disease 11 (2020): 247, 10.1038/s41419-020-2454-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Rajan S., Shalygin A., Gudermann T., Chubanov V., and Dietrich A., “TRPM2 Channels Are Essential for Regulation of Cytokine Production in Lung Interstitial Macrophages,” Journal of Cellular Physiology 239 (2024): e31322, 10.1002/jcp.31322. [DOI] [PubMed] [Google Scholar]
  • 20. Zong P., Lin Q., Feng J., and Yue L., “A Systemic Review of the Integral Role of TRPM2 in Ischemic Stroke: From Upstream Risk Factors to Ultimate Neuronal Death,” Cells 11 (2022): 491, 10.3390/cells11030491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhong C., Yang J., Zhang Y., et al., “TRPM2 Mediates Hepatic Ischemia‐Reperfusion Injury via ca(2+)‐Induced Mitochondrial Lipid Peroxidation Through Increasing ALOX12 Expression,” Research (Washington, D.C.) 6 (2023): 0159, 10.34133/research.0159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Ali E. S., Rychkov G. Y., and Barritt G. J., “TRPM2 Non‐Selective Cation Channels in Liver Injury Mediated by Reactive Oxygen Species,” Antioxidants (Basel) 10 (2021): 1243, 10.3390/antiox10081243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Liu P., de la Vega M. R., Dodson M., et al., “Spermidine Confers Liver Protection by Enhancing NRF2 Signaling Through a MAP1S‐Mediated Noncanonical Mechanism,” Hepatology 70 (2019): 372–388, 10.1002/hep.30616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Geng J., Shi Y., Zhang J., et al., “TLR4 Signalling via Piezo1 Engages and Enhances the Macrophage Mediated Host Response During Bacterial Infection,” Nature Communications 12 (2021): 3519, 10.1038/s41467-021-23683-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Ramachandran P., Pellicoro A., Vernon M. A., et al., “Differential Ly‐6C Expression Identifies the Recruited Macrophage Phenotype, Which Orchestrates the Regression of Murine Liver Fibrosis,” Proceedings of the National Academy of Sciences of the United States of America 109 (2012): E3186‐3195, 10.1073/pnas.1119964109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Uribe‐Querol E. and Rosales C., “Phagocytosis: Our Current Understanding of a Universal Biological Process,” Frontiers in Immunology 11 (2020): 1066, 10.3389/fimmu.2020.01066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Mylvaganam S., Freeman S. A., and Grinstein S., “The Cytoskeleton in Phagocytosis and Macropinocytosis,” Current Biology 31 (2021): R619–R632, 10.1016/j.cub.2021.01.036. [DOI] [PubMed] [Google Scholar]
  • 28. Iredale J. P., Benyon R. C., Pickering J., et al., “Mechanisms of Spontaneous Resolution of Rat Liver Fibrosis. Hepatic Stellate Cell Apoptosis and Reduced Hepatic Expression of Metalloproteinase Inhibitors,” Journal of Clinical Investigation 102 (1998): 538–549, 10.1172/jci1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Matsuda M. and Seki E., “Hepatic Stellate Cell‐Macrophage Crosstalk in Liver Fibrosis and Carcinogenesis,” Seminars in Liver Disease 40 (2020): 307–320, 10.1055/s-0040-1708876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Afroz S. F., Raven K. D., Lawrence G., Kapetanovic R., Schroder K., and Sweet M. J., “Mitochondrial Dynamics in Macrophages: Divide to Conquer or Unite to Survive?,” Biochemical Society Transactions 51 (2023): 41–56, 10.1042/bst20220014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Wu J., Li Z., Deng Y., et al., “Function of TRP Channels in Monocytes/Macrophages,” Frontiers in Immunology 14 (2023): 1187890, 10.3389/fimmu.2023.1187890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Tao L., Guo G., Qi Y., et al., “Inhibition of Canonical Transient Receptor Potential 5 Channels Polarizes Macrophages to an M1 Phenotype,” Pharmacology 105 (2020): 202–208, 10.1159/000503452. [DOI] [PubMed] [Google Scholar]
  • 33. Lv Z., Xu X., Sun Z., et al., “TRPV1 Alleviates Osteoarthritis by Inhibiting M1 Macrophage Polarization via ca(2+)/CaMKII/Nrf2 Signaling Pathway,” Cell Death & Disease 12 (2021): 504, 10.1038/s41419-021-03792-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Dutta B., Goswami R., and Rahaman S. O., “TRPV4 Plays a Role in Matrix Stiffness‐Induced Macrophage Polarization,” Frontiers in Immunology 11 (2020): 570195, 10.3389/fimmu.2020.570195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Khalil M., Babes A., Lakra R., et al., “Transient Receptor Potential Melastatin 8 Ion Channel in Macrophages Modulates Colitis Through a Balance‐Shift in TNF‐Alpha and Interleukin‐10 Production,” Mucosal Immunology 9, no. 6 (2016): 1500–1513, 10.1038/mi.2016.16. [DOI] [PubMed] [Google Scholar]
  • 36. Yuan J., Liu H., Zhang H., Wang T., Zheng Q., and Li Z., “Controlled Activation of TRPV1 Channels on Microglia to Boost Their Autophagy for Clearance of Alpha‐Synuclein and Enhance Therapy of Parkinson's Disease,” Advanced Materials 34 (2022): e2108435, 10.1002/adma.202108435. [DOI] [PubMed] [Google Scholar]
  • 37. Yang S., Du Y., Zhao X., et al., “Cannabidiol Enhances Microglial Beta‐Amyloid Peptide Phagocytosis and Clearance via Vanilloid Family Type 2 Channel Activation,” International Journal of Molecular Sciences 23 (2022): 5367, 10.3390/ijms23105367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Schappe M. S., Stremska M. E., Busey G. W., et al., “Efferocytosis Requires Periphagosomal ca(2+)‐Signaling and TRPM7‐Mediated Electrical Activity,” Nature Communications 13 (2022): 3230, 10.1038/s41467-022-30959-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Alavi M. S., Soheili V., and Roohbakhsh A., “The Role of Transient Receptor Potential (TRP) Channels in Phagocytosis: A Comprehensive Review,” European Journal of Pharmacology 964 (2024): 176302, 10.1016/j.ejphar.2023.176302. [DOI] [PubMed] [Google Scholar]
  • 40. Ren L., Chen X., Chen X., Li J., Cheng B., and Xia J., “Mitochondrial Dynamics: Fission and Fusion in Fate Determination of Mesenchymal Stem Cells,” Frontiers in Cell and Developmental Biology 8 (2020): 580070, 10.3389/fcell.2020.580070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. An P., Wei L. L., Zhao S., et al., “Hepatocyte Mitochondria‐Derived Danger Signals Directly Activate Hepatic Stellate Cells and Drive Progression of Liver Fibrosis,” Nature Communications 11 (2020): 2362, 10.1038/s41467-020-16092-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Arauz J., Rivera‐Espinoza Y., Shibayama M., Favari L., Flores‐Beltrán R. E., and Muriel P., “Nicotinic Acid Prevents Experimental Liver Fibrosis by Attenuating the Prooxidant Process,” International Immunopharmacology 28 (2015): 244–251, 10.1016/j.intimp.2015.05.045. [DOI] [PubMed] [Google Scholar]
  • 43. Arauz J., Zarco N., Segovia J., Shibayama M., Tsutsumi V., and Muriel P., “Caffeine Prevents Experimental Liver Fibrosis by Blocking the Expression of TGF‐β,” European Journal of Gastroenterology & Hepatology 26 (2014): 164–173, 10.1097/MEG.0b013e3283644e26. [DOI] [PubMed] [Google Scholar]
  • 44. Casas‐Grajales S., Vázquez‐Flores L. F., Ramos‐Tovar E., et al., “Quercetin Reverses Experimental Cirrhosis by Immunomodulation of the Proinflammatory and Profibrotic Processes,” Fundamental & Clinical Pharmacology 31 (2017): 610–624, 10.1111/fcp.12315. [DOI] [PubMed] [Google Scholar]
  • 45. Ramos‐Tovar E., Hernández‐Aquino E., Casas‐Grajales S., et al., “Stevia Prevents Acute and Chronic Liver Injury Induced by Carbon Tetrachloride by Blocking Oxidative Stress Through Nrf2 Upregulation,” Oxidative Medicine and Cellular Longevity 2018 (2018): 3823426, 10.1155/2018/3823426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Casas‐Grajales S., Ramos‐Tovar E., Chávez‐Estrada E., et al., “Antioxidant and Immunomodulatory Activity Induced by Stevioside in Liver Damage: In Vivo, In Vitro and In Silico Assays,” Life Sciences 224 (2019): 187–196, 10.1016/j.lfs.2019.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Escoll P., Song O. R., Viana F., et al., “ Legionella pneumophila Modulates Mitochondrial Dynamics to Trigger Metabolic Repurposing of Infected Macrophages,” Cell Host & Microbe 22 (2017): 302–316, 10.1016/j.chom.2017.07.020. [DOI] [PubMed] [Google Scholar]
  • 48. Wiegman C. H., Michaeloudes C., Haji G., et al., “Oxidative Stress‐Induced Mitochondrial Dysfunction Drives Inflammation and Airway Smooth Muscle Remodeling in Patients With Chronic Obstructive Pulmonary Disease,” Journal of Allergy and Clinical Immunology 136 (2015): 769–780, 10.1016/j.jaci.2015.01.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Maremanda K. P., Sundar I. K., and Rahman I., “Role of Inner Mitochondrial Protein OPA1 in Mitochondrial Dysfunction by Tobacco Smoking and in the Pathogenesis of COPD,” Redox Biology 45 (2021): 102055, 10.1016/j.redox.2021.102055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Song Z., Ghochani M., McCaffery J. M., Frey T. G., and Chan D. C., “Mitofusins and OPA1 Mediate Sequential Steps in Mitochondrial Membrane Fusion,” Molecular Biology of the Cell 20 (2009): 3525–3532, 10.1091/mbc.e09-03-0252. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1: STR report for RAW264.7 cell.

LIV-45-0-s003.pdf (1.4MB, pdf)

Data S2: Full images for figures presenting cropped images of western blotting results.

LIV-45-0-s002.pdf (2.5MB, pdf)

Figure S1: Frequencies and TRPM2 expression of macrophages in liver fibrosis and regression mouse models.

Figure S2: RAW264.7 cells have the ability to phagocytose Escherichia coli BioParticles.

Figure S3: H2O2 treatment has little effect on RAW264.7 cell viability.

Figure S4: TRPM2 is important for the phagocytosis of BMDMs.

Figure S5: TRPM2 is important for the phagocytosis of THP‐1 cells.

Figure S6: TRPM2‐KO facilitates the up‐regulation of proinflammatory cytokines by high‐intensity H2O2.

Figure S7: RAW264.7 cells have the ability to phagocytose apoptotic hepatic stellate cells.

Figure S8: TRPM2‐modulated Ca2+ accumulation promotes mitochondrial fission.

Table S1: Primer sequences.

LIV-45-0-s001.docx (2.6MB, docx)

Data Availability Statement

The data that support the findings of this study are openly available in SRA database at https://submit.ncbi.nlm.nih.gov/subs/sra/SUB15534511/overview, reference number PRJNA1306199.


Articles from Liver International are provided here courtesy of Wiley

RESOURCES