Abstract
Background:
Various risk factors thought to impact cervical cancer progression. One way these factors influence cancer development is through changes in the microRNA’s expression, which are small, non-coding, single-stranded RNA molecules around 20–23 nucleotides long. In cervical cancer, specific miRNAs, notably miRNA-9 and miRNA-192, are gaining attention as potential clinical biomarkers.
Materials and Methods:
RNA was extracted from cervical intraepithelial neoplasia grade I, II, and III (CIN I, CIN II, and CIN III) tissues, as well as their adjacent normal tissues, to compare the expression levels of miRNA-9 and miRNA-192 as potential biomarkers. The extracted RNAs were then converted to cDNA for evaluation using quantitative PCR (qPCR).
Results:
Pathological analysis revealed that 80% of patients with cervical cancer and CIN III tissues were diagnosed with squamous cell carcinoma, while the proportions for adenocarcinoma and adenosquamous cell carcinoma were 13.4% and 6.6%, respectively. Our data indicated a significant increase in the expression of miRNA-192-5p (P < 0.05) in 15 cervical cancer and CIN III tissues compared to CIN I and CIN II. Similarly, miRNA-9 expression was also elevated in cervical cancer and CIN III tissues relative to CIN I and CIN II.
Conclusions:
miRNA-9 and miRNA-192 may serve as promising biomarkers for cervical cancer, given their elevated expression levels in the both cervical cancer and CIN III tissues. This expression pattern implies that they could aid in detecting early stages of cervical cancer progression, potentially improving early diagnosis and monitoring. However, further studies are essential to confirm these preliminary findings and validate their clinical relevance.
Keywords: Biomarker, cervical cancer, microRNA-9, microRNA-192, quantitative PCR
INTRODUCTION
Cancer places an immense burden on the healthcare systems and represents a major global health challenge. It is the leading cause of death in developed countries and ranks as the second leading cause of death worldwide.[1,2] In 2020 alone, approximately 10 million people lost their lives to cancer.[1] Several types, such as lung, colorectal, liver, stomach, breast, and cervical cancer, are particularly associated with high mortality rates.[1] Notably, cervical cancer stands out due to its typically slow progression, allowing potential opportunities for early detection and intervention.[3]
Advancements in medical technology have enabled doctors to detect cancers, including cervical cancer, at early stages, allowing many women to receive timely treatment.[4,5] While these technologies are crucial in early detection, cervical cancer cases at advanced stages have sharply increased, with around 700,000 new cases diagnosed annually at later stages and approximately 400,000 cervical cancer-related deaths.[5] Research indicates that abnormal cell division in the cervix often begins in individuals aged 20 to 29, while the average age of death from cervical cancer is around 59.[3,4]
Cervical cancer is linked to several risk factors, including radiation exposure, early marriage (before age 18), having multiple sexual partners, multiple births, environmental pollution, alcohol consumption, smoking, and certain infections. For instance, the human papillomavirus (HPV) particularly high-risk strains HPV-16 and HPV-18 is widely recognized as the primary risk factor. Indeed, researchers have confirmed the presence of oncogenes in these strains that drive cancer development.[4]
Nevertheless, among these risk factors, the roles of microRNAs in the progression of cervical cancer have not been clear. MicroRNAs are single-stranded RNA (ssRNA) molecules, typically non-coding, that consist of 20–23 nucleotides and are generally transcribed by RNA polymerase II.[6] Different mammalian cell types can express a wide range of microRNAs, allowing approximately 600 microRNAs to be encoded by human genes. Among these, some microRNAs function as oncogenes, while others act as tumor suppressors across multiple signaling pathways.[7,8] In this study, we aim to evaluate the expression levels of miRNA-9 and miRNA-192 in cervical cancer tissues compared to normal tissues, as these microRNAs have been implicated in promoting metastasis in certain contexts. For instance, Botla et al.[9] found that miRNA-192 expression decreases during pancreatic cancer progression, suggesting its potential as a biomarker. Numerous oncomicroRNAs play roles in cancers, such as colorectal, lung, bladder, hepatocellular, and cervical cancers. miRNA-9 and miRNA-192 are prominent examples, shown to promote cervical cancer progression, and some risk factors may drive their expression.[7,9] Consequently, research indicates that miRNA-9 may serve as a prognostic biomarker in cervical cancer.[10]
Since the signaling pathways, involving these microRNAs in cervical cancer progression remain unconfirmed, we aimed to assess their expression levels across various stages of cervical disease. Specifically, we evaluated microRNA expression in cervical cancer tissues, cervical intraepithelial neoplasia (CIN) grades I, II, and III, as well as in adjacent normal tissues.
MATERIALS AND METHODS
Tissue sample collection
This study has been approved by Shahid Beheshti University of Medical Sciences (IR.SBMU.MSP.REC.1400.633), grant number: 30819.
15 cervical cancer and CIN III tissues, 55 CIN1,2 [25 CIN1 and 30 CIN2] with 20 adjacent normal tissues were obtained from Mahdie Hospital (between 2018 and 2020 in Tehran). All patients’ Informed consent was collected, and tissues were stabilized in RNAlater solution (Qiagen GmbH, Hilden, Germany) at 20°C. The pathologist group recorded all the data of patients and confirmed cervical cancer. To evaluate the expression of RNAs, we excluded the patients who used the chemotherapy and radiotherapy.
Elicitation of RNA and synthesis cDNA
Cervical tissues were treated with 1 ml RNX-plus solution (Cinnagen, Tehran, Iran), and chloroform was added to remove protein. This mixture helped us to extract RNA samples by propanol which precipitates the RNA. The RNA integrity was confirmed through electrophoresis and Nanodrop spectrophotometer (Eppendorf) analysis. The mixture containing of 0.5 µl primer of RT miRNA-9, 0.5 µl primer of RT miRNA-192, 9 µl of reverse transcriptase (BioFACT) and 0.5 µl of the U6 reverse primer was provided, and 10 µl of RNA was added to that. The PCR schedule was 95°C for 5 min and at 50°C for 40 min. The cDNA was double-checked with sterile water to confirm proper concentration.
Quantitative PCR (qPCR)
The expression level of miRNA-9 and -192 in cervical cancer tissues was evaluated by qPCR using Rotor-Gene 6000 (Corbett Life Science) in the final 20 µl of the reaction volume. 10 µl of BIOFACT™ 2X real-time PCR master mix (for SYBR Green I; BIOFACT, South Korea), 1 µl of forward primer 10 pmol, 1 µl of reverse primer 10 pmol, 2 µl of cDNA and 6 µl of sterile water was combined to assess the expression level of miRNA-9 and -192. It should be mentioned that every experiment was simultaneously run in triplicate. Primers used in the present study are given in Table 1. 10 min at 95°C was adjusted for thermal cycling; then, 40 cycles at 95°C for 30 sec; 55°C for 30 sec, 72°C for 30 sec were performed, and we set the melt curve between 60°C and 95°C. The 2-∆∆CT method was employed to calculate the values for the relative quantification.[11]
Table 1.
Nucleotide sequences of primers used for real-time RT-PCR
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) | ||
|---|---|---|---|---|
| U6 | GAGAAGATTAGCATGGCCCCT | ATATGGAACGCTTCACGAATTTGC | ||
| miR-9 | CTTTGGTTATCTAGCTGTATGAGTCGT | ATCCAGTGCAGGGTCCGA | ||
| miR-192 | CTGACCTATGAATTGACAGCCGT | ATCCAGTGCAGGGTCCGA |
Statistical analysis
In this study, we employed Graph-Pad Prism software to compare the expression levels of miRNA-9 and -192, and experimental data were expressed by mean ± standard deviation of three independent assays. Statistical significance was calculated using ANOVA tests. P value less than (P < 0.05) was used for the differences.
RESULTS
Fifteen cervical tumor tissues and CIN III, 55 CIN1,2 [25 CIN1 and 30 CIN2] and 20 normal ones from patients in Mahdie Hospital, Tehran, Iran were collected. To evaluate the correlation between the expression levels of miRNANA-9, 192 and cervical cancer, the RNA of all tissues was extracted, and we compared these two miRNAs expression with qPCR.
The information from the hospital showed that 60% of 15 patients suffering from cervical cancer and CIN III were older than 60 years old. Moreover, the histology of these tissues included (Squamous cell carcinoma: 80%, Adenocarcinoma: 13.4% and adenosquamous cell carcinoma: 6.6%). 40% of these 15 cervical tumor tissues and CIN III were lower <2 cm, and Lymph node metastasis was observed in only 10% of patients. Table 2 reveals more information about the clinical characteristics of these 15 cervical tumor tissues and CIN III.
Table 2.
The clinical characteristics of 15 cervical cancer patients
| Clinical characteristics | Percentage | |
|---|---|---|
| Age | ||
| Older than 50 | 60% | |
| Younger than 50 | 40% | |
| FIGO stage | ||
| IA2 | 20% | |
| IB1 | 80% | |
| Histology | ||
| Squamous cell carcinoma | 80% | |
| Adenocarcinoma | 13.4% | |
| Adenosquamous cell carcinoma | 6.6% | |
| Tumor size | ||
| <2 | 60% | |
| >2 | 40% | |
| Lymph node metastasis | 10% |
Our data illustrated an increase in the expression of miRNA-192-5p (the P value < 0.5) in 15 cervical tumor tissues and CIN III when we compare them with CIN I and CIN II. Similarly, miRNA-9 was higher in comparison with CIN I and CIN II [Figure 1].
Figure 1.

The expression of microRNA-9 and -192 in cervical tissues
DISCUSSION
MicroRNAs (miRNAs) are integral to various developmental processes, including cell cycle regulation, proliferation, apoptosis, migration, differentiation, and metabolism. However, key aspects of the miRNA biogenesis pathway and their precise repressive mechanisms are still not fully understood. While miRNAs have emerged as important biomarkers for diagnosing cancers, such as lung and breast cancer, their potential as biomarkers in cervical cancer remains under investigation.
In terms of gene regulation, miRNAs function by targeting the 3′-untranslated region (3′-UTR) of mRNAs, typically resulting in translational repression or mRNA degradation. Primary miRNAs (pri-miRNAs) are transcribed by RNA polymerase II, after that the RNase III enzyme Drosha processes them in the nucleus, producing a pre-miRNA hairpin. Following further processing and maturation in the cytoplasm, these mature miRNAs regulate gene expression and may play roles in driving malignant transformations.[11,12,13]
Specific miRNAs, such as miR-9 and miR-192 have shown promise as biomarkers for early detection and disease progression, providing valuable diagnostic and prognostic insights. These microRNAs have demonstrated dual roles as oncogenes or tumor suppressors in several cancers, such as pediatric acute myeloid leukemia, neuroblastoma, triple-negative breast cancer, esophageal squamous cell carcinoma, and hepatocellular carcinoma.[14,15,16,17,18] However, their specific roles and clinical relevance in cervical cancer remain to be fully elucidated although some reports have analyzed them in cervical malignancies. Indeed, different levels of miR-9 and miR-192 have been observed in cervical cancer and high-grade CIN III tissues, but this issue has not been approved.
In this study, we assessed the expression levels of two microRNAs, miR-9 and miR-192, using quantitative PCR (qPCR). Our results demonstrated a significant increase in miRNA-192-5p expression (P < 0.05) in 15 cervical cancer and CIN III tissues compared to CIN I and CIN II tissues. Similarly, miRNA-9 expression was elevated in cervical cancer and CIN III tissues, suggesting that these microRNAs may play a role in promoting cervical carcinoma metastasis. Their upregulation can correlate with disease progression, suggesting they may serve as early indicators of cervical cancer development. For example, miRNA-9 and -192 have a relation with SOCS5[19] and RacGAP1,[20] respectively, that contributes to cell migration and invasion, but further studies are required. The limitations of our study were the small sample size and lack of confirmation of alternative techniques. Further cohort studies with larger sample sizes and alternative methods are needed to confirm these findings.
Researchers have evaluated the miRNA-9 in different stages of cervical cancer tissues. For example, miR-9 has been shown to increase cervical cancer risk through the SOCS5 pathway.[19] In HeLa cells, IL-6 downregulates miR-9, thereby activating the IL-6/Jak/STAT3 pathway.[21] In 2018, Aishanjiang and colleagues used real-time PCR and western blotting to study C33A and HeLa cell lines, as well as cervical tissue samples. Their findings revealed that miR-9 downregulates FOXO1, disrupting cell cycle regulation.[22] The relation between miRNA-9, lymph node metastasis, and cervical cancer was confirmed as high expression of miRNA-9 in these tissues was detected in comparison with normal ones.[23,24] HPV E6 in a p53-independent manner also can activate miRNA-9.[25] This microRNA has a critical role in apoptotic pathway (affecting Bax, Bcl-2 and p-Akt expressions), and the inhibition of miRNA-9 triggers apoptosis in cervical cancerous cells.[10] Transcriptional factors, especially TWIST1, are responsible for targeting epithelial-to-mesenchymal transition (EMT), and miRNA-9 is involved in controlling TWIST1 function.[26] circNFATC3 and NEAT1 can have a similar function of miRNA-9 to regulate SDC2 expression, having a heavy toll on patients suffering from cervical cancer.[27,28] The relationship between miRNA-192 and cervical cancer has been explored in a limited number of studies. For instance, miR-192 has been linked to cervical cancer progression by targeting RacGAP1, which activates the AP-1 pathway via p-JNK signaling.[20]
CONCLUSION
Given the influence of specific risk factors on miR-9 and miR-192, our data suggest that these microRNAs show elevated expression levels in cervical cancer and CIN III tissues. Consequently, they hold promise as potential biomarkers for diagnosing the early stages of cervical cancer progression. However, additional studies are needed to validate these findings and clarify their clinical relevance with a higher number of samples and alternative techniques.
Ethics approval and consent to participate
This study has been conducted in Department of the School of Medicine Shahid Beheshti University of Medical (IR.SBMU.MSP.REC.1400.633).
Conflicts of interest
There are no conflicts of interest.
Acknowledgments
The authors gratefully acknowledge the financial support for this work that was provided by Shahid Beheshti University of Medical Sciences.
Funding Statement
This study has been approved by Shahid Beheshti University of Medical Sciences, grant number: 30819.
REFERENCES
- 1.Tavakolian S, Iranshahi M, Faghihloo E. The Evaluation of HERV-K np9, rec, gag expression in isolated human peripheral blood mononuclear cell (PBMC) of gastric and colon cancer. Adv Biomed Res. 2023;12:131. doi: 10.4103/abr.abr_288_22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Tavakolian S, Goudarzi H, Nazarian H, Raee P, Niakan S, Faghihloo E. The evaluation of human papilloma virus and human herpes viruses (EBV, CMV, VZV HSV-1 and HSV-2) in semen samples. Andrologia. 2021;53:e14051. doi: 10.1111/and.14051. [DOI] [PubMed] [Google Scholar]
- 3.Kashyap N, Krishnan N, Kaur S, Ghai S. Risk factors of cervical cancer: A case-control study. Asia-Pac J Oncol Nurs. 2019;6:308–14. doi: 10.4103/apjon.apjon_73_18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Buskwofie A, David-West G, Clare CA. A review of cervical cancer: Incidence and disparities. J Natl Med Assoc. 2020;112:229–32. doi: 10.1016/j.jnma.2020.03.002. [DOI] [PubMed] [Google Scholar]
- 5.Eckert L. Cambridge University Press; 2024. Enough: Because We Can Stop Cervical Cancer. [Google Scholar]
- 6.Peng Y, Croce CM. The role of MicroRNAs in human cancer. Signal Transduct Target Ther. 2016;1:1–9. doi: 10.1038/sigtrans.2015.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Banno K, Iida M, Yanokura M, Kisu I, Iwata T, Tominaga E, et al. MicroRNA in cervical cancer: OncomicroRNAs and tumor suppressor microRNAs in diagnosis and treatment. Sci World J. 2014;2014:178075. doi: 10.1155/2014/178075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Farzanehpour M, Mozhgani SH, Jalilvand S, Faghihloo E, Akhavan S, Salimi V, et al. Serum and tissue miRNAs: Potential biomarkers for the diagnosis of cervical cancer. Virol J. 2019;16:116. doi: 10.1186/s12985-019-1220-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Botla SK, Savant S, Jandaghi P, Bauer AS, Mücke O, Moskalev EA, et al. Early epigenetic downregulation of microRNA-192 expression promotes pancreatic cancer progression. Cancer Res. 2016;76:4149–59. doi: 10.1158/0008-5472.CAN-15-0390. [DOI] [PubMed] [Google Scholar]
- 10.Zhang H, Zhang Z, Wang S, Zhang S, Bi J. The mechanisms involved in miR-9 regulated apoptosis in cervical cancer by targeting FOXO3. Biomed Pharmacother. 2018;102:626–32. doi: 10.1016/j.biopha.2018.03.019. [DOI] [PubMed] [Google Scholar]
- 11.Bartel DP. MicroRNAs: Target recognition and regulatory functions. Cell. 2009;136:215–33. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Fabian MR, Sonenberg N. The mechanics of miRNA-mediated gene silencing: A look under the hood of miRISC. Nat Struct Mol Biol. 2012;19:586–93. doi: 10.1038/nsmb.2296. [DOI] [PubMed] [Google Scholar]
- 13.Saj A, Lai EC. Control of microRNA biogenesis and transcription by cell signaling pathways. Curr Opin Genet Dev. 2011;21:504–10. doi: 10.1016/j.gde.2011.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Song Y, Li J, Zhu Y, Dai Y, Zeng T, Liu L, et al. MicroRNA-9 promotes tumor metastasis via repressing E-cadherin in esophageal squamous cell carcinoma. Oncotarget. 2014;5:11669–80. doi: 10.18632/oncotarget.2581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang H, Qi M, Li S, Qi T, Mei H, Huang K, et al. MicroRNA-9 targets matrix metalloproteinase 14 to inhibit invasion, metastasis, and angiogenesis of neuroblastoma cells. Mol Cancer Ther. 2012;11:1454–66. doi: 10.1158/1535-7163.MCT-12-0001. [DOI] [PubMed] [Google Scholar]
- 16.Emmrich S, Katsman-Kuipers JE, Henke K, Khatib ME, Jammal R, Engeland F, et al. MiR-9 is a tumor suppressor in pediatric AML with t (8;21) Leukemia. 2014;28:1022–32. doi: 10.1038/leu.2013.357. [DOI] [PubMed] [Google Scholar]
- 17.D’Ippolito E, Plantamura I, Bongiovanni L, Casalini P, Baroni S, Piovan C, et al. mir-9 and mir-200 regulate pdgfrβ-mediated endothelial differentiation of tumor cells in triple-negative breast cancer. Cancer Res. 2016;76:5562–72. doi: 10.1158/0008-5472.CAN-16-0140. [DOI] [PubMed] [Google Scholar]
- 18.Higashi T, Hayashi H, Ishimoto T, Takeyama H, Kaida T, Arima K, et al. MiR-9-3p plays a tumour-suppressor role by targeting TAZ (WWTR1) in hepatocellular carcinoma cells. Br J Cancer. 2015;113:252–8. doi: 10.1038/bjc.2015.170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Wei YQ, Jiao XL, Zhang SY, Xu Y, Li S, Kong BH. MiR-9-5p could promote angiogenesis and radiosensitivity in cervical cancer by targeting SOCS5. Eur Rev Med Pharmacol Sci. 2019;23:7314–26. doi: 10.26355/eurrev_201909_18837. [DOI] [PubMed] [Google Scholar]
- 20.Zhang T, Wang C, Wang K, Liang Y, Liu T, Feng L, et al. RacGAP1 promotes the malignant progression of cervical cancer by regulating AP-1 via miR-192 and p-JNK. Cell Death Dis. 2022;13:604. doi: 10.1038/s41419-022-05036-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhang J, Jia J, Zhao L, Li X, Xie Q, Chen X, et al. Down-regulation of microRNA-9 leads to activation of IL-6/Jak/STAT3 pathway through directly targeting IL-6 in HeLa cell. Mol Carcinog. 2016;5:732–42. doi: 10.1002/mc.22317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Aishanjiang A, Rouzi N, Jiao Z, Wang L, Wusainahong K, Wumanjiang N, et al. MicroRNA-9 enhances invasion and migration of cervical carcinomas by directly targeting FOXO1. Eur Rev Med Pharmacol Sci. 2018;8:2253–60. doi: 10.26355/eurrev_201804_14812. [DOI] [PubMed] [Google Scholar]
- 23.Azizmohammadi S, Safari A, Azizmohammadi S, Kaghazian M, Sadrkhanlo M, Yahaghi E, et al. Molecular identification of miR-145 and miR-9 expression level as prognostic biomarkers for early-stage cervical cancer detection. QJM: Int J Med. 2017;110:11–5. doi: 10.1093/qjmed/hcw101. [DOI] [PubMed] [Google Scholar]
- 24.Kuang T, Li L, Chen Y, Wang J. Effects of miR-9-5p on the migration, invasion and epithelial-mesenchymal transition process in cervical squamous cell carcinoma. Zhong Nan Da Xue Xue Bao Yi xue ban. Journal of Central South University. Medical Sciences. 2023;48:15–23. doi: 10.11817/j.issn.1672-7347.2023.210773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Liu W, Gao G, Hu X, Wang Y, Schwarz JK, Chen JJ, et al. Activation of miR-9 by human papillomavirus in cervical cancer. Oncotarget. 2014;22:11620. doi: 10.18632/oncotarget.2599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Babion I, Jaspers A, van Splunter AP, van der Hoorn IA, Wilting SM, Steenbergen RD. miR-9-5p exerts a dual role in cervical cancer and targets transcription factor TWIST1. Cells. 2019;9:65. doi: 10.3390/cells9010065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ma N, Li X, Wei H, Zhang H, Zhang S. Circular RNA circNFATC3 acts as a miR-9-5p sponge to promote cervical cancer development by upregulating SDC2. Cell Oncol. 2021;44:93–107. doi: 10.1007/s13402-020-00555-z. [DOI] [PubMed] [Google Scholar]
- 28.Xie Q, Lin S, Zheng M, Cai Q, Tu Y. Long noncoding RNA NEAT1 promotes the growth of cervical cancer cells via sponging miR-9-5p. Biochem Cell Biol. 2019;97:100–8. doi: 10.1139/bcb-2018-0111. [DOI] [PubMed] [Google Scholar]
