Summary
The study of disease-modifiers is a powerful way to identify patho-mechanisms associated with disease. Using the strong genetic traits of Huntington’s disease (HD), we identified a rare, single nucleotide polymorphism (SNP) in WDFY3 associated with a delayed age-of-onset of up to 23-years. Remarkably, the introduction of the orthologous SNP into mice recapitulates this neuroprotection, significantly delaying neuropathological and behavioral dysfunction in two models of HD. The SNP increases expression of the protein Alfy, an autophagy adaptor protein for the clearance of aggregated proteins, whose ectopic overexpression is sufficient to capture the neuroprotective effects of the variant. Increasing Alfy expression protects not only against HD, but also against the toxicity due to phospho-αSynuclein and AT8-positive accumulates. Taken together, by combining human and mouse genetics, we have uncovered a pathway that protects against multiple proteinopathies, revealing a much sought after, shared therapeutic target across a broad range of neurodegenerative diseases.
eTOC blurb for Croce et al
In Croce et al, the discovery of a rare SNP in the Venezuelan HD kindreds that is associated with a delayed age of onset by up to 23 years reveals how preventing aberrant protein accumulation is protective not only against polyglutamine toxicity, but α-synuclein- and tau-mediated toxicity as well.
Introduction
A powerful means to identify the cellular pathways that play a pivotal role in disease is through the study of disease-modifying genes. These modifiers are often genetic variants that can tip the balance to drive or diminish pathogenesis. The difficulty of using this approach stems from requiring a quantifiable and continuous outcome measure that can be correlated to pathogenic events central to the disease under study. For most adult-onset neurodegenerative diseases, given their sporadic nature, this is not a trivial task. In contrast, the genetic features of the autosomal dominant, heritable disorder Huntington’s disease (HD) offer a powerful platform from which disease modifiers can be identified. HD is caused by a expansion of CAG within the coding region of the HD gene, giving rise to an abnormally expanded polyglutamine (polyQ) stretch within the encoded protein Huntingtin (HTT)1,2. Given its typical midlife onset and other neuropathological features3–5, HD serves as a valuable paradigm disorder for sporadic, adult-onset neurodegenerative diseases. Moreover, due to the well-known inverse correlation between the length of the CAG expansion mutation and the predicted age of onset6, this provides the continuous outcome measure that is lacking in the most prevalent neurodegenerative diseases. Several studies have identified potential genetic modifiers in both the European and Venezuelan HD kindreds, most notably those genes implicated in DNA repair that may influence the CAG length itself7.
A well-known cellular feature across neurodegenerative diseases is the aberrant intracellular accumulation of proteins, but its relevance as a therapeutic target has been frustratingly unclear. Across model systems, the abnormal accumulation of aggregated proteins can drive neuropathology, but little success has been met by attempts to target the event therapeutically. This reflects the complex biology of protein accumulation, which intersects with the most fundamental cellular pathways from protein translation, chaperone-mediated protein folding, protein degradation and stress response pathways8. Impacting these homeostatic pathways have proven limited, largely due to the resulting pleiotropic effects stemming from an inability to impact the aggregated form of the protein directly.
Given the intricacy of protein aggregation and accumulation in disease, we hypothesize that their role in neurotoxicity can be revealed through a thorough understanding of the cellular pathways responsible for eliminating complex aggregated structures. Aggregated proteins are eliminated by the lysosome-mediated degradation pathway autophagy9–11, which uses adaptor proteins to permit their selective turnover11. Several adaptor proteins have been identified to play a role in the turnover of aggregated proteins, such as Sequestosome-1 (SQSTM1/p62), Calcoco3/TAX1BP1 and Autophagy linked FYVE protein (Alfy) (reviewed in11). Despite the potential importance of autophagy on protein accumulation, it is notable that autophagy genes have yet to be overwhelmingly identified to modify disease onset or susceptibility. Mutations in adaptor proteins have been implicated in very rare forms of familial amyotrophic lateral sclerosis-frontotemporal dementia (ALS-FTD)12–16, as well as other diseases of the periphery17,18. Nonetheless, given how those implicated are also responsible for the turnover of different cargoes, including mitochondria9,11, whether diminishing aggregate turnover is central to pathogenesis of these diseases is difficult to establish. Further, when autophagy genes are implicated in disease (reviewed in11), the diseases are developmental, reflecting the overarching importance of autophagy to cellular and organellar homeostasis.
In this study, we identify a rare genetic variant of the gene WDFY3 that is associated with a delayed age of onset of up to 23 years within the Venezuelan HD kindred. The variant leads to increased levels of expression of its encoded mRNA and protein, WDFY3, also known as Alfy. Either introduction of the orthologous polymorphism in Wdfy3 or ectopic overexpression of a cDNA encoding human ALFY (hAlfy) enhances aggregate-turnover by autophagy and prevents the neuropathological and behavioral changes in both a transgenic and knock-in mouse model of HD. Moreover, although identified in a cohort of HD patients, we report that the beneficial effects of this modifier can be extended to different proteinopathies; increasing Alfy expression protects against the neurotoxicity associated with the α-synuclein (αSyn) preformed fibril (PFF) injection model of Parkinson’s disease (PD), as well as the PS19 P301S tauopathy model (PS19). Taken together, through characterization of a rare, protective single nucleotide polymorphism (SNP) within an HD cohort, we have identified a common pathway that can prevent protein accumulation and thereby confer neuroprotection across different neurodegenerative diseases.
Results
rs17368018 delays age of onset in HD patients
A genetic linkage study in the Venezuelan HD kindreds19 reported several loci modifying age of onset, including one at chr4q2120. To resolve potential modifier genes of interest within this locus, we genotyped HD individuals with corresponding clinical data and performed a genome-wide association analysis (see Methods, Table S1). This approach recapitulated a significant signal within chr4q21 specifically mapping to variants proximal and within the gene WDFY3 (Fig. S1A), a large gene expressed highly in the brain21,22. The most significantly associated SNP, rs17368018, encoded a missense mutation (A>G) within the WDFY3 coding region (WDFY3rs17368018 (WDFY3rs), Fig. 1). We examined the Venezuelan pedigree for patients who carried this signal and identified an extended family with delayed ages of onset by 6–23 years (Fig.1A).
Fig. 1: Introduction of rs17368018 into the mouse genome recapitulates the delayed age of onset of the HD-like phenotype (See also Fig. S1. Complete statistics can be found in Table S2).

A. Graphic representation of the pedigree identified in the HD Venezuelan cohort. Only a partial pedigree is shown that indicates patients positive for HD. Square (male) or circle (female) is indicated for HD positivity (left) and the presence of the SNP (right), the CAG (Q) repeat length, and the residual age of onset (AO, +/− years) below. The reported CAG repeat length is the value obtained upon sequencing. Blue, later AO; red, earlier AO; hatched, rs17368018+; empty, rs17368018-.
B. Sequence alignment of exon 60 of human WDFY3 and exon 57 murine Wdfy3 which share 83.23% sequence identity. Grey indicates sequence differences in mouse. rs17368018 indicated by *. Variant encodes a change of A to G (green).
C. Box plots of total distance traveled by 6 m/o Q140 mice with Wdfy3Var. RM-ANOVA with Fisher PLSD. Sex considered independent a priori. Female: Ctrl n=17, Q140 n=16, Q140::Wdfy3Var n=18; Male: Ctrl n=16, Q140 n=15, Q140::Wdfy3Var n=21. *, p < 0.05.
D-G. Immunostaining and quantification for D. astrocytosis (GFAP), E. microgliosis (Iba1), F. MSN (FoxP1) and G. mHtt aggregates (MAB5492). Activated microglia indicated by black arrows and scored as described in Fig. S1E. Q140 and Q140 with one or two copies of Wdfy3Var. ANOVA with Fisher PLSD. Bar graphs of Mean±St.Dev with individual data points. n=3/genotype. *, p < 0.05.
Recreation of SNP rs17368018 in mice recapitulates disease protection
WDFY3rs is a rare SNP with a frequency of 0.8 to 1% in the broader population (dbSNP Build 157). Coupled with the rarity of HD, we were unable to obtain sufficient patient numbers to improve the study’s power. We therefore tested the hypothesis that should this SNP affect the biology of HD as significantly as the pedigree suggests, creation of the orthologous SNP on an HD background in mice could phenocopy the outcome. Given that WDFY3 shares significant sequence identity, over 96% conservation, with murine Wdfy3 (NCBI), we identified and introduced the corresponding A>G change into Wdfy3 (Wdfy3Var) (Fig. 1B, Fig. S1B). Wdfy3Var mice demonstrated no change in breeding, home cage behavior, or spontaneous locomotor activity compared to littermate wild-type (WT) mice (Fig. S1C, data not shown).
To determine if rs17368018 modified HD pathogenesis, we crossed Wdfy3Var with HD mice (Fig. S1D). We selected the Q140+/− (Q140) model which approximates the genetic environment of the HD gene mutation23, as we were uncertain how the SNP might exert protection. Consistent with previous reports24,25, 6-month-old (m/o) Q140 mice demonstrated a significant hypolocomotor phenotype when compared to littermate controls (Fig. 1C). Notably, the presence of Wdfy3Var in these mice made them indistinguishable from littermate controls (Fig. 1C). Next, we measured additional, orthogonal HD-associated outcomes, by examining for indications of astrocytosis and microgliosis in the striatum, a well-established feature of HD pathology5,26,27. Astrocytosis was scored by the number of hyper ramified astrocytes with higher expression of glial fibrillary acid protein (GFAP)28, whereas reactive microglia were identified by changes in morphology revealed by staining against Ionized calcium binding adaptor molecule 1 (Iba1)(Fig. S1E)29,30. Mixed strain 6 m/o Q140 striata showed profound astrocytosis and microgliosis, while co-expression of Wdfy3Var significantly blunted these indications (Fig. 1D, E). Moreover, we found that expression of the medium spiny neuron (MSN) marker FoxP1,31 is significantly diminished in Q140 mice, but preserved in Q140::Wdfy3Var, thereby indicating that different indicators of brain health are yet to demonstrate pathological changes (Fig. 1F). These data suggest that the impact of rs17368018 can be translated across species, and can capture the protective effect observed in HD patients.
The genomic location of rs17368018 is within a coding exon of WDFY3, which encodes for Alfy, an adaptor protein that specifies cargo for degradation by autophagy32,33. Alfy is required for the clearance of pre-formed aggregates in cells32,33 including in neurons of the adult brain34,35. Given its previously described role, we performed stereological analyses to determine if Wdfy3Var influences accumulation of mutant Htt protein in 6 m/o Q140 striata (Fig. 1G). Notably, stereological analyses of Q140::Wdfy3Var mice reveal few to no aggregates at this age. These data indicate that the SNP is associated with diminished aggregate accumulation in the HD brain, and suggest that the variant may enhance Alfy function.
rs17368018 increases expression of the selectivity autophagy adaptor protein Alfy by enhancing mRNA stability
Alfy is a 390 kDa scaffold protein that is characterized by a series of protein-protein and protein-lipid interaction motives32,36, that scaffolds aggregated proteins, potentially through an interaction with Sequestesome-1/protein 62 (p62)37, and the growing autophagosome membrane through an interaction with Atg12–5:16L complex32, a LC3-interacting region (LIR)38 and a FYVE domain39 (Fig. 2A). rs17368018 leads to an amino acid change from Ile3032Var (I3032V). Examining the predicted structure of Alfy using AlphaFold340,41 shows Alfy is of two distinct regions, with the N-terminal two thirds comprising of helices and the C-terminal third being globular in nature (Fig. S2A–C). I3032V falls within this region of Alfy, within the region previous shown to interact with the autophagy receptor p62 (Fig. 2A). We have previously shown that C-terminal fragment (AlfyC) is sufficient to increase aggregate clearance in an autophagy-dependent manner32,33,39,42. To determine if I3032V enhances the ability of AlfyC to increase aggregate clearance, we overexpressed AlfyC or AlfyC(I3032V) in a previously published stable cell line expressing mCFP tagged polyQ protein43 (Fig. S2E). The presence of I3032V neither diminished or enhanced AlfyC activity, suggesting that the amino acid replacement is neutral and that the benefit of the variant is not due to changes in protein function.
Fig. 2: rs17368018 increases Alfy expression by stabilizing the WDFY3 mRNA transcript, which is recapitulated in mice (See also Fig. S2).

A. Schematic representation of Alfy. Interacting regions for p62/SQSTM1 and Atg5. Atg5 allows interaction with Atg12-5:16L complex. LIR domain binds to GABARAP and LC3C. The FYVE domain. The multi-color striped regions are indicative of predicted disordered domains. I3032 falls within the p62 binding region. Abbreviations: aa: amino acid; ARM: Armadillo; ConA: Concavalin A; FYVE: Fab1, YOTB, Vac1 and EEA1; LIR: LC3 interacting region; PH-BEACH: Plecstrin homology-beige and Chediak-Higashi syndrome protein; and WD: WD40 repeat.
B. WDFY3 transcript (top) and Alfy protein levels (btm) of patient brains from individuals genotyped with the rs17368018 variant. (Top) RT-qPCR. Two-tailed student t-test reveals significantly higher levels of WDFY3 transcript expression in the variant (p=0.025). (Btm) Immunoblots of cerebellum from the same individuals with Box plots of quantification normalized to vinculin. Student t-test reveals higher levels of WDFY3 expression in variant carriers (p=0.027); n=14 WDFY3+/+, n=7 WDFY3rs/+.
C. Wdfy3 transcript (top) and Alfy protein levels (btm) of brains from mice in which the point mutation orthologous to rs17368018 was introduced. (top) RT-qPCR (btm) Immunoblot of brain lysates normalized to vinculin. ANOVA with Fisher PLSD. Complete statistics can be found in Table S2. n=3/genotype. *, p<0.05.
D, E. WDFY3 transcript levels from HEK293 WT (white) and HEK293 WDFY3Var cells (blue). RT-qPCR of RNA isolated from whole cell homogenate (n=4), cytosolic (n=3) and nuclear (n=4) fractions. Normalized to WT parental cells. E. Cells treated with or without ActD. Box plots with p-values generated from Student t-test.
We have previously shown in cells, fly and mouse brain that there is a direct relationship between Alfy expression levels and aggregate clearance32–34, and thus determined if rs17368018 changed WDFY3 expression levels. To do so, we genotyped 597 samples of varying diagnoses from the New York Brain Bank and identified 8 independent rs17368018-positive samples, of which 6 were available for subsequent analyses. RT-qPCR on both WDFY3WT and WDFY3rs carriers revealed increased levels of WDFY3 transcript and Alfy protein expression in brain tissue from rs17368018 individuals versus controls (Fig. 2B). To confirm the sufficiency of rs17368018 to increase Alfy expression, we examined Alfy expression in Wdfy3Var mice. Strikingly, the mice recapitulated the human data (Fig. 2C), demonstrating increased transcript and protein levels of Alfy in mouse brain.. These data indicate that like the neuroprotection, the mechanism elicited by the variant to increase Alfy expression levels is conserved across species. Given the conservation, we hypothesized that the mechanism was through mRNA stability, which growing studies indicate can be achieved through changes to the open reading frame. To test our hypothesis, we used CRISPR base pair editing to create HEK293 cells with biallelic introduction of rs17368018 (Fig. 2D,E). Introduction of the variant was sufficient to increase WDFY3 mRNA as indicated by RT-qPCR (Fig. 2D). Cell fractionation revealed that this increase could be observed in the cytosolic but not nuclear mRNA pool, suggesting that the SNP enhanced transcript stability opposed to transcription. To pursue this further, we next determined if the increase in WDFY3 mRNA was diminished by the inhibition of transcription by Actinomycin D (ActD)44,45. A time course of ActD administration revealed that WDFY3 mRNA was nearly unchanged across the 8 hrs, indicating that WDFY3 encodes a long-lived transcript (Fig. S2F). Using a 4hr ActD treatment, we found that the variant maintained higher WDFY3 transcript levels, suggesting that transcription is not responsible for higher expression of WDFY3 (Fig. 2E, S2G,H). Taken together, these data suggest that rs17368018 exerts protection via higher Alfy expression achieved by stabilizing WDFY3 mRNA.
Ectopic upregulation of Alfy is sufficient to capture the protective effect of Wdfy3Var
To test this hypothesis directly, we ectopically overexpressed Alfy and compared the outcome to orthologous introduction of rs17368018. To do so, we created a knock-in of full-length hAlfy cDNA preceded by a 3xFLAG-tag into the Rosa26 locus (RosahAlfy, Fig. 3A,B, S3A, and data not shown). To confirm that hAlfy can complement murine Alfy and to ensure that the FLAG tag did not interfere with Alfy function, we crossed RosahAlfy/+ on an Wdfy3 null (AlfyKO) background. AlfyKO are perinatal lethal and demonstrate neurodevelopmental deficits such as a loss of the midline crossing22,46 (Fig. S3B–D). Ectopic overexpression of hAlfy completely rescued the AlfyKO phenotypes.
Fig. 3: Ectopically increasing Alfy expression levels is sufficient to recapitulate the protective effect of rs17368018 (See also Fig. S3).

A,B. Ectopic overexpression of hALFY (hA) in mice is created through a knockin of hAlfy cDNA into the Rosa26 locus (Bl6/129Sv). A. Immunoblot for Alfy normalized to vinculin. The levels of hAlfy as detected by its FLAG tag can be observed in Fig S3A. B. Box plot reveals a gene dose dependent increase in Alfy expression. ANOVA with Fisher PLSD. Complete statistics can be found in Table S2. n=3/genotype. *, p<0.05.
C. Breeding schema to introduce hAlfy overexpression (Bl6/129Sv) onto the Q140 background (strain C57BL/6J). Resulting littermates were used in all comparisons.
D. Hypolocomotion phenotype of 6 m/o Q140 mice. Box plots of total distance traveled. RM-ANOVA with Fisher PLSD of comparison to Ctrl. Ctrl mice have either one or two copies of hAlfy. Females: Ctrl n=15, Q140 n=16, Q140::RosahAlfy/+ n=14, Q140::RosahAlfy/hAlfy n=12; Males: Ctrl n=13, Q140 n=13, Q140::RosahAfy/+ n=10, Q140hAlfy/hAlfy n=15. *, p < 0.05 Complete statistics can be found in Table S2.
E-H. Neuropathological phenotypes of 6 m/o Q140 mice. Two tailed t-test comparing Q140 and Q140hAlfy/hAlfy for E. aggregated mHtt, (p = 0.009) F. astrocytosis (GFAP, p=0.007), G. microgliosis (Iba1, p=0.007), and H. decreased expression of FoxP1 (p=0.034). Bar graphs of Mean±St.Dev with individual data points. n=3/genotype. *, p < 0.05.
I. Detergent soluble mutant Htt with respect to total protein (Vinculin (Vinc) as loading control) or to WT Htt. 6 m/o striatal lysates. Bar graphs of Mean±St.Dev with individual data points. n=3/genotype. ANOVA reveals no significant effect of genotype for mHTT/Vinc (F(2,6)=0.987, p=0.426) or mHTT/HTT (F(2,6)=0.142, p=0.870). Abbrev. hA/+: Rosa hAlfy/+; Var/+: Wdfy3Var/+
Ectopic overexpression of Alfy in Q140 mice (Fig. 3C) was consistent with our Wdfy3Var findings, preventing the hypolocomotion in Q140 mice (Fig. 3D, S3E), and the neuropathological changes including protein aggregation, neuroinflammation and FoxP1 expression (Fig. 3E–H). Given the established function of Alfy on aggregate clearance by autophagy, we explored whether Alfy overexpression led to changes in indicators of basal autophagy. Immunoblot analyses revealed no difference in p62 or LC3-II/LC3-I levels compared to WT animals (Fig S3F). This aligns with loss-of-function studies, which showed that changing expression of Alfy does not globally alter autophagy, consistent with its role as a selectivity adaptor protein32,34. Moreover, despite the diminished amount of aggregated proteins in the presence of increased Alfy expression, immunoblot analysis revealed that detergent soluble levels of mutant Htt remain unchanged (Fig. 3I). This is consistent with Alfy degrading the aggregated form of the protein, rather than preventing aggregate-formation or diminishing levels of the soluble protein. Taken together, our data indicate that ectopic overexpression of Alfy is sufficient to recapitulate our observations in the Wdfy3Var mice, and further supports the model that the SNP confers protection by augmenting levels of Alfy expression, and enhances the selective turnover of aggregated mutant Htt.
Alfy upregulation is protective by increasing the turnover of aggregating proteins
The CAG expansion mutation is postulated to drive toxicity via several mechanisms including the loss of HTT function47,48. Therefore to further examine the impact of diminishing the proteinopathy, we next assessed how Wdfy3Var or RosahAlfy affected the N171-82Q (N171) transgenic model (Fig. 4A).49 N171 mice demonstrate an aggressive phenotype thought to be driven by the expanded polyglutamine stretch itself50. Crossing N171 mice with either Wdfy3Var or RosahAlfy led to a significant decrease of aggregates in the striatum and cortex (Fig. 4B,C). Subsequent neuropathological analyses also revealed that the loss of aggregation was accompanied by diminished neuroinflammation (Fig. 4D,E), and preservation of FoxP1 expression (Fig. 4F). Behavioral analyses revealed that Alfy overexpression also delayed the onset of the hypolocomotor phenotype (Fig. 5A, S4A) and latency to fall on the accelerated rotarod (Fig. 5B, S4B). Therefore, increasing levels of Alfy in the N171 model augments aggregate turnover by selective autophagy, and protects against the neuropathological outcomes of the accumulating expanded polyglutamine protein.
Fig. 4. The Alfy variant or ectopic overexpression of Alfy confers protection to 5 m/o N171 mice: Neuropathology.

A. Breeding schema for the creation of N171-82Q (N171)(B6C3F1/J) mice, expressing either the WDFY3 variant (Bl6/129Sv) or ectopically overexpressing hAlfy (Bl6/129Sv). Resulting littermates were used in all comparisons.
B. MAB5492+ mHtt aggregates in the cortex.
C-F. Immunostaining and quantification in striatum of C. Aggregate load. D. astrocytosis (GFAP), E. microgliosis (Iba1), and F. FoxP1 expression.
ANOVA with Fisher PLSD. *, p < 0.05. n=3/genotype. Complete statistics can be found in Table S2. Bar graphs of Mean±St.Dev with individual data points. n=3/genotype.
Fig. 5. The Alfy variant or ectopic overexpression of Alfy confers protection to N171 mice: Behavior and Survival (See also Fig. S4).

A. Hypolocomotor phenotype in 3 m/o N171 mice. Box plots of total distance traveled for male N171 in the presence or absence of the variant (Alfy Var, left) or ectopic overexpression (Alfy OE, right). Female N171 mice failed to become hypolocomotive in either group and were not analyzed further. Right: Ctrl n=11, N171 n=11, N171::Wdfy3Var/Var n=13; Left: Ctrl n=20, N171 n=11, N171::RosahAlfy/+ n=14. *, p < 0.05. Complete statistics can be found in Table S2.
B. Accelerated rotarod deficits in N171 mice. p-values generated from RM-ANOVA of the multiple trials per age, and posthoc analyses are listed below each line graph. Males: 2 and 3 m/o n=11 mice/genotype, 4 m/o n=11 Ctrl, n=10 N171, n=9 N171::RosahAlfy/+, 5 m/o n=11 Ctrl, n=7 N171, n=6 N171::RosahAlfy/+.
C. Survival curve. N171 (median age = 17wks) vs. N171::Wdfy3Var/Var (median age = 26wks): Mann-Whitney U for time: Z=−6.4, p<0.001. N171 vs N171::RosahAlfy/+ (median age = 21wks): Mann-Whitney U for time: Z = −4.524, p<0.001. Mixed sex cohorts. N171 n=66; N171:: Wdfy3Var/Var n=29; N171::RosahAlfy/+ n=61.
A unique feature of the N171 mice is that they suffer from premature lethality. The cause of the early demise is uncertain but monitoring fecal deposits and performing pathologic examinations suggest that gut motility defects might play a role (data not shown). Interestingly, increasing levels of Alfy prolongs normal fecal deposition and leads to a significant lifespan expansion of the N171 mice (not shown and Fig. 5C). Consistent with our cell based data, these data suggest that diminishing protein accumulation may protect across different tissues and not only the brain.
Upregulation of Alfy is protective in a mouse model of synucleinopathy
A shared feature across adult-onset neurodegenerative diseases is that a once functional, soluble protein becomes entangled in an insoluble complex, that ultimately consolidate into the inclusion bodies that are known neuropathological hallmarks. We previously found that autophagy degrades aggregated structures that are predominantly less than 1 micron32, and with others, found that Alfy can target different aggregated structures for autophagic degradation32,37,51–53. This suggests that the biochemical and physical features of the structure, rather than the identity of the aggregating protein, are important for selection by Alfy. We therefore determined if augmenting Alfy levels is protective against two additional proteinopathies, synucleinopathies and tauopathies.
Synucleinopathies are a group of neurodegenerative diseases characterized by the presence of intracytoplasmic accumulates of aggregated αSyn and include disorders such as PD and Dementia with Lewy Bodies (DLB)54. A prominent model for synucleinopathies is the α-Syn PFF model55–57. Intracerebral introduction of α-Syn PFFs leads to a change of endogenous α-Syn into states that are reminiscent of pathological αSYN found in patients, such as the accumulation of phosphorylated αSyn at serine 129 (pS129-αSyn). WT and RosahAlfy/hAlfy mice received a single striatal injection of mouse αSyn PFFs and were euthanized 120 days post-injection (Fig. 6A). Consistent with the literature55,58–60, PFF-injections in WT mice led to the accumulation of pS129-αSyn) in the injected striatum, as well as regions of innervation including the cortex, amygdala, and substantia nigra pars compacta (SNpc) (Fig. 6C–G, S5). The aberrant accumulation was accompanied by a loss of tyrosine hydroxylase (TH)- or Nissl-positive neurons in the SNpc, attesting to their toxicity55,56. In contrast, PFF-injections in RosahAlfy/hAlfy mice revealed that despite a similar aggregation load at the injection site with WT (Fig. S5A), as well as similar staining for endogenous αSyn (Fig. S5D), pS129-αSyn accumulation appeared attenuated in projection areas (Fig. 6C, S5B–D). Subsequent quantification in SNpc revealed that there was significantly less aggregation in the RosahAlfy/hAlfy mice (Fig. 6C,D), demonstrating that Alfy overexpression can also diminish pS129-αSyn accumulation. Moreover, quantification of neurons revealed a significantly greater number of TH-positive and Nissl-positive dopaminergic neurons present in PFF-injected RosahAlfy/hAlfy mice. These data demonstrate that Alfy overexpression reduces aggregate burden and delays neurodegeneration in the αSyn PFF model.
Fig. 6. Increasing Alfy levels protects against αSYN accumulation and neurotoxicity in a PFF model of synucleinopathy (See also Fig. S5).

A. Schematic representation of experimental design. WT and RosahAlfy/hAlfy littermates generated from the intercross of RosahAlfy/+ mice were used.
B. Summarized representation of striatal injection site (red) per animal.
C. pS129-αSYN counterstained with Nissl in SNpc of mice injected with PFFs. D. Quantification of aggregates per field. Bar graphs of Mean±St.Dev with individual data points. n=4/condition. Two-tailed student t-test, *, p<0.001.
E. Images of TH+ and Nissl+ neurons in the SNpc. Quantification of F. TH+ and G. Nissl+ cells contralateral (C) and ipsilateral (I) to injection site. RM-ANOVA. *, p<0.05. Complete statistics can be found in Table S2. Bar graphs of Mean±St.Dev with individual data points. n=4/genotype.
Upregulation of Alfy is protective in a mouse model of tauopathy
Another commonly occurring proteinopathy is the abnormal accumulation of the neuronal microtubule-associated protein tau. Post-translational modifications of tau favor conformational changes in the protein, leading to fibril formation and insolubility61. The accumulation of phosphorylated, paired helical filaments (PHFs) of tau are found across numerous diseases from Alzheimer’s disease and Frontotemporal dementia (FTD), to rare disorders such as Progressive Supranuclear Palsy and Pick’s disease. The PS19 transgenic mouse model expresses the T34 isoform of tau with one N-terminal insert and four microtubule binding repeats encoding the human P301S mutation, which causes FTD with parkinsonism62–64. These mice demonstrate an AT8-positive tauopathy with neurodegeneration of forebrain regions62. PS19 mice were crossed with RosahAlfy/hAlfy mice, then characterized at 34 weeks-old for the accumulation of AT8-positive structures and neurodegeneration (Fig. 7). Consistent with the reduction of mutant Htt and pS129-αSyn, increased levels of Alfy prevented the accumulation of AT8-positive structures in the somatosensory (SS) cortex and hippocampus (Fig 7B). This difference was apparent despite showing no difference in soluble levels of total tau or AT8-positive phosphorylated tau (pTau), suggesting that diminished AT8 staining was neither due to diminished total tau levels, or increased turnover of soluble pTau (Fig 7D). In addition, the ratio between pTau and tau were also unchanged suggesting that increasing levels of Alfy does not change phosphorylation of the protein. Again, similarly to the models of HD and αSyn toxicity, diminished pTau accumulation was accompanied by diminished toxicity (Fig. 7C, E). PS19 mice have been reported to have approximately 15% cell loss in the perirhinal cortex by 12 weeks of age65. At 34 weeks, we found that there was an even further loss of cells, but in the presence of Alfy overexpression, the loss was prevented (Fig. 7C). Moreover, like for N171 mice, ectopic expression of Alfy or the presence of the variant enhanced lifespan, again with a greater effect shown by the variant. Taken together, Alfy overexpression can confer resistance across a broad range of aggregating proteins from mutant Htt, pS129-αSyn, and PHF tau.
Fig. 7. Increasing Alfy levels protects against accumulation and neurotoxicity in the PS19 mouse model of tauopathy.

A. Breeding schema to introduce hAlfy (hA) (Bl6/129Sv) onto the PS19 model (B6C3F1/J).
B. AT8 staining from somatosensory (SS) cortex (top) and hippocampus CA1 (btm) from PS19 and PS19::RosahAlfy/hAlfy. Counterstained with Nissl. Higher magnification below.
C. Quantification of Nissl+ neurons. ANOVA with Fisher PLSD. *, p < 0.05. Complete statistics can be found in Table S2. Bar graphs of Mean±St.Dev with individual data points. n=3/genotype.
D. Immunoblotting of detergent soluble HT7 (human) tau and AT8+ phosphorylated tau (pTau). Vinculin loading controls. RosahA/hA littermate control (Ctrl) included to ensure specificity of HT7. Below, relative density of Tau and pTau and their ratio. Bar graphs of Mean±St.Dev with individual data points. n=3/genotype.
E. Survival curve of PS19 mice. PS19 (median age = 10.5 mos) vs. PS19::RosahAlfy/+ (median age = 12.5mos): Mann-Whitney U for time: Z=−2.196, p=0.0281. PS19 vs PS19::Wdfy3Var/+ (median age = 21mos): Mann-Whitney U for time: Z=−2.509, p=0.0122. Mixed sex cohorts. PS19 n=28; N171:: Wdfy3Var/+ n=6; N171::RosahAlfy/+ n=23
The impact of Alfy overexpression on gene expression is revealed on the background of a proteinopathy
By increasing levels of the autophagy adaptor protein Alfy and augmenting aggregate-turnover, we find that this delays neurotoxicity. To gain insight into how diminishing aggregate burden might be protective, we returned to the Q140 model which has a well-established transcriptional signature via total RNA sequencing25.
We first asked if increased levels of Alfy leads to discrete changes in differentially expressed genes (DEGs) in the striata of WT versus Q140 mice (Fig. 8A–C, Table S3). The presence of one copy of hAlfy led to 133 up- and 67 down-regulated genes relative to WT mice, suggesting a modest impact of Alfy expression. In contrast, on the Q140 background, the number of changes increased in a dose-dependent manner from 173 up- and 132 down-regulated genes in RosahAlfy/+::Q140 vs. Q140, to 921 and 773 in RosahAlfy/hAlfy::Q140 vs. Q140 mice, respectively (Fig. 8A–C, Table S3). In addition to the change in DEG number, the −log10 False Discovery Rate (FDR) increased, suggesting increased certainty. As to the nature of the changes (Fig. 8D–G, Table S4–5), Gene Ontology (GO) analyses coupled with Search Tool for the Retrieval of Interacting Genomes (STRING) analyses revealed that Alfy over-expression, on the Q140 but not WT background, leads to changes that increased expression of inter-related genes, all involved in translation and ribosomal biogenesis; pathways shown to be dysfunctional broadly across neurodegenerative diseases66–74 (Fig. 8D,E, Tables S3, S4). Decreased gene expression observed on both WT and Q140 backgrounds are involved in angiogenesis and cell migration. Taken together, these findings suggest that Alfy may negatively regulate genes involved in angiogenesis and cell migration, whereas its overexpression can correct the disruption in translation and ribosomal dyshomeostasis that occurs in the presence of a proteinopathy.
Fig. 8. Increasing Alfy levels leads to changes in ribosomal biogenesis, but not on the larger transcriptome-wide signature of HD (See also Fig. S6,S7).

A-C. Volcano plots of DEGs evoked by Alfy overexpression in A. WT vs. B,C. Q140 mice. See Table S3. Although several gene changes were noted by Alfy overexpression in a WT background, no discernable pattern were observed using independent approaches such as Gene Ontology or STRING analyses.
D-G. Gene ontology analyses and protein interaction network of DEG lists based on Table S3. D, G. GO analyses of D. increased and G. decreased gene expression changes from all comparisons. E, F. Protein-protein interactions using Cytoscape via the STRING database, v12.0. E. increased and F. decreased gene expression changes due to homozygous overexpression of hAlfy in Q140 mice to illustrate the inter-relationship of the DE increased and decreased genes with E. ribosomal biogenesis and F. angiogenesis.
The transcriptomic study we performed mirrored a previously published study that established an HD transcriptomic signature in the Q140 mice25. In light of the positive impact Alfy has on the neuropathological and behavioral phenotypes we examined, we also asked whether increasing Alfy levels altered the Q140 transcriptional signature previously described25 (Fig. S6). To do so, we first performed transcriptome-wide correlation analysis between the differential expression statistics of the striata of our Q140 vs. littermate WT mice and the previously published comparison of Q140 vs CAG20 (Q20)25 (Fig. S6A). This revealed that our Q140 mice, despite being of mixed background (C57Bl6x129Sv), largely maintained the transcriptional signature as previously reported25, with a positive correlation coefficient of 0.78. (Fig. S6A). Given the similarities, we determined the impact of Alfy overexpression on the HD transcriptional signature (Fig. S6B–D). Correlation analyses revealed that Alfy overexpression did not substantially alter the Q140 transcriptional signature (Fig. S6C,D). This was consistent with principal component analysis, which identified Q140 to account for the largest possible variance rather than Alfy levels (Fig. S6B). Although Alfy overexpression left the HD transcriptional signature largely unmodified, we identified a subset of Q140 dysregulated genes that are exacerbated (as indicated by a negative correlation) or rescued (as indicated by a positive correlation) (Fig. S6C,D, S7, Table S6,7). GO analyses revealed that transcripts involved in protein metabolism and focal adhesion protein were rescued, whereas transcripts involved in angiogenesis were exacerbated, but changes were minimal. Overall, these data suggest that the transcriptional changes observed in Q140 mice may reflect the disease-specific state evoked by the CAG expansion mutation in the Htt gene, whereas the modifying effect of Alfy overexpression is post-transcriptional and at the level of the proteinopathy.
Discussion
By leveraging the strengths of human and mouse genetics, we identified a potent modifier of neurodegenerative diseases that evokes protection by preventing protein accumulation, providing critical insight into the relevance of diminishing protein-mediated toxicity and positive outcomes in the adult brain.
The starting premise of this study aims to determine if a rare variant, rs17368018, underlies the delayed age of onset observed in an extended family of HD. Although modeling implicated this SNP as most highly correlated with the delayed age of onset (Fig. S1A), our inability to identify enough patients to reach power required an orthogonal approach to test our hypothesis. WDFY3 is exquisitely conserved across vertebrates, and thus mouse modeling permitted us to eventually capture the molecular consequence of this rare coding variant; it increases expression of the protein product by increasing transcript stability (Fig. 2). Although SNPs within a coding sequence are more associated to a change in protein function, SNPs can alter the transcript expression. For example, a synonymous SNP in corneodesmosin (CDSN) increases transcript stability by changing the sequence within a stability motif75, leading to changes in RNA-protein interactions. Although the affected sequence in WDFY3 differs from CDSN, a similar mechanism might be at play; RNAs naturally interact with RNA-binding proteins (RBPs), RNA-protein complexes and other RNAs76,77. Whether this is due to changes in direct binding or changes in RNA secondary structure will require a further and important line of study, since the mechanism may outline novel therapeutic approaches that can translate the findings we present here.
Alfy is highly expressed in the brain, and like other genes with similar profiles, it is essential for CNS development and maintenance22,46,53,78,79 and the loss of function has been implicated in neurodevelopmental disorders and developmental delay46,79–81. Using heterozygous depletion of Wdfy3, we previously found that reducing Alfy was sufficient to accelerate aggregate accumulation and phenotypic onset in HD mice34. Unlike the loss of function studies, expression of the SNP or ectopic overexpression of Alfy had no notable impact on peripheral tissue, as both the Wdfy3Var and RosahAlfy mice were indistinguishable from controls. Furthermore, transcriptome-wide analyses also revealed that there is little impact on basal transcription as well, consistent with the greater health-span observed within the Venezuelan patients carrying this variant. Notably, increasing the adaptor protein revealed that global upregulation of autophagy may not be necessary to harness its therapeutic potential. Given the broad homeostatic role of autophagy that may differ across different cell types and tissue, autophagy may be too complex to consider affecting protein accumulation alone. This has been highlighted by studies upregulating autophagy globally by decreasing levels of Rubicon, which can augment autophagic clearance of aggregated proteins in brain, but can have problematic effects in peripheral tissues, and lead to metabolic disease82,83.
Although ectopic Alfy overexpression captured the general protective features of rs17368018, some of our findings indicate that the latter is more protective, suggesting that Alfy may be acting beyond autophagy alone. The difference is most evident in the survival of the N171 and PS19 models (Fig. 5C, 7E). Why the variant might be more protective is unclear. Ectopic overexpression limits genetic regulation of Wdfy3, but studies suggest that Alfy may also impact the turnover of NIPSNAP-positive mitochondria84 and improve efferocytosis85, suggesting potential anti-inflammatory outcomes. Recently, BEACH domain containing proteins have been shown to act as cargo sorting adaptors in secretory and endocytic pathways86, consistent with the loss of the ability of AlfyKO neurons to respond to pathfinding cues during development22. How these other functions might be potentiated by increasing Alfy still needs to be explored. Our transcriptional study, however, suggests that Alfy’s ability to prevent protein accumulation is essential by maintaining ribosomal homeostasis. The direct disruption of protein translation due to the CAG repeat87–90 has been reported and similar events due to α-Syn and tau are also suggested73,74,91,92.
The need for better understanding of Alfy biology notwithstanding, we find that for three distinct, aggregation-prone and disease-causing proteins, slowing accumulation can be significantly protective against neurodegeneration. The ability to demonstrate the significance of protein aggregation and accumulation on disease pathogenesis, especially as a therapeutic target, has been impressively frustrating. The rationale underlying this study stems from a continuous line of cell- and animal-based studies showing that Alfy is required to clear aggregated proteins in the adult brain32–34. Through the design of this study, we cannot determine if aggregate formation is slowed by increasing Alfy expression, but it clearly demonstrates that protein accumulation is detrimental, and its prevention is a potent way to help maintain function. How increasing Alfy levels might influence the different proteinopathies might vary, and for proteins such as oligomeric αSyn, it remains unclear if Alfy alters propagation kinetics or the end stage accumulation event. Given its role in macrophages85, studies implicating the ability of microglia to uptake αSyn93 may be at play. Future studies that overexpress Alfy in a cell type specific manner will permit greater mechanistic insight, and may indicate that augmenting its expression can complement existing therapeutics in development.
Taken together, by applying the complementary nature of human and mouse genetics, we address two major questions in adult neurodegeneration: the importance of the essential pathway autophagy and the significance of protein accumulation on pathogenesis. We believe these findings highlight the strength of mouse modeling and how it can serve to complement patient-related findings. As such, we believe they will serve as a strong foundation from which a potential therapeutic avenue for combatting these devastating diseases might be born.
Resource Availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Ai Yamamoto (ai.yamamoto@columbia.edu).
Material availability
All unique/stable reagents generated in this study will be made available by request to the Lead Contact with a completed Materials Transfer Agreement. We are glad to share mouse lines and other resources generated in this study, with reasonable compensation by requestor for shipping.
Data and code availability
The RNA sequencing datasets generated during the current study have been made immediately available in the Gene Expression Omnibus (GEO), GSE281823. No new code has been generated as part of this publication. Any additional information required to reanalyze the data reported in this work paper is available from the Lead Contact upon request.
STAR METHODS
Experimental model and study participant details
Human participants:
The participants are from the Venezuelan HD kindred, whose documentation began in 1979 and thanks to an international, interdisciplinary team that had traveled annually to Maracaibo, Venezuela. Genetic and clinical data from these kindreds have been used in this investigation and have been extensively described elsewhere.20,94–96 All experiments with genetic material have been granted IRB exemption by the MIT Committee on the Use of Humans as Experimental Subjects. Patients were de-identified and only identified by code.
Human brain samples:
Carriers of rs17368018 were identified by genotyping 597 samples of varying diagnoses from the New York Brain Bank (NYBB) as described on Table S8. We identified 7 independent samples of varied patient histories positive for the SNP. Tissue from the Broadmann Area 9 (BA9) frontal cortex and cerebellum was used for RT-qPCR and immunoblotting, respectively. All experiments with patient material have been granted IRB exemption status by virtue of working with de-identified material from deceased individuals
Mice:
Animals were bred and housed in facilities at the William Black Medical Research Building. Same-sex animals of mixed genotypes, maximum 5 adult mice per cage, are housed in a humidity- and temperature-controlled room, with access to food and water ad libitum. Animals are maintained on a 12-hour light/dark cycle. For breeding and housing prior to experiments, animals were maintained on a cycle with lights on between 7:00 A.M and 7:00 P.M. For experimental and behavioral analysis, animals were maintained on a cycle with lights off between 9:00 A.M. and 9:00 P.M. All experiments were reviewed and approved by the Columbia University Medical Center’s Institutional Animal Care and Use Committee (IACUC).
Generation of conditional Alfy mice (Alfyflox/flox, strain: Bl6/129Sv) were previously described22,34 and HprtCre/+ mice (strain: 129S1, stock no. 004302), were obtained from the Jackson Laboratory (JAX). By crossing Alfyflox/+ males with HprtCre/+ females we created the potential of Alfy heterozygous constitutive knockout (AlfyΔ/+, strain: Bl6/129Sv)22. Conditional human Alfy knockin mice were generated by Ingenious Targeting Laboratory (Rosaflox-hAlfy/+, strain: Bl6/129Sv). Targeted iTL BA1 (hybrid: C57BL/6 X 129Sv) embryonic stem cells were microinjected into CD-1 blastocysts. Resulting chimeras were mated to wild-type C57BL/6N mice to generate F1 heterozygous offspring. This knockin line expresses full-length human ALFY (hALFY) that is fused with a 3xFLAG tag. This sequence is preceded by a stop cassette flanked with LoxP sites, and was knocked into the Rosa locus and is driven by the Rosa promoter. Mice with a heterozygous hALFY allele (Rosaflox-hAlfy/+) were crossed to obtain homozygous Rosaflox-hAlfy/flox-hAlfy mice. Crossing with HPRTCre/+ females removed the floxed stop cassette, allowing for expression of hAlfy (RosahAlfy/+). Wdfy3Var/+ mice (strain Bl6/129Sv) were generated from Ingenious Targeting Laboratory. Targeted iTL HF4 (129/SvEv x C57BL/6 FLP) hybrid embryonic stem cells were microinjected into C57BL/6 blastocysts. Resulting chimeras were mated to C57BL/6 WT mice to generate Germline Neo Deleted mice. This knockin mouse model expresses the T>C point mutation identified in humans consisting of a T > C change at exon 59, codon 4090, at the Wdfy3 locus and driven by the Wdfy3 promotor. Q140 mice (strain C57BL/6J, stock no. JAX027409), N171-82Q mice (strain B6C3F1/J, stock no. JAX003627) and PS19 P301S mice (strain B6C3F1/J, stock no. JAX008169) were obtained from the Jackson Laboratory. Q140 mice contained a floxed neo cassette and were crossed with HPRTCre/+ females (C57BL/6J) resulting in deletion of the neo cassette. After crossing these models with either RosahAlfy/+ or Wdfy3Var/+ lines, the strains of all animals used in the study were as follows: Q140 (Bl6/129Sv), N171-82Q (Bl6/C3/129Sv), and PS19 (Bl6/C3/129Sv). PFF model was created in Alfyflox/flox, and WT littermates created by intercrossing Alfyflox/+ mice (strain: Bl6/129Sv)
Cellular models:
HEK293T WT and WDFY3Var cells were maintained in high-glucose Dulbecco's modified eagle medium (DMEM; Life Technologies) supplemented with 20% fetal bovine serum (FBS; Life Technologies) at 37°C and in a 5% CO2-containing atmosphere. Tet-regulatable 103QmGFP cells were maintained as previously described43.
METHOD DETAILS
Blinding, Replicates and Controls:
All human samples were de-identified. Identification codes of mice were assigned upon weaning prior to genotyping. All mice experiments were performed blind to genotype, with littermates and cagemates used as controls. Genotypes were revealed at time of analysis. Sex and age of mice, as well as experimental replicates are listed under each experiment and figure legends. For cell culture experimental replicates are from independent passages, whereas samples generated from the same passage number are considered a technical replicate.
Genome-wide genotyping and imputation of Venezuelan patients:
DNA was extracted from EBV-transformed lymphoblastoid cell lines established from blood samples of the Venezuelan individuals using the Qiagen Blood and Tissue DNeasy Kit with a fine-mapping approach that combined whole genome sequencing and an Illumina Core Exome single nucleotide polymorphism (SNP) array across 440 HD patients. Genotyping with CoreExome array was performed at the New York Genome Center on a HiScan Illumina machine. Population-based imputation was performed using Minimac4 to impute genotypes from the publicly available TopMed R2 reference panel and whole genome sequences from select Venezuelan patient samples.
Genome-wide association study of residual age of onset:
To perform quantitative genome-wide association testing using the SAIGE software package97, a linear mixed model regression approach was implemented using residual age at motor onset as a phenotype and allowing for adjustment of empirical pairwise relatedness as well as other covariates, such as sex and population structure. We used age at onset of motor signs and CAG repeat length to derive the residual age at onset. In order to subtract the effects of CAG repeats from the age at onset of motor signs, we used a phenotype model previously developed98 through a linear regression of natural log-transformed age at motor onset to CAG repeat length. In order to reduce skewness in the distribution of residual age at onset to more closely model a theoretical normal distribution, a Yeo-Johnson power transformation was applied to the distribution.
Reverse transcription (RT) and Quantitative PCR (qPCR) of ALFY: Human brain samples:
Total RNA was extracted from approximately 25mg of tissue using the total RNeasy kit (Qiagen). Residual genomic DNA was removed on the column using the RNase-Free DNase Set as described in the RNeasy kit. cDNA was reverse transcribed using the iScript cDNA synthesis kit (BioRad). Quantitative PCR was performed on a LightCycler 480II machine (Roche) using the Luna Universal qPCR master mix (NEB) and primer pairs specific to human WDFY3 and RPLP0 as a housekeeping gene for normalization. Ct values were calculated using the 2nd derivative method.
Mouse brain samples:
Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen), cDNA was reverse transcribed using random hexamers and SuperScriptIII reverse transcriptase (Invitrogen). qPCR was performed using KAPA SYBR FAST qPCR kit (Roche) primers against mouse ALFY (Mm_Wdfy3_1_SG, cat no QT00170583) or mouse TBP (Mm_Tbp_1_SG, cat no QT00198443)(QuantiTect) as a housekeeping gene for normalization. WDFY3Var cells: Total RNA was extracted from WT and WDFY3Var HEK293T cells using the total RNeasy kit (Qiagen). 1 ug or 2 ug of RNA was loaded into the reverse transcription reactions performed with Smartscribe Reverse Transcriptase (Takara). The program used is as follows; 90 min at 42 °C followed by 15 min at 72 °C. After RT, samples were diluted by 1:10 then used for qPCR with KAPA SYBR FAST or Fisher FAST SYBR mix. Primers were used to target human ALFY, c-Myc (short-lived transcript), and GAPDH (housekeeping gene/long-lived transcript). qPCR cycling conditions: 95 degrees for 3 min, 40 cycles of 95 degrees for 3s, 60 degrees for 30s.
Generation of PFF model:
Four-month-old WT and RosahAlfy/hAlfy mice were anesthetized and stereotaxically injected in one hemisphere with 500 nL (2.5 ug) of fibrillized mouse αSyn (pre-formed fibrils, PFF), as previously described99,100. A single needle insertion was used to target the left dorsolateral striatum (unilateral injection using the following coordinates relative to bregma; L, 2.3mm; A 0.9mm; and V 3.4mm). Animals were monitored regularly following recovery from surgery, and sacrificed at 120 days post-injection by transcardial perfusion for histological analysis.
Genotyping:
Genomic DNA was isolated from ear punch biopsies. Samples were lysed overnight at 55°C. DNA was precipitated by adding 350 μL isopropyl alcohol (Thermo Fisher) to the digested sample. Tubes were then inverted to mix thoroughly, followed by centrifugation at 4°C, 14,000 rpm for 30 min. Once the supernatant has been decanted, the pellet was washed with 800 μL 80% ethanol (Decon Laboratories) and spun at 4°C, 14,000 rpm for 10 min. The supernatant was carefully removed and the DNA pellet was air-dried for 5 min at room temperature. Samples are resuspended in 50 μL of nuclease free water. PCR was performed using DreamTaq Green Master Mix (Thermo Fisher). Cycling conditions for Alfy flox, RosahAlfy, and Wdfy3Var mice are as follows: 94 degrees for 2 minutes (min); 10 cycles of 94 degrees for 15 seconds (s), 65 degrees (decreasing by 1 degree/cycle) for 45s, and 72 degrees for 45s; 25 cycles of 94 degrees for 15s, 55 degrees for 30s, 72 degrees for 45s; 72 degrees for 7 min.
Mouse Behavioral Testing:
Animals were relocated and acclimated to the reverse-cycle Satellite Animal Facility one month prior to behavioral testing. Lights were off between 9 AM and 9 PM so that longitudinal assays could be conducted during the animals dark/active hours. All behavioral assessments were performed between hours 3 and 8 of the dark cycle. Littermates of the same sex were randomly assigned to experimental groups at weaning, and experimenters were blinded to genotype. Mice were maintained in group housing, and experiments were performed by cage.
Open field:
Mice were habituated to the behavior room for 30 minutes prior to testing. Locomotor activity (including total distance traveled) was recorded by an automated monitoring system using equipment and software from Med Associates. Each mouse was tested for a single exposure of 2 hours in the open field arena (43.2 cm × 43.2 cm × 30.5 cm) (Med Associates). Data was binned into 5-minute intervals. The Q140 cohort was assessed at 6 months old, and the N171-82Q+/− cohort was assessed at 3 months old.
Accelerated rotarod test:
For the Accelerated Rotarod assay, the Mouse Rota-Rod apparatus (Ugo Basile) was used. The rod consists of textured drums to avoid slipping, and allowed 5 mice to be trained simultaneously. Training consisted of one day of initial exposure where each mouse performed three, 5-minute trials with the first trial at a constant speed of 5 rpm, a second trial with speed accelerating from 5 rpm to 15 rpm, and a third trial with speed accelerating from 5 to 25 rpm. Animals were given 10-minute rest intervals between trials. Training day was followed by three consecutive days of testing on the accelerated rotarod with speeds accelerating from 5 to 40 rpm over 5 minutes for a total of three trials each day. Mice were allowed 1 fall from the rotarod and on the second fall, the trial was terminated and latency to fall was recorded. Training was only conducted during the first exposure at 2 months, and testing was repeated every 4 weeks from 2 to 5 months old.
Fixed Tissue Preparation:
Mice were deeply anesthetized with isoflurane and transcardially perfused with 25 mL of ice-cold phosphate buffer saline (PBS) followed by 25 mL of 4% paraformaldehyde (PFA) in PBS. Brains were dissected and post-fixed in 4% PFA overnight at 4 °C, then washed in PBS and stored in 30% sucrose in 1X phosphate buffer (PB) for 72 hours minimum, until used for processing. Brains were snap-frozen in powdered dry ice then cryoprotected in OCT embedding medium (Thermo Fisher). Serial sections 30 μm thick were cut in sets of 8 through the striatum, and sets of 4 through the substantia nigra on a Leica CM 1950 cryostat and stored at 4°C in 1x PB containing 0.02% sodium azide as a preservative.
Tissue preparation for detergent soluble fractions:
Tissue (50–500 mg) was placed in a glass dounce homogenizer with an equal volume of 1X phosphate buffer saline (PBS) containing 1X Halt protease inhibitor cocktail (ThermoFisher) and disaggregated with 40 pumps of a pestle. The suspension was transferred to a tube and an equal volume of detergent (2% Triton X-100 [Tx-100] in PBS) was added to bring the final detergent concentration to 1%Tx-100 in PBS (PBS-Tx), and incubated for 30 minutes on ice, then spun in an Eppendorf 5417R centrifuge at 1000 rpm for 5 minutes. To segregate the Tx-100 soluble versus insoluble fraction, the supernatant (S1) was centrifuged at 14,000 rpm for 5 minutes. The resulting supernatant (S2) represents the detergent soluble fraction.
Immunoblotting:
20 μg of total protein lysate was resolved by SDS-PAGE (Thermo Fisher) at 180V. Proteins were transferred to PDVF membranes (Thermo Fisher) for 1.5 hours at 0.4A, and blocked for 1 hour in 3% BSA (Thermo Fisher) in 1x PBS with 0.1% Tween (Thermo Fisher) at room temperature. Membranes were probed overnight at 4 °C with primary antibodies. Primary and secondary antibody dilutions contained 0.1% PBS-Tween. Following three washes, membranes were incubated with HRP-conjugated secondary antibody (Thermo Fisher) for 1.5 hours at room temperature. Bands were visualized by the Clarity Western ECL Substrate (BioRad) and detected using the BioRad VersaDoc imaging system. Band intensities were analyzed using ImageJ and normalized to a loading control (vinculin) probed on the same blot
Immunohistochemistry:
Representative sections throughout the brain were stained. Sections were washed in PBS containing 0.02% Triton-X, followed by antigen retrieval in sodium citrate, pH 9.0 boiling at 70°C for 20 minutes. Sections were washed three times then endogenous peroxidases were blocked with 1% hydrogen peroxide in 0.5% Triton-X PBS for two 10-minute washes. Sections were washed three times before blocked in 0.4% Triton-X for 1 hour at room temperature, then incubated overnight in primary antibody dilutions containing 0.4% Triton-X PBS. For MAB5492 staining, sections were blocked using a Mouse on Mouse (M.O.M.) Immunodetection kit (Vector Labs) to reduce endogenous mouse Ig staining. These sections were briefly washed with contained M.O.M. Protein Concentrate (Vector Labs) in 0.4% Triton-X PBS before incubating overnight in primary antibody dilutions that also contained Mouse on Mouse Protein Concentrate in 0.4% Triton-X PBS. Sections were washed 3 times in PBS then were incubated in biotinylated secondary antibody at room temperature for 1 hour. Signal was amplified using the Vectastain ABC Kit (Vector labs) and detected using diaminobenzidine (DAB) (10 mg/25mL) in phosphate buffer containing 0.00001% H2O2. Following the DAB reaction, sections were washed in phosphate buffer then mounted on glass slides and air-dried. Once thoroughly dried, slides were dehydrated in ascending grades of ethanol, cleared in xylene (Thermo Fisher), and cover slipped with Permount mounting medium (Thermo Fisher).
Stereology:
Unbiased stereological counts were obtained from the striatum using Stereo Investigator Software (MBF Bioscience). The optical dissector method was used to count profiles in an unbiased random selection of serial sections in a defined volume of the striatum, cortex, substantia nigra pars compacta (TH/Nissl only), or perirhinal cortex (Nissl only). Total numbers were calculated using optical fractionator estimations and the variability within animals was assessed via the Gundersen Coefficient of Error (< 0.1). For all striatal stereological counts, the left hemisphere was traced at 2x magnification. Parameters for individual immunostains/structures are as follows:
mHtt inclusions (MAB5492):
Inclusions were classified as cytosolic or intranuclear and combined for total mHtt aggregate scoring. Sections were counterstained with Nissl following immunolabeling. The counting parameters involved a 300 × 300 grid with a 50 × 50 counting frame at 60x magnification, and a fixed tissue thickness of 30 μm.
FoxP1 positivity:
FoxP1 staining intensity was classified as weak, medium, and strong signal. Medium and strong nuclei counts were compared over total positive cells to assess variability across animals. The counting parameters involved a 250 × 250 grid with a 100 × 100 counting frame at 40x magnification, and a fixed tissue thickness of 30 μm.
Reactive astrocytes (GFAP):
The counting parameters involved a 500 × 500 grid with a 300 × 300 counting frame at 40x magnification, and a fixed tissue thickness of 30 μm28.
Activated microglia (IBA1):
Concurrent with cell counting, Iba1-positive microglia were categorized as one of four types (representative images can be found in Fig. S1): Type 1: thin ramified processes, Type 2: thick long processes, Type 3: stout processes, or Type 4: round/ameboid shapes29,30. Type 1/2 are considered ramified/quiescent and therefore grouped together, whereas Type 3/4 are considered activated. The counting parameters involved a 250 × 250 grid with a 100 × 100 counting frame at 40x magnification, and a fixed tissue thickness of 30 μm.
TH-positive neurons (SNpc):
Sections were counterstained with Nissl following TH immunolabeling. Glial nuclei were excluded from Nissl-positive neuronal counts based on size. Parameters involved a 50 μm × 50 μm counting frame systematically distributed across a grid 150 μm × 150 μm within the injected and uninjected SNpc56,57. Neurons were counted at 60x magnification at a fixed tissue thickness of 30 μm.
Nissl-positive neurons (Prh):
Sections were counterstained with Nissl following AT8 immunolabeling. Glial nuclei were excluded from Nissl-positive neuronal counts based on size. Parameters involved a 40 μm × 40 μm counting frame systematically distributed across a grid 200 μm × 200 μm within the right hemisphere perirhinal cortex65. Nissl-positive neurons were counted at 40x magnification at a fixed tissue thickness of 30 μm within 12–15 counting windows.
Counting phosphorylated α-synuclein inclusions (pSer129-positive aggregates):
Stereo Investigator Software (MBF Bioscience) was used to assess the total number of phosphorylated α-syn aggregates within the SNpc at 120 days post-injection. Sections were counterstained with Nissl following pSer129 immunolabeling. A contour was drawn around the SNpc of the injected hemisphere using a 4X objective and aggregates were systematically counted using the 20X objective. Based on the literature56, the counting parameters selected for the SNpc involved a 250 × 250 grid with a 250 × 250 counting frame at 20x magnification, and a fixed tissue thickness of 30 μm. The total number of aggregates was recorded for every fourth section (1:4 series) throughout the rostro-caudal axis of the SNpc. The total number of aggregates for each section was compiled and reported as a total for each animal. Counts reflect actual numbers counted, not a population estimate derived from a sample within the SNpc.
Tissue selection and mRNA sequencing:
Striatum was selected for mRNA profiling at a 6-month time point. Samples consisted of four female and four male heterozygous Q140 mice with or without Alfy overexpression, in addition to control littermates with or without Alfy overexpression. Total genotypes included WT, RosahAlfy/+, Q140, Q140::RosahAlfy/+, Q140::RosahAlfy/hAlfy. RNA extraction, sequencing, data processing and analysis was conducted as previously described by Langfelder, et al25
Creation of HEK293 WDFY3Var cells:
HEK293T cells were plated into 6 well plate at density 105 cells/well and transfected 24h later with prepared pGL3-U6-sgRNA-PGK-puromycin guide RNA vector and NG-ABE8e vector (gift from David Liu, Addgene plasmid # 138491) in 1:1 ratio using X-tremeGENE 9 DNA Transfection Reagent (Roche). Complete media was supplemented with 2 μg/ml of puromycin 24 hours after transfection and cells were cultured in this media for additional 48 hours. 72h after transfection (48h after addition of puromycin) cells were lysed in 150μl of DirectPCR Lysis Reagent (Cell) (Viagen Biotech), supplemented with 0.2 mg/ml of Proteinase K and incubated for 6h at 55 degrees followed by incubation at 85 degrees for 45 min. 0,5 μl of lysate was used as a template to PCR region of genomic DNA around I3032 of ALFY/WDFY3 using primers pair Fw1 : CCACCCAGCAGGTCTTGTAG Rev1: TGGCTAGGATCTCTCGGAGG or Fw2: CATTCCACCCAGCAGGTCTT Rev2: AGCCAGACCACAAAAGAGCA. Obtained PCR products were cloned into pCR-Blunt II-TOPO vector (Zero Blunt™ TOPO™ PCR Cloning Kit, Invitrogen) and transformed into Stbl3 chemically competent cells. Plasmid DNA was purified from 20 bacterial colonies and sequenced with T7 primer (TAATACGACTCACTATAGGG).
Preparation of pGL3-U6-sgRNA-PGK-puromycin guide RNA vector:
Oligonucleotides ccggaggtattcttgcggtggaac and aaacgttccaccgcaagaatacct were phosphorylated and 100μM of each annealed using T4 PNK (NEB). Annealed oligos were cloned into pGL3-U6-sgRNA-PGK-puromycin vector (gift from Xingxu Huang, Addgene plasmid # 51133) cut with BsaI-HFv2 restriction enzyme.
Aggregate clearance assay:
AlfyC constructs were created as previously described32,33,39. I3032V modification was created by introducing the Ala to Gly mutation using QuikChange mutagenesis per manufacturer’s instructions. Constructs was transiently transfected into 103QmGFP cells using Lipofectamine 2000 per manufacturer’s instructions and assayed for aggregate clearance43,101. Briefly 24 hrs post-transfection, cells are replated onto coverslips then 48 hrs later, fixed with 4% paraformaldehyde in PBS +/+ for 10 min at room temperature. Cells were washed two times with PBS, the incubated with 1 μg/ml Hoechst solution (Life Technologies) for two hours at room temperature. Images were acquired using a Leica TCS SP2 confocal microscope at 63x magnification and the accompanying software package. Aggregates and nuclei were counted using ImageJ.
Cell Fractionation: Nuclear isolation:
Nuclei EZ kit was used to isolate nuclei followed by immediate RNA isolation. Cytosol extraction: Either supernatant from Nuclei EZ prepped samples were used (after centrifugation step 1) or HLB buffer was added directly to cell pellet to extract cytosol102.
Actinomycin D treatment:
Cells were seeded at 3×105 cells per well (6 well plate)44. The following day, Act D (10μg) was added to the wells then samples were collected at designated time points (t=1, 2, 4, 8 hrs). The cell pellets were then used directly in RNA isolation with the RNeasy kit.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical analyses:
Statistical analyses of survival, behavioral data, western blots, stereologically obtained counts and volumes were performed using Statview or SAS (SAS Institute) unless otherwise stated in the text. Statistical significance was accepted at p < 0.05. Normally distributed data were subject to student t-test or, for multiple comparisons, analysis of variance (ANOVA). Complete F-statistics and calculated p-values are found in Table S2, as indicated in the Figure Legends. Fisher PLSD was used as a post hoc test. Power analyses for behavioral and neuroanatomical studies were performed to achieve a power of 0.8 with a confidence of 0.95 using G*Power 3.1103. Effect sizes were based upon pilot studies, previously published, or unpublished materials. n-values are indicative of biological replicates, and no data were excluded from analyses. Nonparametric tests such as Kruskal-Wallis and Whitney Mann U were used if normal distribution of data was not assumed. Data are represented as mean +/− SEM or SD as noted in figures. ImageJ (NIH) was used for western blot quantification of band intensity. RNAseq analyses were performed as previously described.25
Image preparation:
All images were prepared using NIH ImageJ, Adobe Photoshop CS5, and Adobe Illustrator CS5
Supplementary Material
Table S1: Significant variants in linkage disequilibrium in the WDFY3 locus, related to Figure 1A. Excel spreadsheet indicating output from SNPEff, which was used to generate annotation for each SNP with added columns for GWA statistics and variant to protein prediction algorithms (SIFT, CADD, PolyPhen2)
Table S3: DEG lists (FDR < 0.10) are related to Figures 5A, B and C. Excel Spreadsheet with complete DEGs from respective comparisons from Q140 mice.
Table S4: GO Analysis Gene IDs, Increased Expression, as related to Figures. 5D and E. Excel spreadsheet with gene lists representing DEGs that showed increased expression
Table S5: GO Analysis Gene IDs, Decreased Expression, as related to Figures. 5F and G. Excel spreadsheet with gene lists representing DEGs that showed decreased expression
Table S6: Significant Rescue genes (FDR < 0.10) as related to Figure 6 and 7. Excel spreadsheet of genes showing a change in direction upon expression of Alfy (eg Gene whose expression is increased in a WT vs Q140 comparison becomes decreased in a Q140 vs Q140+Alfy comparison)
Table S7: Significant Exacerbate genes (FDR < 0.10) as related to Figure 6 and 7. Excel spreadsheet of genes showing a further enhancement of direction upon expression of Alfy
Table S8: NYBB cohort used for genotyping for presence of Alfy variant, as related to STAR METHODS as related to Figure 2. Excel spreadsheet indicating age, sex, PMI of samples used. Those samples used for subsequent analysis as indicated in Figure 2 are indicated.
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal anti-Alfy | Gifted by Dr. Ben Hoffstrom, Fred Hutchinson Cancer Center | This publication |
| Mouse monoclonal anti-Huntingtin Antibody, a.a. 1-82 | Millipore | Cat# MAB5492; RRID:AB_347723 |
| Rabbit polyclonal anti- Glial Fibrillary Acidic Protein | Agilent | Cat# Z0334; RRID:AB_10013382 |
| Rabbit monoclonal anti-Iba1/AIF-1 (E4O4W) | Cell Signal Technology | Cat# 17198; RRID:AB_2820254 |
| Rabbit polyclonal anti-FOXP1 | Abcam | Cat# ab16645; RRID:AB_732428 |
| Rabbit monoclonal anti-Alpha-synuclein (phospho S129) [EP1536Y] | Abcam | Cat# ab51253; RRID:AB_869973 |
| Rabbit polyclonal anti-Tyrosine Hydroxylase | Sigma-Aldrich | Cat# AB152;RRID:AB_390204 |
| Rabbit recombinant monoclonal anti-Vinculin | Thermo Fisher Scientific | Cat# 700062, RRID:AB_2532280 |
| Mouse monoclonal M2 anti-flag | Sigma-Aldrich | Cat# F1804; RRID:AB_262044 |
| Mouse monoclonal anti-Huntingtin Antibody, clone mEM48 | Millipore | Cat# MAB5374; RRID:AB_177645 |
| Rabbit polyclonal anti-LC3B | Abcam | Cat# ab48394; RRID:AB_881433 |
| Rabbit recombinant anti-SQSTM1 / p62 antibody [EPR4844] | Abcam | Cat# ab109012; RRID:AB_2810880 |
| Mouse monoclonal Phospho-Tau (Ser202, Thr205) (AT8) | Thermo Fisher Scientific | Cat# MN1020; RRID:AB_223647 |
| Mouse monoclonal Tau antibody (HT7) | Thermo Fisher Scientific | Cat# MN1000; RRID:AB_2314654 |
| Rabbit monoclonal α-Synuclein (D37A6) | Cell Signal Technology | Cat# 4179 |
| Rabbit monoclonal anti-Huntingtin antibody [EPR5526] | Abcam | Cat# ab109115; RRID:AB_10863082 |
| Biological samples | ||
| Human Broadmann Area 9 (BA9) frontal cortex | New York Brain Bank | Table S8 |
| Human cerebellum samples | New York Brain Bank | Table S8 |
| Chemicals, peptides, and recombinant proteins | ||
| Bovine serum albumin (BSA) | Sigma | Cat# A4161 |
| TRIzol Reagent | ThermoFisher | Cat# 15596026 |
| Halt protease inhibitor cocktail | ThermoFisher | 78430 |
| 3,3′-Diaminobenzidine tetrahydrochloride | Sigma-Aldrich | Cat# D5905-50TAB |
| Goat Anti-Rabbit HRP | ThermoFisher | Cat# 31460 |
| Goat Anti-mouse HRP | ThermoFisher | Cat# 31430 |
| Fisher FAST SYBR Mix | Applied Biosystems ThermoFisher | Cat# 4385612 |
| KAPA FAST SYBR Mix | Kapa Biosystems Roche Diagnostics | Cat# 50-196-5206 |
| Dulbecco's Modified Eagle Medium | ThermoFisher | Cat# 11965118 |
| Heat inactivated Fetal Bovine Serum | ThermoFisher | Cat# 16140071 |
| Actinomycin D | ThermoFisher | Cat# 11805017 |
| Induro Reverse transcriptase | New England Biolabs | Cat# M0681S |
| Smartscribe Reverse Transcriptase | Takarabio | Cat# 639536 |
| Fibrillized mouse α-Syn | This paper | Polinski, et al. Bieri et al.92,93 |
| Critical commercial assays | ||
| DC protein assay | Biorad | Cat# 5000111 |
| VECTASTAIN Elite ABC-HRP Kit | Vector Laboratories | Cat# PK-6100 |
| M.O.M. Immunodetection Kit | Vector Laboratories | Cat# BMK-2202 |
| Nuclei EZ Prep Kit | Sigma-Aldrich | Cat# Nuc101-1Kt |
| RNeasy Isolation Kit | Qiagen | Cat# 74104 |
| DNeasy Blood and Tissue Kit | Qiagen | Cat# 69504 |
| Deposited data | ||
| Transcriptional profiling of striatum from the Q140 mouse model of Huntington's disease. | GEO deposit | GSE281823 |
| Experimental models: Cell lines | ||
| HEK293T cells | ATCC | Cat# CRL-3216 |
| Experimental models: Organisms/strains | ||
| Mouse: Q140 (strain C57BL/6J) | Jackson Labs | JAX027409 |
| Mouse: N171-82Q (strain B6C3F1/J) | Jackson Labs | JAX003627 |
| Mouse: PS19 P301S (strain B6C3F1/J) | Jackson Labs | JAX008169 |
| Mouse: HPRTCre/+ (strain 129S1/Sv) | Jackson Labs | JAX004302 |
| Mouse: Wdfy3Var/+ (strain Bl6/129Sv) | This paper | N/A |
| Mouse: Rosaflox-hAlfy/+ (strain Bl6/129Sv) | This paper | N/A |
| Mouse: Alfyflox/flox (strain: Bl6/129Sv) | Dragich et al.22 | N/A |
| Oligonucleotides (See Table for complete list) | ||
| Alfy Lox P1 Forward: GAA ACG AAG CTC GTT TAC GG | Dragich et al.22 | N/A |
| Alfy Lox P1 Reverse: TGC AGT GAC ATT TCC TCT GG | Dragich et al.22 | N/A |
| Rosa hAlfy Forward: AAA TCT CAT CCC CGG TGC G | This paper | N/A |
| Rosa hAlfy Reverse: CTG GCA ACT AGA AGG CAC AG | This paper | N/A |
| Rosa WT Forward: AGC ACT TGC TCT CCC AAA GTC | This paper | N/A |
| Rosa WT Reverse: TGA GCA TGT CTT TAA TCT ACC TCG ATG G | This paper | N/A |
| Alfy Var Forward: CAA GTG ACC AGA TTG TGA CTT GCC A | This paper | N/A |
| Alfy Var Reverse: GAG AAC CCA GAC CAG GCT TTG TCA | This paper | N/A |
| Software and algorithms | ||
| Stereo Investigator Software | MBF Bioscience | https://www.mbfbioscience.com/products/stereo-investigator |
| SAIGE software package | Zhou et al.94 | |
| Open field Activity Monitor | Med Associates | https://med-associates.com/product/activity-monitor-7-software/ |
| ImageJ | Schneider et al.99 | NIH |
| Statview | SAS Institute | N/A |
| Photoshop Creative Suite 5 | Adobe | https://helpx.adobe.com/creative-suite.html |
| Illustrator Creative Suite 5 | Adobe | https://helpx.adobe.com/creative-suite.html |
| Bio-Rad CFX Maestro | Bio-Rad | https://www.bio-rad.com/en-us/product/cfx-maestro-software-for-cfx-real-time-pcr-instruments?ID=OKZP7E15 |
Highlights.
A variant of WDFY3 delays the age of onset of HD in the Venezuelan kindred
Orthologous expression of the SNP in mice captures the protection seen in patients
The SNP augments expression of the autophagy adaptor Alfy by increasing mRNA stability
Increasing Alfy expression protects against different proteinopathies
Acknowledgements
We would like to thank all members of the Yamamoto Lab for their insightful comments and suggestions, as well as to Drs. Myriam Heiman, Ulrich Hengst, Un Kang, Christoph Kelledonk and Clarissa Waites. Special thanks to the Alexander Boyd and Jane Starke Boyd Charitable Foundation and the Hereditary Disease Foundation. Additional funding provided by: NIH R01NS077111 (AY, KRC, NAL), NIH R01 NS127186 (AY, NAL), NIH R01 NS101663 (AY), NIH R01NS091144 (JBD), NIH R01NS103037 (JBD), P01NS092525 (DEH, CN, SF, AL), NIH R01NS089076 (DEH, CN, SF, AL), NSF GRFP (KRC, EA), W.M. Keck Foundation (NSW, MZ, CH, AB), Hereditary Disease Foundation (CN, KRC, AY, MZ), Columbia University Precision Medicine Initiative (AY), Research Council of Norway Center of Excellence Project 262652 (AS, SP), Ground-breaking research (FRIPRO) Project 249753 and 314684 (AS, SP), Norwegian Cancer Society Project 190251 (AS, SP), HHMI Gilliam Fellowship (EA), Stanford DARE Fellowship (EA)
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Declaration of interests: AY, KRC, SP and AS have a patent application related to augmenting expression levels of Alfy to combat proteinopathies
References
- 1.Gusella JF, MacDonald ME, Ambrose CM, and Duyao MP (1993). Molecular genetics of Huntington's disease. Arch Neurol 50, 1157–1163. [DOI] [PubMed] [Google Scholar]
- 2.Group, T.H.s.D.C.R. (1993). A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72, 971–983. [DOI] [PubMed] [Google Scholar]
- 3.DiFiglia M, Sapp E, Chase KO, Davies SW, Bates GP, Vonsattel JP, and Aronin N (1997). Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science 277, 1990–1993. 10.1126/science.277.5334.1990. [DOI] [PubMed] [Google Scholar]
- 4.Scherzinger E, Lurz R, Turmaine M, Mangiarini L, Hollenbach B, Hasenbank R, Bates GP, Davies SW, Lehrach H, and Wanker EE (1997). Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell 90, 549–558. [DOI] [PubMed] [Google Scholar]
- 5.Vonsattel JP, Keller C, and Cortes Ramirez EP (2011). Huntington's disease - neuropathology. Handb Clin Neurol 100, 83–100. 10.1016/B978-0-444-52014-2.00004-5. [DOI] [PubMed] [Google Scholar]
- 6.Duyao M, Ambrose C, Myers R, Novelletto A, Persichetti F, Frontali M, Folstein S, Ross C, Franz M, Abbott M, and et al. (1993). Trinucleotide repeat length instability and age of onset in Huntington's disease. Nat Genet 4, 387–392. [DOI] [PubMed] [Google Scholar]
- 7.Genetic Modifiers of Huntington's Disease, C. (2015). Identification of Genetic Factors that Modify Clinical Onset of Huntington's Disease. Cell 162, 516–526. 10.1016/j.cell.2015.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Croce KR, and Yamamoto A (2021). Dissolving the Complex Role Aggregation Plays in Neurodegenerative Disease. Mov Disord 36, 1061–1069. 10.1002/mds.28522. [DOI] [PubMed] [Google Scholar]
- 9.Rogov V, Dotsch V, Johansen T, and Kirkin V (2014). Interactions between autophagy receptors and ubiquitin-like proteins form the molecular basis for selective autophagy. Mol Cell 53, 167–178. 10.1016/j.molcel.2013.12.014. [DOI] [PubMed] [Google Scholar]
- 10.Gubas A, and Dikic I (2022). A guide to the regulation of selective autophagy receptors. FEBS J 289, 75–89. 10.1111/febs.15824. [DOI] [PubMed] [Google Scholar]
- 11.Griffey CJ, and Yamamoto A (2022). Macroautophagy in CNS health and disease. Nat Rev Neurosci 23, 411–427. 10.1038/s41583-022-00588-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Fecto F, Yan J, Vemula SP, Liu E, Yang Y, Chen W, Zheng JG, Shi Y, Siddique N, Arrat H, et al. (2011). SQSTM1 mutations in familial and sporadic amyotrophic lateral sclerosis. Arch Neurol 68, 1440–1446. 10.1001/archneurol.2011.250. [DOI] [PubMed] [Google Scholar]
- 13.Goode A, Butler K, Long J, Cavey J, Scott D, Shaw B, Sollenberger J, Gell C, Johansen T, Oldham NJ, et al. (2016). Defective recognition of LC3B by mutant SQSTM1/p62 implicates impairment of autophagy as a pathogenic mechanism in ALS-FTLD. Autophagy 12, 1094–1104. 10.1080/15548627.2016.1170257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Maruyama H, Morino H, Ito H, Izumi Y, Kato H, Watanabe Y, Kinoshita Y, Kamada M, Nodera H, Suzuki H, et al. (2010). Mutations of optineurin in amyotrophic lateral sclerosis. Nature 465, 223–226. 10.1038/nature08971. [DOI] [PubMed] [Google Scholar]
- 15.Rubino E, Rainero I, Chio A, Rogaeva E, Galimberti D, Fenoglio P, Grinberg Y, Isaia G, Calvo A, Gentile S, et al. (2012). SQSTM1 mutations in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Neurology 79, 1556–1562. 10.1212/WNL.0b013e31826e25df. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Pensato V, Magri S, Bella ED, Tannorella P, Bersano E, Soraru G, Gatti M, Ticozzi N, Taroni F, Lauria G, et al. (2020). Sorting Rare ALS Genetic Variants by Targeted Re-Sequencing Panel in Italian Patients: OPTN, VCP, and SQSTM1 Variants Account for 3% of Rare Genetic Forms. J Clin Med 9. 10.3390/jcm9020412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Rezaie T, Child A, Hitchings R, Brice G, Miller L, Coca-Prados M, Heon E, Krupin T, Ritch R, Kreutzer D, et al. (2002). Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science 295, 1077–1079. 10.1126/science.1066901295/5557/1077 [pii]. [DOI] [PubMed] [Google Scholar]
- 18.Hiruma Y, Kurihara N, Subler MA, Zhou H, Boykin CS, Zhang H, Ishizuka S, Dempster DW, Roodman GD, and Windle JJ (2008). A SQSTM1/p62 mutation linked to Pageťs disease increases the osteoclastogenic potential of the bone microenvironment. Hum Mol Genet 17, 3708–3719. 10.1093/hmg/ddn266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gusella JF, Wexler NS, Conneally PM, Naylor SL, Anderson MA, Tanzi RE, Watkins PC, Ottina K, Wallace MR, Sakaguchi AY, and et al. (1983). A polymorphic DNA marker genetically linked to Huntington's disease. Nature 306, 234–238. 10.1038/306234a0. [DOI] [PubMed] [Google Scholar]
- 20.Gayan J, Brocklebank D, Andresen JM, Alkorta-Aranburu G, Group, U.S.-V.C.R., Zameel Cader M, Roberts SA, Cherny SS, Wexler NS, Cardon LR, and Housman DE (2008). Genomewide linkage scan reveals novel loci modifying age of onset of Huntington's disease in the Venezuelan HD kindreds. Genet Epidemiol 32, 445–453. 10.1002/gepi.20317. [DOI] [PubMed] [Google Scholar]
- 21.McCoy MJ, and Fire AZ (2024). Parallel gene size and isoform expansion of ancient neuronal genes. Curr Biol 34, 1635–1645 e1633. 10.1016/j.cub.2024.02.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Dragich JM, Kuwajima T, Hirose-Ikeda M, Yoon MS, Eenjes E, Bosco JR, Fox LM, Lystad AH, Oo TF, Yarygina O, et al. (2016). Autophagy linked FYVE (Alfy/WDFY3) is required for establishing neuronal connectivity in the mammalian brain. Elife 5. 10.7554/eLife.14810. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Menalled LB, Sison JD, Dragatsis I, Zeitlin S, and Chesselet MF (2003). Time course of early motor and neuropathological anomalies in a knock-in mouse model of Huntington's disease with 140 CAG repeats. J Comp Neurol 465, 11–26. 10.1002/cne.10776. [DOI] [PubMed] [Google Scholar]
- 24.Menalled L, El-Khodor BF, Patry M, Suarez-Farinas M, Orenstein SJ, Zahasky B, Leahy C, Wheeler V, Yang XW, MacDonald M, et al. (2009). Systematic behavioral evaluation of Huntington's disease transgenic and knock-in mouse models. Neurobiol Dis 35, 319–336. 10.1016/j.nbd.2009.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Langfelder P, Cantle JP, Chatzopoulou D, Wang N, Gao F, Al-Ramahi I, Lu XH, Ramos EM, El-Zein K, Zhao Y, et al. (2016). Integrated genomics and proteomics define huntingtin CAG length-dependent networks in mice. Nat Neurosci 19, 623–633. 10.1038/nn.4256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sapp E, Kegel KB, Aronin N, Hashikawa T, Uchiyama Y, Tohyama K, Bhide PG, Vonsattel JP, and DiFiglia M (2001). Early and progressive accumulation of reactive microglia in the Huntington disease brain. J Neuropathol Exp Neurol 60, 161–172. [DOI] [PubMed] [Google Scholar]
- 27.Vonsattel JP, Myers RH, Stevens TJ, Ferrante RJ, Bird ED, and Richardson EP Jr. (1985). Neuropathological classification of Huntington's disease. J Neuropathol Exp Neurol 44, 559–577. [DOI] [PubMed] [Google Scholar]
- 28.Ullah F, Liang H, Niedermayer G, Munch G, and Gyengesi E (2020). Evaluation of Phytosomal Curcumin as an Anti-inflammatory Agent for Chronic Glial Activation in the GFAP-IL6 Mouse Model. Front Neurosci 14, 170. 10.3389/fnins.2020.00170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Maras PM, Hebda-Bauer EK, Hagenauer MH, Hilde KL, Blandino P Jr., Watson SJ Jr., and Akil H (2022). Differences in microglia morphological profiles reflect divergent emotional temperaments: insights from a selective breeding model. Transl Psychiatry 12, 105. 10.1038/s41398-022-01821-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Perkins AE, Piazza MK, and Deak T (2018). Stereological Analysis of Microglia in Aged Male and Female Fischer 344 Rats in Socially Relevant Brain Regions. Neuroscience 377, 40–52. 10.1016/j.neuroscience.2018.02.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Precious SV, Kelly CM, Reddington AE, Vinh NN, Stickland RC, Pekarik V, Scherf C, Jeyasingham R, Glasbey J, Holeiter M, et al. (2016). FoxP1 marks medium spiny neurons from precursors to maturity and is required for their differentiation. Exp Neurol 282, 9–18. 10.1016/j.expneurol.2016.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Filimonenko M, Isakson P, Finley KD, Anderson M, Jeong H, Melia TJ, Bartlett BJ, Myers KM, Birkeland HC, Lamark T, et al. (2010). The selective macroautophagic degradation of aggregated proteins requires the PI3P-binding protein Alfy. Mol Cell 38, 265–279. 10.1016/j.molcel.2010.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Eenjes E, Dragich JM, Kampinga HH, and Yamamoto A (2016). Distinguishing aggregate formation and aggregate clearance using cell-based assays. J Cell Sci 129, 1260–1270. 10.1242/jcs.179978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Fox LM, Kim K, Johnson CW, Chen S, Croce KR, Victor MB, Eenjes E, Bosco JR, Randolph LK, Dragatsis I, et al. (2020). Huntington's Disease Pathogenesis Is Modified In Vivo by Alfy/Wdfy3 and Selective Macroautophagy. Neuron 105, 813–821.e816. 10.1016/j.neuron.2019.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Isakson P, Holland P, and Simonsen A (2013). The role of ALFY in selective autophagy. Cell Death Differ 20, 12–20. 10.1038/cdd.2012.66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Yamamoto A, and Simonsen A (2011). Alfy-dependent elimination of aggregated proteins by macroautophagy: can there be too much of a good thing? Autophagy 7, 346–350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Clausen TH, Lamark T, Isakson P, Finley K, Larsen KB, Brech A, Overvatn A, Stenmark H, Bjorkoy G, Simonsen A, and Johansen T (2010). p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy 6, 330–344. 10.4161/auto.6.3.11226. [DOI] [PubMed] [Google Scholar]
- 38.Lystad AH, Ichimura Y, Takagi K, Yang Y, Pankiv S, Kanegae Y, Kageyama S, Suzuki M, Saito I, Mizushima T, et al. (2014). Structural determinants in GABARAP required for the selective binding and recruitment of ALFY to LC3B-positive structures. EMBO Rep 15, 557–565. 10.1002/embr.201338003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Reinhart EF, Litt NA, Katzenell S, Pellegrini M, Yamamoto A, and Ragusa MJ (2021). A highly conserved glutamic acid in ALFY inhibits membrane binding to aid in aggregate clearance. Traffic 22, 23–37. 10.1111/tra.12771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, Ronneberger O, Willmore L, Ballard AJ, Bambrick J, et al. (2024). Addendum: Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 636, E4. 10.1038/s41586-024-08416-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, Ronneberger O, Willmore L, Ballard AJ, Bambrick J, et al. (2024). Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630, 493–500. 10.1038/s41586-024-07487-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Eenjes E, Dragich JM, Kampinga HH, and Yamamoto A (2016). Distinguishing aggregate formation and aggregate clearance using cell based assays. J Cell Sci. 10.1242/jcs.179978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Yamamoto A, Cremona ML, and Rothman JE (2006). Autophagy-mediated clearance of huntingtin aggregates triggered by the insulin-signaling pathway. J Cell Biol 172, 719–731. 10.1083/jcb.200510065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Ratnadiwakara M, and Anko ML (2018). mRNA Stability Assay Using transcription inhibition by Actinomycin D in Mouse Pluripotent Stem Cells. Bio Protoc 8, e3072. 10.21769/BioProtoc.3072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Ratnadiwakara M, Archer SK, Dent CI, Ruiz De Los Mozos I, Beilharz TH, Knaupp AS, Nefzger CM, Polo JM, and Anko ML (2018). SRSF3 promotes pluripotency through Nanog mRNA export and coordination of the pluripotency gene expression program. Elife 7. 10.7554/eLife.37419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Orosco LA, Ross AP, Cates SL, Scott SE, Wu D, Sohn J, Pleasure D, Pleasure SJ, Adamopoulos IE, and Zarbalis KS (2014). Loss of Wdfy3 in mice alters cerebral cortical neurogenesis reflecting aspects of the autism pathology. Nat Commun 5, 4692. 10.1038/ncomms5692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Schulte J, and Littleton JT (2011). The biological function of the Huntingtin protein and its relevance to Huntington's Disease pathology. Curr Trends Neurol 5, 65–78. [PMC free article] [PubMed] [Google Scholar]
- 48.McAdam RL, Morton A, Gordon SL, Alterman JF, Khvorova A, Cousin MA, and Smillie KJ (2020). Loss of huntingtin function slows synaptic vesicle endocytosis in striatal neurons from the htt(Q140/Q140) mouse model of Huntington's disease. Neurobiol Dis 134, 104637. 10.1016/j.nbd.2019.104637. [DOI] [PubMed] [Google Scholar]
- 49.Schilling G, Becher MW, Sharp AH, Jinnah HA, Duan K, Kotzuk JA, Slunt HH, Ratovitski T, Cooper JK, Jenkins NA, et al. (1999). Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Hum Mol Genet 8, 397–407. [DOI] [PubMed] [Google Scholar]
- 50.Ehrnhoefer DE, Butland SL, Pouladi MA, and Hayden MR (2009). Mouse models of Huntington disease: variations on a theme. Dis Model Mech 2, 123–129. 10.1242/dmm.002451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Han H, Wei W, Duan W, Guo Y, Li Y, Wang J, Bi Y, and Li C (2015). Autophagy-linked FYVE protein (Alfy) promotes autophagic removal of misfolded proteins involved in amyotrophic lateral sclerosis (ALS). In Vitro Cell Dev Biol Anim 51, 249–263. 10.1007/s11626-014-9832-4. [DOI] [PubMed] [Google Scholar]
- 52.Isakson P, Lystad AH, Breen K, Koster G, Stenmark H, and Simonsen A (2013). TRAF6 mediates ubiquitination of KIF23/MKLP1 and is required for midbody ring degradation by selective autophagy. Autophagy 9, 1955–1964. [DOI] [PubMed] [Google Scholar]
- 53.Kadir R, Harel T, Markus B, Perez Y, Bakhrat A, Cohen I, Volodarsky M, Feintsein-Linial M, Chervinski E, Zlotogora J, et al. (2016). ALFY-Controlled DVL3 Autophagy Regulates Wnt Signaling, Determining Human Brain Size. PLoS Genet 12, e1005919. 10.1371/journal.pgen.1005919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Kog S., Sekiy H., Kondr N., Ros OA., and Dickso DW. (2021). Neuropathology and molecular diagnosis of Synucleinopathies. Mol Neurodegener 16, 83. 10.1186/s13024-021-00501-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Luk KC, Kehm V, Carroll J, Zhang B, O'Brien P, Trojanowski JQ, and Lee VM (2012). Pathological alpha-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338, 949–953. 10.1126/science.1227157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Paumier KL, Luk KC, Manfredsson FP, Kanaan NM, Lipton JW, Collier TJ, Steece-Collier K, Kemp CJ, Celano S, Schulz E, et al. (2015). Intrastriatal injection of pre-formed mouse alpha-synuclein fibrils into rats triggers alpha-synuclein pathology and bilateral nigrostriatal degeneration. Neurobiol Dis 82, 185–199. 10.1016/j.nbd.2015.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Peelaerts W, Bousset L, Van der Perren A, Moskalyuk A, Pulizzi R, Giugliano M, Van den Haute C, Melki R, and Baekelandt V (2015). alpha-Synuclein strains cause distinct synucleinopathies after local and systemic administration. Nature 522, 340–344. 10.1038/nature14547. [DOI] [PubMed] [Google Scholar]
- 58.Jucker M, and Walker LC (2013). Self-propagation of pathogenic protein aggregates in neurodegenerative diseases. Nature 501, 45–51. 10.1038/nature12481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Henrich MT, Geibl FF, Lakshminarasimhan H, Stegmann A, Giasson BI, Mao X, Dawson VL, Dawson TM, Oertel WH, and Surmeier DJ (2020). Determinants of seeding and spreading of alpha-synuclein pathology in the brain. Sci Adv 6. 10.1126/sciadv.abc2487. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Dadgar-Kiani E, Bieri G, Melki R, Gitler AD, and Lee JH (2022). Mesoscale connections and gene expression empower whole-brain modeling of alpha-synuclein spread, aggregation, and decay dynamics. Cell Rep 41, 111631. 10.1016/j.celrep.2022.111631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Alquezar C, Arya S, and Kao AW (2020). Tau Post-translational Modifications: Dynamic Transformers of Tau Function, Degradation, and Aggregation. Front Neurol 11, 595532. 10.3389/fneur.2020.595532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Yoshiyama Y, Higuchi M, Zhang B, Huang SM, Iwata N, Saido TC, Maeda J, Suhara T, Trojanowski JQ, and Lee VM (2007). Synapse loss and microglial activation precede tangles in a P301S tauopathy mouse model. Neuron 53, 337–351. S0896–6273(07)00030-X [pii] 10.1016/j.neuron.2007.01.010. [DOI] [PubMed] [Google Scholar]
- 63.Sperfeld AD, Collatz MB, Baier H, Palmbach M, Storch A, Schwarz J, Tatsch K, Reske S, Joosse M, Heutink P, and Ludolph AC (1999). FTDP-17: an early-onset phenotype with parkinsonism and epileptic seizures caused by a novel mutation. Ann Neurol 46, 708–715. 10.1002/1531-8249(199911)46:5<708::aid-ana5>3.0.co;2-k. [DOI] [PubMed] [Google Scholar]
- 64.Goodwin LO, Splinter E, Davis TL, Urban R, He H, Braun RE, Chesler EJ, Kumar V, van Min M, Ndukum J, et al. (2019). Large-scale discovery of mouse transgenic integration sites reveals frequent structural variation and insertional mutagenesis. Genome Res 29, 494–505. 10.1101/gr.233866.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Yang S, Cacquevel M, Saksida LM, Bussey TJ, Schneider BL, Aebischer P, Melani R, Pizzorusso T, Fawcett JW, and Spillantini MG (2015). Perineuronal net digestion with chondroitinase restores memory in mice with tau pathology. Exp Neurol 265, 48–58. 10.1016/j.expneurol.2014.11.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Culver BP, Savas JN, Park SK, Choi JH, Zheng S, Zeitlin SO, Yates JR 3rd, and Tanese N (2012). Proteomic analysis of wild-type and mutant huntingtin-associated proteins in mouse brains identifies unique interactions and involvement in protein synthesis. J Biol Chem 287, 21599–21614. 10.1074/jbc.M112.359307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Yang J, Hao X, Cao X, Liu B, and Nystrom T (2016). Spatial sequestration and detoxification of Huntingtin by the ribosome quality control complex. Elife 5. 10.7554/eLife.11792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Tauber E, Miller-Fleming L, Mason RP, Kwan W, Clapp J, Butler NJ, Outeiro TF, Muchowski PJ, and Giorgini F (2011). Functional gene expression profiling in yeast implicates translational dysfunction in mutant huntingtin toxicity. J Biol Chem 286, 410–419. 10.1074/jbc.M110.101527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Hosp F, Gutierrez-Angel S, Schaefer MH, Cox J, Meissner F, Hipp MS, Hartl FU, Klein R, Dudanova I, and Mann M (2017). Spatiotemporal Proteomic Profiling of Huntington's Disease Inclusions Reveals Widespread Loss of Protein Function. Cell Rep 21, 2291–2303. 10.1016/j.celrep.2017.10.097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Moily NS, Ormsby AR, Stojilovic A, Ramdzan YM, Diesch J, Hannan RD, Zajac MS, Hannan AJ, Oshlack A, and Hatters DM (2017). Transcriptional profiles for distinct aggregation states of mutant Huntingtin exon 1 protein unmask new Huntington's disease pathways. Mol Cell Neurosci 83, 103–112. 10.1016/j.mcn.2017.07.004. [DOI] [PubMed] [Google Scholar]
- 71.Yablonska S, Ganesan V, Ferrando LM, Kim J, Pyzel A, Baranova OV, Khattar NK, Larkin TM, Baranov SV, Chen N, et al. (2019). Mutant huntingtin disrupts mitochondrial proteostasis by interacting with TIM23. Proc Natl Acad Sci U S A 116, 16593–16602. 10.1073/pnas.1904101116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Joag H, Ghatpande V, Desai M, Sarkar M, Raina A, Shinde M, Chitale R, Deo A, Bose T, and Majumdar A (2020). A role of cellular translation regulation associated with toxic Huntingtin protein. Cell Mol Life Sci 77, 3657–3670. 10.1007/s00018-019-03392-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Khan MR, Yin X, Kang SU, Mitra J, Wang H, Ryu T, Brahmachari S, Karuppagounder SS, Kimura Y, Jhaldiyal A, et al. (2023). Enhanced mTORC1 signaling and protein synthesis in pathologic alpha-synuclein cellular and animal models of Parkinson's disease. Sci Transl Med 15, eadd0499. 10.1126/scitranslmed.add0499. [DOI] [PubMed] [Google Scholar]
- 74.Flinkman D, Hong Y, Gnjatovic J, Deshpande P, Ortutay Z, Peltonen S, Kaasinen V, James P, and Coffey E (2023). Regulators of proteostasis are translationally repressed in fibroblasts from patients with sporadic and LRRK2-G2019S Parkinson's disease. NPJ Parkinsons Dis 9, 20. 10.1038/s41531-023-00460-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Capon F, Allen MH, Ameen M, Burden AD, Tillman D, Barker JN, and Trembath RC (2004). A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups. Hum Mol Genet 13, 2361–2368. 10.1093/hmg/ddh273. [DOI] [PubMed] [Google Scholar]
- 76.Burd CG, and Dreyfuss G (1994). Conserved structures and diversity of functions of RNA-binding proteins. Science 265, 615–621. 10.1126/science.8036511. [DOI] [PubMed] [Google Scholar]
- 77.Gerstberger S, Hafner M, and Tuschl T (2014). A census of human RNA-binding proteins. Nat Rev Genet 15, 829–845. 10.1038/nrg3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.King IF, Yandava CN, Mabb AM, Hsiao JS, Huang HS, Pearson BL, Calabrese JM, Starmer J, Parker JS, Magnuson T, et al. (2013). Topoisomerases facilitate transcription of long genes linked to autism. Nature 501, 58–62. 10.1038/nature12504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Iossifov I, O'Roak BJ, Sanders SJ, Ronemus M, Krumm N, Levy D, Stessman HA, Witherspoon KT, Vives L, Patterson KE, et al. (2014). The contribution of de novo coding mutations to autism spectrum disorder. Nature 515, 216–221. 10.1038/nature13908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Iossifov I, Ronemus M, Levy D, Wang Z, Hakker I, Rosenbaum J, Yamrom B, Lee YH, Narzisi G, Leotta A, et al. (2012). De novo gene disruptions in children on the autistic spectrum. Neuron 74, 285–299. 10.1016/j.neuron.2012.04.009 S0896–6273(12)00340–6 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Wang T, Guo H, Xiong B, Stessman HA, Wu H, Coe BP, Turner TN, Liu Y, Zhao W, Hoekzema K, et al. (2016). De novo genic mutations among a Chinese autism spectrum disorder cohort. Nat Commun 7, 13316. 10.1038/ncomms13316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Yamamuro T, Kawabata T, Fukuhara A, Saita S, Nakamura S, Takeshita H, Fujiwara M, Enokidani Y, Yoshida G, Tabata K, et al. (2020). Age-dependent loss of adipose Rubicon promotes metabolic disorders via excess autophagy. Nat Commun 11, 4150. 10.1038/s41467-020-17985-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Sandri M (2013). Protein breakdown in muscle wasting: role of autophagy-lysosome and ubiquitin-proteasome. Int J Biochem Cell Biol 45, 2121–2129. 10.1016/j.biocel.2013.04.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Abudu YP, Pankiv S, Mathai BJ, Lamark T, Johansen T, and Simonsen A (2019). NIPSNAP1 and NIPSNAP2 act as “eat me” signals to allow sustained recruitment of autophagy receptors during mitophagy. Autophagy 15, 1845–1847. 10.1080/15548627.2019.1637642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Shi J, Wu X, Wang Z, Li F, Meng Y, Moore RM, Cui J, Xue C, Croce KR, Yurdagul A Jr., et al. (2022). A genome-wide CRISPR screen identifies WDFY3 as a regulator of macrophage efferocytosis. Nat Commun 13, 7929. 10.1038/s41467-022-35604-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Pankiv S, Dahl AK, Aas A, Andersen RL, Brech A, Holland P, Singh S, Bindesboll C, and Simonsen A (2024). BEACH domain proteins function as cargo-sorting adaptors in secretory and endocytic pathways. J Cell Biol 223. 10.1083/jcb.202408173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Marti E (2016). RNA toxicity induced by expanded CAG repeats in Huntington's disease. Brain Pathol 26, 779–786. 10.1111/bpa.12427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Tsoi H, Lau TC, Tsang SY, Lau KF, and Chan HY (2012). CAG expansion induces nucleolar stress in polyglutamine diseases. Proc Natl Acad Sci U S A 109, 13428–13433. 10.1073/pnas.1204089109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Martin-Solana E, Diaz-Lopez I, Mohamedi Y, Ventoso I, Fernandez JJ, and Fernandez-Fernandez MR (2024). Progressive alterations in polysomal architecture and activation of ribosome stalling relief factors in a mouse model of Huntington's disease. Neurobiol Dis 195, 106488. 10.1016/j.nbd.2024.106488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Subramaniam S (2021). Ribosome traffic jam in neurodegeneration: decoding hurdles in Huntington disease. Cell Stress 5, 86–88. 10.15698/cst2021.06.251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Evans HT, Taylor D, Kneynsberg A, Bodea LG, and Gotz J (2021). Altered ribosomal function and protein synthesis caused by tau. Acta Neuropathol Commun 9, 110. 10.1186/s40478-021-01208-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Koren SA, Galvis-Escobar S, and Abisambra JF (2020). Tau-mediated dysregulation of RNA: Evidence for a common molecular mechanism of toxicity in frontotemporal dementia and other tauopathies. Neurobiol Dis 141, 104939. 10.1016/j.nbd.2020.104939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Choi I, Zhang Y, Seegobin SP, Pruvost M, Wang Q, Purtell K, Zhang B, and Yue Z (2020). Microglia clear neuron-released alpha-synuclein via selective autophagy and prevent neurodegeneration. Nat Commun 11, 1386. 10.1038/s41467-020-15119-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Wexler NS, Lorimer J, Porter J, Gomez F, Moskowitz C, Shackell E, Marder K, Penchaszadeh G, Roberts SA, Gayan J, et al. (2004). Venezuelan kindreds reveal that genetic and environmental factors modulate Huntington's disease age of onset. Proc Natl Acad Sci U S A 101, 3498–3503. 10.1073/pnas.0308679101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Andresen JM, Gayan J, Djousse L, Roberts S, Brocklebank D, Cherny SS, Group, U.S.-V.C.R., Group, H.M.C.R., Cardon LR, Gusella JF, et al. (2007). The relationship between CAG repeat length and age of onset differs for Huntington's disease patients with juvenile onset or adult onset. Ann Hum Genet 71, 295–301. 10.1111/j.1469-1809.2006.00335.x. [DOI] [PubMed] [Google Scholar]
- 96.Andresen JM, Gayan J, Cherny SS, Brocklebank D, Alkorta-Aranburu G, Addis EA, Group, U.S.-V.C.R., Cardon LR, Housman DE, and Wexler NS (2007). Replication of twelve association studies for Huntington's disease residual age of onset in large Venezuelan kindreds. J Med Genet 44, 44–50. 10.1136/jmg.2006.045153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Zhou W, Nielsen JB, Fritsche LG, Dey R, Gabrielsen ME, Wolford BN, LeFaive J, VandeHaar P, Gagliano SA, Gifford A, et al. (2018). Efficiently controlling for case-control imbalance and sample relatedness in large-scale genetic association studies. Nat Genet 50, 1335–1341. 10.1038/s41588-018-0184-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Keum JW, Shin A, Gillis T, Mysore JS, Abu Elneel K, Lucente D, Hadzi T, Holmans P, Jones L, Orth M, et al. (2016). The HTT CAG-Expansion Mutation Determines Age at Death but Not Disease Duration in Huntington Disease. Am J Hum Genet 98, 287–298. 10.1016/j.ajhg.2015.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Bieri G, Brahic M, Bousset L, Couthouis J, Kramer NJ, Ma R, Nakayama L, Monbureau M, Defensor E, Schule B, et al. (2019). LRRK2 modifies alpha-syn pathology and spread in mouse models and human neurons. Acta Neuropathol 137, 961–980. 10.1007/s00401-019-01995-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Polinski NK, Volpicelli-Daley LA, Sortwell CE, Luk KC, Cremades N, Gottler LM, Froula J, Duffy MF, Lee VMY, Martinez TN, and Dave KD (2018). Best Practices for Generating and Using Alpha-Synuclein Pre-Formed Fibrils to Model Parkinson's Disease in Rodents. J Parkinsons Dis 8, 303–322. 10.3233/JPD-171248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Eenjes E, Yang-Klingler YJ, and Yamamoto A (2019). Monitoring Aggregate Clearance and Formation in Cell-Based Assays. Methods Mol Biol 1873, 157–169. 10.1007/978-1-4939-8820-4_9. [DOI] [PubMed] [Google Scholar]
- 102.Huynh HT, Shcherbinina E, Huang HC, Rezaei R, and Sarshad AA (2024). Biochemical Separation of Cytoplasmic and Nuclear Fraction for Downstream Molecular Analysis. Curr Protoc 4, e1042. 10.1002/cpz1.1042. [DOI] [PubMed] [Google Scholar]
- 103.Faul F, Erdfelder E, Buchner A, and Lang AG (2009). Statistical power analyses using G*Power 3.1: tests for correlation and regression analyses. Behav Res Methods 41, 1149–1160. 10.3758/BRM.41.4.1149. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S1: Significant variants in linkage disequilibrium in the WDFY3 locus, related to Figure 1A. Excel spreadsheet indicating output from SNPEff, which was used to generate annotation for each SNP with added columns for GWA statistics and variant to protein prediction algorithms (SIFT, CADD, PolyPhen2)
Table S3: DEG lists (FDR < 0.10) are related to Figures 5A, B and C. Excel Spreadsheet with complete DEGs from respective comparisons from Q140 mice.
Table S4: GO Analysis Gene IDs, Increased Expression, as related to Figures. 5D and E. Excel spreadsheet with gene lists representing DEGs that showed increased expression
Table S5: GO Analysis Gene IDs, Decreased Expression, as related to Figures. 5F and G. Excel spreadsheet with gene lists representing DEGs that showed decreased expression
Table S6: Significant Rescue genes (FDR < 0.10) as related to Figure 6 and 7. Excel spreadsheet of genes showing a change in direction upon expression of Alfy (eg Gene whose expression is increased in a WT vs Q140 comparison becomes decreased in a Q140 vs Q140+Alfy comparison)
Table S7: Significant Exacerbate genes (FDR < 0.10) as related to Figure 6 and 7. Excel spreadsheet of genes showing a further enhancement of direction upon expression of Alfy
Table S8: NYBB cohort used for genotyping for presence of Alfy variant, as related to STAR METHODS as related to Figure 2. Excel spreadsheet indicating age, sex, PMI of samples used. Those samples used for subsequent analysis as indicated in Figure 2 are indicated.
Data Availability Statement
The RNA sequencing datasets generated during the current study have been made immediately available in the Gene Expression Omnibus (GEO), GSE281823. No new code has been generated as part of this publication. Any additional information required to reanalyze the data reported in this work paper is available from the Lead Contact upon request.
