Skip to main content
NCBI home page
Nature Portfolio logoLink to Nature Portfolio
. 2025 May 27;30(10):4677–4689. doi: 10.1038/s41380-025-03061-6

A neural substrate of comorbid depressive symptoms in alcohol use

Zhenlei Chen 1,#, Shangchen Yang 1,#, Lige Leng 1,2,3,✉,#, Jinjun Ding 4, Ziqi Yuan 1, Kai Zhuang 1, Dan Can 1, Tingting Zou 1, Ya Wang 1, Huifang Li 1, Ti-Fei Yuan 4,5,✉, Jie Zhang 1,3,6,7,✉
PMCID: PMC12436194  PMID: 40425852

Abstract

Alcohol use disorder (AUD) is commonly associated with depression, which may exacerbate the clinical outcome and increase treatment difficulty. The neural substrates underlying such comorbid symptoms are unclear. Here, we identify the regulatory role of amygdala Menin (multiple endocrine neoplasia type 1) signaling in orchestrating local GABAergic inhibition, which modulates the emotional state following alcohol use. Alcohol intake reduces Menin expression in the amygdala, decreasing GAT1 transcription. Restoring Menin signaling or overexpressing GAT1 in the amygdala could suppress alcohol preference and prevent depressive-like behaviors in these animals. Notably, knocking-in mice expressing a human MEN1 variant (Menin-G503D) that associates with MDD exhibit strong alcohol preference. These findings uncover a previously unknown mechanism for a common clinical element of alcohol addiction and point to a novel candidate therapeutic target against depression.

Subject terms: Neuroscience, Psychology, Cell biology, Molecular biology

Introduction

Alcohol use disorder (AUD) frequently accompanies depressive symptoms, mutually rendering patients more difficult to treat and resulting in more severe clinical outcomes (e.g., suicidal ideas and attempts) [1–3]. The co-occurrence of these disorders is associated with greater severity and worse prognosis than either disorder alone [4]. Particularly, depressive symptoms lead to increased frequency of drinking and higher levels of relapse [2, 4–7]. The neural mechanisms underlying these comorbidities remain unelucidated, hindering the development of effective treatments.

Neuroimaging studies reported structural changes (e.g., volume reduction) in the amygdala, ventral striatum, medial prefrontal cortex, anterior cingulate cortex, ventrolateral prefrontal cortex, and dorsolateral prefrontal cortex in depression [8–11]. At the same time, AUD patients exhibited volume loss in the amygdala, ventral striatum, hippocampus, frontal lobes, and cerebellum [1, 12, 13]. Among these overlapping brain regions, the amygdala has been well implicated as a common neural substrate in both depression and AUD. Accumulating evidence suggests an important role for synaptic transmission in the amygdala in mediating alcohol-related behaviors and neuroadaptive mechanisms associated with alcohol dependence through GABA-ergic systems [14–22]. Meanwhile, the modulation of the amygdala network via GABA-ergic interneurons has been shown to control the depression-like behaviors [23–25]. Notably, the local inhibitory system helps to reduce sensitization of alcohol on amygdaloid synaptic activity, maintains basal synaptic activity, and regulates amygdala functioning [1, 26]. The GABA levels in the amygdala set the threshold to choose alcohol over natural reward [27, 28], which produces the alcohol sensitivity and are cleared by GABA transporters (GATs). These findings therefore emphasize the potential therapeutic importance of regulating the amygdala GABA-ergic system in treating comorbidities of AUD and depression.

Multiple endocrine neoplasia type 1 (MEN1) gene in humans (Men1 in mice) encodes a scaffold protein: Menin. We previously identified that carriers of the MEN1 SNP rs375804228 (a coding mutation conferring G503D) are associated with a higher risk of MDD onset [29]. As a nuclear scaffold protein, Menin can, through epigenetic mechanisms, positively or negatively regulate gene expression and interact with several proteins with diverse functions [30]. It has been proved that Menin regulates spinal GABA functioning [31]. It is unclear if Menin can regulate local inhibition in the amygdala and contribute to AUD comorbidity with depression.

The present study firstly aims to characterize the impact of alcohol intake on depressive-like behaviors and Menin expression in the brain. We then investigate the effects of Menin deletion on alcohol intake. For mechanistic exploration, we examine the potential regulation of Menin on GABA-ergic system functioning and microcircuits in the amygdala. We further examine the alcohol intake in mice with MEN1 SNP rs375804228 (G503D), a risk gene for MDD onset in humans [29]. These results shall provide evidence linking amygdala Menin deficiency to AUD and depression comorbidity, and aid in the development of targeted therapies.

Materials and methods

Animals

Mice were housed under a 12 h light/dark cycle with free access to standard rodent chow and water. Each cage housed a maximum of four mice. Mice were maintained under specific-pathogen-free SPF conditions and were not subject to immune suppression. The health of the animals used was regularly controlled by animal caretakers. All mice used in the study were not previously involved in other experimental procedures, and were drug/test naïve. 2-month-old litter/age-matched mice were randomly assigned to experimental groups. Animals were used according to “3Rs” principles (Replacement, Reduction, and Refinement) in all experimental procedures.

Menin(G503D) Knock-in mice were created as a C57BL/6J mouse model with a point mutation (G503D) at the mouse Men1 locus by CRISPR/Cas-mediated genome engineering from Cyagen Biosciences (Suzhou, China). The G503 is located on exon 10, which was selected as the target site. gRNA targeting vector and donor oligo (with targeting sequence, flanked by 120 bp homologous sequences combined on both sides). The G503D (GGC to GAC) mutation sites in the donor oligo were introduced into exon 10 by homology-directed repair. Cas9 mRNA, gRNA generated by in vitro transcription, and donor oligo were co-injected into fertilized eggs for KI mouse production. The pups will be genotyped by PCR followed by sequence analysis. gRNA1 (matches forward strand of gene): TTGGACAAGGGCCCGGGCTCAGG. Donor oligo sequence: CCCCGAAGAGAGTCCAAGCCTGAGGAGCCACCACCACCCAAGAAGCCTGCATTGGACAAGGACCCGGGCTCAGGACAAAGTGCAGGGTCGGGACCACCTAGGAAAACGTCAGGGACTGTCCCA. The target region of the mouse Men1 locus was amplified by PCR with specific primers.

The floxed Men1mouse strain (Men1F/F) was provided by Dr. Guanghui Jin and Dr. Xianxin Hua [32].

Experimental design

All experiments described in this study were performed on a minimum of 3 mice or 3 independent experiments. To determine the required sample size of mice for the experiment, we first established low- and high-alcohol preference groups in 60 male mice through voluntary alcohol drinking. We then calculated the effect size (d) for the parameters of these two groups. Using a significance level (α) of 1.96 and a power (1-β) of 0.84 for a two-tailed test, we calculated the sample size of mice required for our experiment. The specific calculation formula is as follows:

graphic file with name 41380_2025_3061_Figa_HTML.gif

Voluntary alcohol drinking model

At 2 months of age, mice were singly housed in non-ventilated standardized Plexiglas mouse cages with corncob bedding and nesting material. On the first day of single-housing, mice were exposed to two 50 mL conical tubes (Fisher Scientific) filled with water and fitted with rubber stoppers with a metal ball bearing sipper tube (Ancare Corporation) for up to 4 days of acclimation. Following acclimation, the experimental mice were weighed. Then, one conical tube was filled with a 10% EtOH (Sigma) v/v solution, weighed, and placed next to the subsequently weighed water conical tube for continuous access. Bottle tubes were measured every day and interchanged every day to prevent side preference. After 2, 8, and 14 days of exposure to a choice between 10% EtOH v/v and water, the mice were weighed. Each day of the 14 days, both tubes were weighed and placed in the cage. Individual alcohol drinking behaviors were determined. Mice were maintained on a choice of 10% EtOH v/v and water until killing. Tubes were refilled accordingly, and bottle sides were switched every 2 days once alcohol drinking behaviors were determined. Food was provided ad libitum throughout the alcohol drinking paradigm. EtOH preference (%) was determined as ((EtOH intake/total fluid intake) × 100). EtOH consumed was determined as g of EtOH according to its concentration/mouse weight across a 24-h period. Low alcohol drinking mice are defined as an EtOH preference of <40% and consume <10 g/kg EtOH over 24 h (g/kg per 24 h). High alcohol drinking mice are defined as an EtOH preference of >60% and consume >10 g/kg EtOH over 24 h (g/kg per 24 h). Mice were excluded if they showed an initial high preference for alcohol followed by a significant reduction in drinking behavior.

Forced alcohol exposure model

Alcohol exposure was conducted by intraperitoneal injections of ethanol at a dose of 3 g/kg once a day for seven or fourteen consecutive days. Ethanol (459836, Sigma, Shanghai, China) was dissolved in sterile normal saline at 37.5% concentration (v/v).

Lipopolysaccharide (LPS)-Induced Mouse Model

Male C57BL6/J mice (2 months) were intraperitoneally injected with LPS (Sigma, L‐2880) dissolved in sterile 0.9% saline at 0.5 mg/kg. Saline or LPS injection was administered between 09:00 and 09:30 a.m. daily for 7 days. Behavioral tests were performed 24 h following the last injection.

Stereotactic Injection of Adeno-Associated Virus

rAAV-vGAT1-CRE-mCherry-WPRE-hGH-polyA (AAV9, virus titer: 2.96 × 1012/Ml, 0.2 ul), rAAV-EF1α-DIO-EYFP-WPRE-hGH-polyA (AAV2/9, virus titer: 5.32 × 1012/mL, 0.2 ul), rAAV-EF1α-DIO-Men1-EYFP-WPRE-hGH-polyA (AAV2/9, virus titer: 5.15 × 1012/mL, 0.2 ul), rAAV-CMV-EGFP-WPRE-polyA (AAV2/9, virus titer: 2.32 × 1012/mL, 0.2 ul), rAAV-CMV-Slc6a1-EGFP-WPRE-polyA (AAV2/9, virus titer: 2.78 × 1012/mL, 0.2 ul), rAAV-CaMKIIa-EGFP-P2A-CRE-WPRE-hGH-polyA (AAV9, virus titer: 2.00 × 1012/mL, 0.2 ul) were purchased from BrainVTA (Wuhan, China). Packaged viruses were stereotactically injected into the bilateral BLA of control mice or Men1F/F mice, respectively. Coordinates for BLA were adjusted from Paxinos and Franklin (AP: −1.1, ML: ± 3.0, DV: 4.7). To confirm region-specific knockdown of Men1 in mouse brains, mice were anesthetized and sacrificed 1 month after injection, whereupon brain tissues were rapidly removed and analyzed using histological immunofluorescence staining.

Chromatin immunoprecipitation (ChIP)

ChIP procedures were performed following the manufacturer’s instructions (17-295; Millipore). Briefly, primary neurons from Ctrl and NcKO mice (dissected at E16.5) were cultured for 8–12 days and fixed for 10 min at room temperature with media containing 1% formaldehyde and quenched with 125 mM glycine for 5 min. Fixed homogenates were washed twice using ice-cold PBS containing protease inhibitors. Fixed nuclei were pelleted at 4 min at 2000 rpm and re-suspended in SDS Lysis Buffer (catalog #20-163), where chromatin was sheared using a SCIENTZ ultrasonic apparatus set to 28% power for 14 cycles of a 4.5 s sonication and a 9.0 s resting stage on ice. The sonicated cell supernatant was diluted 10-fold in ChIP dilution buffer (catalog #20-153) and pre-cleared using protein A Agarose/Salmon Sperm DNA (catalog #16-157). After brief centrifugation, ChIP was performed using 3 mg Menin antibody (A300-105A; Bethyl), or normal rabbit IgG (H2615; Santa Cruz) antibody incubated overnight, followed by enrichment using protein A Sepharose beads for 4 h. Beads were washed three times with four different buffers (low-salt immune complex wash buffer, high-salt immune complex wash buffer, and LiCl immune complex wash buffer) and one wash with TE (50 mM Tris HCl, 10 mM EDTA). Chromatin was eluted by agitation at 65 °C for 20 min in TES (TE plus 1% SDS) and reverse crosslinked overnight at 65 °C. Chromatin was subjected to RNase and Proteinase K treatment, followed by DNA purification by phenol-chloroform extraction and ethanol precipitation. DNA pellets were resuspended in 10 mM Tris and subjected to qPCR (480; Roche).

Behavioral studies

The forced swim test (FST) was used to assess depressive-like behavior. Mice were placed in a container filled with water that eventually resulted in immobility, reflecting behavioral despair. Water (23 ± 1 °C) was placed in a transparent acrylic cylinder bath (10 cm in diameter, 20 cm in height) filled to a depth of 13 cm. Mice were placed in the water for six minutes using a video tracking system (Smart 3.0); immobility duration (%) within the final 5 min of testing was recorded.

The tail-suspension test was used to assess the efficacy of antidepressants in mice. Mice were suspended by their tails from an acrylic bar (15 cm in diameter, 30 cm in height) for six minutes and monitored using a video tracking system (Smart 3.0). Escape-related behavior was assessed, where immobility duration (%) during the 6-min suspension period was recorded.

For the Sucrose Preference Test (SPT) and Sucrose Consumption Test(SCT), animals were first trained to consume a 1% sucrose solution from two differing bottles (48 h before the formal experiment). Twenty-four hours later, the animals were allowed free access to 1% sucrose and water from two different bottles. To avoid bottle side preference, the two bottles were switched. The amounts in the two bottles were measured after 24 h, and sucrose preference was calculated according to the following formula: Sucrose preferences (%) = sucrose consumption/ (sucrose + water consumption) × 100%.

RNA-sequencing analysis

The amygdala of high alcohol drinking and low alcohol drinking mice was harvested. Isolated RNA was subsequently used for RNA-seq analysis. cDNA library construction and sequencing were performed by the Beijing Novogene Corporation using the Illumina platform. High-quality reads were aligned to the mouse reference genome using Bowtie2. Expression levels for each of the genes were normalized to fragments per kilobase of exon model per million mapped reads (FPKM) using RNA-seq by Expectation Maximization (RSEM). We identified DEGs (differentially expressed genes) between samples and performed clustering analysis and functional annotation. Genes with ≥2-fold change and false discovery rates (FDR) of ≤0.001 were considered to be statistically significant. Pathways overrepresented by DEGs were annotated in the KEGG (Kyoto Encyclopedia of Genes and Genomes) database.

We collected data from multiple depression-related databases to create a more comprehensive set of differentially expressed genes (DEGs) associated with depression. However, the overlap between these datasets was minimal, highlighting the limitations of single-source data. To address this, we employed a strategy of merging information from multiple databases (GSE81761; GSE54564; GSE44593; GSE53987; GSE223430; GSE181285). This approach ultimately yielded a more robust and informative set of depression-related DEGs.

Statistical analysis

All data presented are expressed as arithmetic mean ± SEM. All statistical analyses were performed using GraphPad Prism version 5.0. Null hypotheses were rejected at p values equal to or higher than 0.05. For statistical comparisons between two groups, we first performed a Shapiro-Wilk normality test (Prism) to determine whether the data were likely normally distributed. Statistically significant differences between groups were determined using one-way ANOVA. In evaluating multiple comparisons, Bonferroni(≤4 groups)/Tukey’s correction (>4 groups) methods were used to adjust p values accordingly to lower the probability of type I errors.

Statistical significance was evaluated by one-way ANOVA with Holm-Sidak pair-wise tests. Values of p < 0.05 were considered statistically significant. DNASTAR Laser gene software (version 7.1) was used to analyze Sanger sequencing data.

Study approval

All mice were maintained within the core animal facility at Xiamen University, and all experimental procedures involved were performed according to protocols approved by the Institutional Animal Care and Use Committee at Xiamen University. The approval number of the protocol is XMULAC20190144. We also abide by the provisions of the Biosafety Law of the People’s Republic of China, the Regulations on the Administration of Experimental Animals, the National Standards for Experimental Animals (GB14925-2010), the Guidelines for Ethical Review of the Welfare of Experimental Animals (GBT 35892–2018), and the relevant rules and regulations formulated by Xiamen University.

Additional materials and methods can be found in the Supplementary Materials.

Results

Alcohol preference associates with depression-like behaviors in isogenic mice

We utilized a continuous access (24 h) two-bottle-choice alcohol-drinking paradigm to identify individual drinking preference (low and high alcohol preference) of C57BL/6J mice, as previously described [33] (Fig. 1A). Specifically, 8-week-old C57BL/6J mice were allowed to voluntarily consume water or alcohol maintained at a constant concentration (10% v/v EtOH) for 14 days. The experimental mice were then maintained on this two-bottle choice of water or 10% EtOH. Alcohol drinking behaviors, as identified via the alcohol drinking paradigm, revealed that EtOH preference and intake behaviors changed throughout the drinking experiment and stabilized by the 14th day (Fig. S1A, B). Using this voluntary alcohol-drinking paradigm, we generated two alcohol-drinking groups that displayed stable individual differences in EtOH preference and intake behaviors. Mice with high-alcohol-drinking behavior showed both an EtOH preference >60% and consumption rates >10 g/kg EtOH through 24 h, while mice with low-alcohol-drinking behavior showed both an EtOH preference of 40% and a consumption rate <10 g/kg EtOH through 24 h. Among the C57BL/6J male mice, 23.33% were classified as high-alcohol-drinking mice compared to 26.67% in the low-alcohol-drinking mice (Fig. 1B). Conversely, in female C57BL/6J mice, the high-alcohol-drinking mice comprised 37.5% of the population compared to 27.5% in the low-alcohol-drinking mice (Fig. 1K). The low-alcohol-drinking mice showed a significantly lower alcohol preference and alcohol intake than the high-alcohol-drinking mice (Figs. 1C, L; S2M). We then analyzed the depression-like behaviors of the two alcohol intake exposure groups using a combination of the tail suspension test (TST) [34], forced swimming test (FST) [35], sucrose preference test (SPT), and sucrose consumption test (SCT) [36]. We found that in both male and female mice, depression-like behaviors were significantly aggravated in the high alcohol preference group (Fig. 1D–I, M–R). Furthermore, we found no significant sex differences in either alcohol preference or depressive-like behaviors (S-Fig. 1C–F).

Fig. 1. Alcohol preference accelerates the acquisition of depression-like behaviors in isogenic mice.

Fig. 1

Open in a new tab

A Schematic representation of the individual EtOH preference experiment. B-S Alcohol preference ratios and depression-like phenotypes in homozygous C57BL/6J male and female mice. Individual EtOH preference maps were recorded for different drinking paradigm days, and the data were for EtOH preference for 14 days of 10% EtOH. Mice were grouped according to the individual distribution of alcohol (B, K). Proportion of alcohol preference in homozygous C57BL/6 J male and female mice (C, L). Depression-like phenotypes of low and high alcohol preference mice were verified by tail suspension test (TST) (D, M), forced swimming tests (FSTs) (E, N), sucrose consumption tests (SCTs) (F, O) and sucrose preference tests (SPTs) (G, P). Comparison of behavioral tests in low-drinking and high-drinking mice. The mean value of the control group was used as the standard. One point was awarded for each criterion if it was above the standard for the TST or FST, or below the standard for the SPT or SCT. Ratios of low and high drinking mice at zero (D0), one (D1), two (D2), three (D3), or four (D4) behavioral criteria are shown in panels (H-I, Q-R). The 2 × 2 factorial analysis was employed to investigate the relationship between alcohol preference and depressive phenotype (J, S). Mouse number obtained in individual alcohol preferences and used in the depressive-like behaviors: Male: Low alcohol drinking: n = 16 mice, High alcohol drinking: n = 14 mice. Female: Low alcohol drinking: n = 11 mice, High alcohol drinking: n = 15 mice. Data represent mean ± SEM, n.s.: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA with Tukey’s post hoc analysis.

To validate the relationship between depression and alcohol preference, high and low alcohol preference were compared with non-depressive and depressive-like phenotypes using a fully factorial 2 ×2 study design. By Fisher’s exact analysis, we found a strong correlation between alcohol preference and depressive-like behavior in both male and female mice (Fig. 1J, S).

Besides, we constructed the LPS-induced depressive mouse model (Fig. S2A–E). As expected, we found that the LPS-induced depressive mice also exhibit high alcohol preference (Fig. S2F–I). This experiment further strengthens the correlation between high alcohol preference with depressive-like behaviors (Fig. S2L).

Menin deficiency in the interneurons of the BLA leads to alcohol preference and depression-like behaviors

We then performed next-generation sequencing to identify differentially expressed genes (DEGs) in the amygdala of the low- and high-alcohol-drinking mice (Fig. S3A–C). To explore the mechanisms underlying the depression and AUD comorbidities, we analyzed the expression of the DEGs that overlapped with the expression of depression-related genes. Interestingly, MEN1 was identified as one of the common DEGs, which is of particular interest to us (Fig. S3D). Given our previous findings that MEN1 is closely associated with depression in both mice and humans [29, 37]. We therefore measured both the protein and mRNA levels of Menin in the amygdala and found that they both were decreased in the high-alcohol-drinking group (Figs. S3E–I; S10).

We employed another model of forced alcohol exposure via i.p. injection and found that this also results in depression-like phenotypes in a certain percentage of animals (susceptible group versus resilient group). We measured the FST and TST behavior of these animals and added the immobility times of each mouse from these two tests to define susceptible and resilient mice (Figs. S3J–L, 3P–S), and the expression level of Menin in the amygdala of the susceptible mice was found to be significantly decreased (Figs. S3M–O, 3T–V). These data confirmed the emergence of a depression-like phenotype accompanied by reduced Menin expression after alcohol exposure.

We further investigate the function of Menin in the amygdala. To this end, rAAV-CamKII-Cre-mCherry-WPRE-pA virus was injected into the BLA of 2-month-old Men1F/F mice to knock down Men1 in the excitatory neurons of the BLA; these constituted the AAV-CamKII-Cre-Men1F/F (CamKII-cre mediated Men1 knockdown) group (Figs. 2A; S4A, B). rAAV-vGAT1-Cre-mCherry-WPRE-pA virus was injected into the BLA of 2-month-old Men1F/F mice to knockdown Men1 in interneurons of the BLA, and these mice constituted the AAV-vGAT1-Cre-Men1F/F (vGAT1-cre mediated Men1 knockdown) group (Figs. 2C, S5A, C).

Fig. 2. Menin deficiency in the interneurons of the BLA leads to alcohol preference and depression-like behaviors.

Fig. 2

Open in a new tab

A Schematic diagram of knockdown of Men1 in excitatory neurons in the amygdala by AAV-CamKII-cre in Men1F/F mice and control mice. B Proportion of alcohol preference in AAV-CamKII-cre mice and AAV-CamKII-cre-Men1F/F mice. C Schematic diagram of knockdown of Men1 in interneurons in the amygdala by AAV-vGAT1-cre in Men1F/F mice and control mice. D Proportion of alcohol preference in AAV-vGAT1-Cre mice and AAV-vGAT1-Cre-Men1F/F mice. E-H Depressive-like phenotypes in these models were validated by forced swimming tests (FSTs) (E), tail suspension tests (TST) (F), sucrose preference tests (SPTs), and sucrose consumption tests (SCTs) (G, H). I-L Comparisons of behavioral tests in the low and high alcohol drinking group of AAV-vGAT1-Cre mice and AAV-vGAT1-Cre-Men1F/F mice. The mean of the control group was used as the criterion. Each point will be obtained if it is higher than the criterion in TST and FST, or lower than the criterion in SPT and SCT. The ratio of low and high alcohol drinking groups of AAV-vGAT1-Cre mice and AAV-vGAT1-Cre-Men1F/F mice for zero (D0), one (D1), two (D2), three (D3), or four(D4) behavioral criteria is shown in panel (I-L). Mouse number obtained in individual alcohol preferences: AAV-CamKII-Cre mice: low alcohol drinking: n = 9 mice, high alcohol drinking: n = 6 mice. AAV-CamKII-Cre-Men1F/F mice: low alcohol drinking: n = 10 mice, high alcohol drinking: n = 6 mice. Mouse number obtained in individual alcohol preferences and used in the depressive-like behaviors: AAV-vGAT1-Cre mice: low alcohol drinking: n = 14 mice, high alcohol drinking: n = 16 mice. AAV-vGAT1-Cre-Men1F/F mice: low alcohol drinking: n = 11 mice, high alcohol drinking: n = 19 mice. Data represent mean ± SEM, n.s.: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, two-way ANOVA with Tukey’s post hoc analysis.

Based on the alcohol preference data collected over the last five days, mice were classified as a high-preference group if their preference for alcohol exceeded 50% on at least three of those days. We found that knocking down Menin in interneurons of the BLA led to high levels of alcohol consumption (Figs. 2D; S5D–F, 5G–J), while the knockdown of Menin in excitatory neurons of the BLA did not cause significant changes in the alcohol consumption of the mice (Figs. 2B; S4C–E, 4F–I). GAT1 expression was also decreased with Menin knockdown (Fig. S5B, C). Menin deficiency in interneurons in the BLA aggravated the depression-like behaviors in the high-alcohol-drinking mice (Figs. 2E–L; S5K–N, 5O–R), while the knockdown of Menin in excitatory neurons of the BLA did not cause significant changes in the depression-like behaviors (Fig. S4I–M). These results indicate that the BLA interneuron Menin deficiency may be involved in the regulation of AUD and depression comorbidities.

Menin regulates Slc6a1 transcription by binding to its promoter region

GABA transporters (GATs) are required for GABA clearance and implicated in alcohol abuse [27]. It has also been previously shown that Menin regulates the level of GABA [31]. As a scaffold protein, Menin contributes to the epigenomic modulation of gene expression. We hypothesized that Menin may regulate the level of GABA transporters through epigenetic mechanisms, thereby participating in GABA clearance. We first measured the changes in the expression of all GABA transporters in the low- and high-drinking mice and found that, among all these transporters, the level of GAT1 Slc6a1) showed the most significant changes (Fig. 3A).

Fig. 3. Menin regulates Slc6a1 transcription by binding to its promoter region.

Fig. 3

Open in a new tab

A The mRNA levels of Slc6a1, Slc6a11, Slc6a12, and Slc6a13 in the amygdala of low alcohol drinking mice and high alcohol drinking mice were detected by real-time PCR. n = 3 experimental replicates/group. B-C Menin and GAT1 protein expression is significantly decreased in primary neurons of Nestin-Cre- Men1F/F (NCKO) mice and Nestin-Cre- Men1F/+ (NCKD) mice compared with control mice. Representative blots are shown in panel (B); Quantification of relative protein level is shown in (C). n = 3 independent experiments. Actin serves as a loading control. D Quantitative RT-PCR measurements to determine men1 levels. n = 6 independent experiments. E-F Menin/Slc6a1 interactions were measured in N2A cells by endogenous co-immunoprecipitation (coIP). n = 3 independent experiments. G ChIP assays using antibodies against Menin were performed in N2A cells. n = 3 independent experiments. H-I Slc6a1-mediated transactivation in N2A cells transfected with plasmid constructs as indicated. n = 3 independent experiments. J-K Representative amygdala brain slices from low alcohol drinking mice and high alcohol drinking mice were stained with GAT1 (green) antibody. The section was counterstained with DAPI (blue). Scale bar, 100μm. Staining intensity is quantified as shown in the panels (K). n = 3 mice. L-M Western blot analysis of GAT1 expression in the amygdala of low alcohol preference mice and high alcohol preference mice. Quantification of protein levels is shown in (M), n = 3 mice. Actin plays a controlling role. N-O Western blot analysis of GAT1 expression in the amygdala of resilient and susceptible mice. Quantification of protein levels is shown in (O), n = 3 mice. Actin plays a controlling role. P Real-time PCR test detected mRNA levels of Slc6a1 in the amygdala of resilient and susceptible mice. n = 3 mice. Q-R Representative tonic GABA currents revealed by rapid application of GABAA-R blocker bicuculline (100 μM) in BLA (Q). Summarized data of tonic GABA current in BLA. Data represent mean ± SEM, n.s.: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA with Tukey’s post hoc analysis.

After knocking out Menin, the expression of GAT1 decreased (Fig. 3B–D), while the overexpression of Menin increased GAT1 levels (Fig. 3E, F). Menin-ChIP assays demonstrated direct binding of Menin to the Slc6a1 promoter region (Fig. 3G). We measured Slc6a1 luciferase reporter activity in Menin knockdown or overexpression, and observed a significant decrease and increase in Slc6a1-mediated transactivation, respectively (Fig. 3H, I). These results all suggest that Menin promotes Slc6a1 activation through its association with the Slc6a1 promoter region. We then measured the protein and mRNA levels of GAT1 in the amygdala and found that both the protein and mRNA levels of GAT1 decreased in the high-alcohol-drinking group and depression-susceptible mice (Fig. 3J–P).

To establish whether Menin, by regulating GAT1, can affect changes in GABA tonic current in the amygdala, we performed slice electrophysiological tonic GABA recording. We found that the tonic GABA currents and sIPSC amplitudes were significantly increased if Menin is knockdown by injection AAV-vGAT1-Cre virus in Men1F/F mice compared to control mice. The restoration of GAT1 expression by injection of AAV-EGFP-GAT1 in the BLA of Menin knockdown mice abolished these effects (Fig. 3Q–R). These results provide further evidence that Menin can influence GABAergic tonic by modulating GAT1 expression.

Overexpression of Menin suppresses alcohol preference and depression-like behaviors, which were abolished by a GAT1 inhibitor

To further clarify the BLA Menin-GAT1 signaling pathway in the pathogenic underlying AUD and depression, we overexpressed Menin in the BLA, and performed treatment with the GAT1 inhibitor ethyl nipecotate (Figs. 4A; S6A–F). After the 14-day voluntary alcohol intake exposure, we found that overexpression of Menin in the amygdala led to low-alcohol-intake behaviors, but this effect was abolished by ethyl nipecotate via i.p. injection (Figs. 4B, C; S6G–J). Moreover, overexpression of Menin in the amygdala alleviated depression-like behaviors in high-alcohol-drinking mice, and this effect was abolished by administering a GAT1 inhibitor (Fig. 4D–O). These data suggest that the Menin-GAT1 pathway in the BLA orchestrates both alcohol-intake behaviors and depressive behaviors.

Fig. 4. Overexpression of Menin in the interneurons of the BLA suppresses alcohol preference and depression-like behaviors, which were abolished by a GAT1 inhibitor.

Fig. 4

Open in a new tab

A Schematic diagram of overexpression of Men1 by AAV in Men1F/F mice and control mice, and GAT1 inhibitor ethyl nipecotate administration (100 mg/kg/day) for 14 days. B Individual distribution for 14 days of alcohol self-administration. C Proportion of alcohol preference in AAV-EGFP mice and AAV-EGFP: Menin mice with or without intraperitoneal injection of GAT1 inhibitor ethyl nipecotate. D-G Depressive-like phenotypes in these models were validated by forced swimming tests (FSTs) (D), tail suspension tests (TST) (E), sucrose preference tests (SPTs), and sucrose consumption tests (SCTs) (F-G). H-O Comparisons of behavioral tests in the low and high alcohol drinking group of AAV-EGFP mice and AAV-EGFP: Menin mice with or without intraperitoneal injection of ethyl nipecotate. The mean of the control group was used as the criterion. Each point will be obtained if it is higher than the criterion in TST and FST, or lower than the criterion in SPT and SCT. The ratio of low and high alcohol drinking group of AAV-EGFP mice and AAV-EGFP: Menin mice with or without intraperitoneal injection of ethyl nipecotate for zero (D0), one (D1), two (D2), three (D3) or four(D4) behavioral criteria are shown in panel (H-O). Mouse number obtained in individual alcohol preferences and used in the depressive-like behaviors: Without the intraperitoneal injection of GAT1 inhibitor. AAV-EGFP mice: low alcohol drinking: n = 16 mice, high alcohol drinking: n = 14 mice. AAV-EGFP: Menin: low alcohol drinking: n = 16 mice, high alcohol drinking: n = 10 mice. With intraperitoneal injection of GAT1 inhibitor. AAV-EGFP mice: low alcohol drinking: n = 11 mice, high alcohol drinking: n = 19 mice. AAV-EGFP: Menin: low alcohol drinking: n = 14 mice, high alcohol drinking: n = 12 mice. Data represent mean ± SEM, n.s.: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA with Tukey’s post hoc analysis.

Restoring GAT1 in the interneurons in the BLA of Menin-deficient mice reduced alcohol preference and depression-like behaviors

To determine whether activating the Menin-GAT1 pathway rescues alcohol preference and depression-like behaviors, we injected AAV-EGFP-Slc6a1 virus into the BLA of AAV-vGAT1-cre Men1F/F mice (Figs. 5A; S7A–D). After the 14-day voluntary alcohol intake exposure, we found that overexpression of GAT1 in the amygdala of the AAV-vGAT1-cre Men1F/F mice resulted in a significant reduction in high-alcohol-drinking individuals in the population (Figs. 5B, C; S7E–G). In addition, GAT1 overexpression in the amygdala of the AAV-vGAT1-cre Men1F/F mice also led to diminished depression-like behaviors (Fig. 5D–M).

Fig. 5. Restoring GAT1 in the interneurons in the BLA of Menin-deficient mice rescues both alcohol preference and depression-like behaviors.

Fig. 5

Open in a new tab

A Schematic diagram of knockout of Men1 and overexpression of GAT1 by AAV-vGAT1-cre in Men1F/F mice and control mice. B Individual distribution for 14 days of alcohol self-administration. C Proportion of alcohol preference in AAV-vGAT1-Cre mice, AAV-vGAT1-Cre-Men1F/F mice, and AAV-vGAT1-Cre-Men1F/F + GFP: GAT1 mice. D-G Depressive-like phenotypes in these models were validated by forced swimming tests (FSTs) (D), tail suspension tests (TST) (E), sucrose preference tests (SPTs), and sucrose consumption tests (SCTs) (F-G). H-M Comparisons of behavioral tests in the low and high alcohol drinking group of AAV-vGAT1-Cre mice, AAV-vGAT1-Cre-Men1F/F mice, and AAV-vGAT1-Cre-Men1F/F + GFP: GAT1 mice. The Mean of the control group was used as the criterion. Each point will be obtained if it is higher than the criterion in TST and FST, or lower than the criterion in SPT and SCT. The ratio of low and high alcohol drinking groups of AAV-vGAT1-Cre mice, AAV-vGAT1-Cre-Men1F/F mice, and AAV-vGAT1-Cre-Men1F/F + GFP: GAT1 mice for zero (D0), one (D1), two (D2), three (D3), or four(D4) behavioral criteria is shown in panel (H-M). Mouse number obtained in individual alcohol preferences and used in the depressive-like behaviors: AAV-vGAT1-Cre mice: low alcohol drinking: n = 16 mice, high alcohol drinking: n = 14 mice. AAV-vGAT1-Cre-Men1F/F mice: low alcohol drinking: n = 9 mice, high alcohol drinking: n = 18 mice. AAV-vGAT1-Cre-Men1F/F + GFP: GAT1: low alcohol drinking: n = 14 mice, high alcohol drinking: n = 12 mice. Data represent mean ± SEM, n.s.: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA with Tukey’s post hoc analysis.

Menin-G503D mice exhibit both alcohol preference and depression-like behaviors

We previously identified that individuals carrying the MEN1 SNP rs375804228 (G503D) were at a higher risk of MDD onset [29]. We then created a mouse model with a point mutation (G503D) in the Men1 locus using CRISPR/Cas-mediated genome engineering. The brain morphology and sizes of the treated mice were indistinguishable from those of the control mice (Fig. S8A–D). No significant difference in the expression of amygdala Menin was found between the G503D-mutant and control mice, while GAT1 expression in G503D-mutant mice was significantly reduced when compared to that in the control mice (Fig. S8D–F). After a 14-day voluntary alcohol intake exposure (Figs. 6A, S9E–H), we found that G503D-mutant mice presented both depression-like phenotype and high alcohol preference (Fig. 6B–P). When exogenous GAT1 was expressed specifically in the interneurons in the BLA of the G503D-mutant mice using Cre recombinase-dependent GAT1-AAV (Fig. S9A–D), the manipulation abolished the effects of G503D on alcohol preference and depressive like behaviors (Fig. 6B–P).

Fig. 6. Menin-G503D mice exhibit both alcohol preference and depression-like behaviors, and overexpression of GAT1 in the BLA of Menin-G503D mice ameliorates the acquisition of both phenotypes.

Fig. 6

Open in a new tab

A Schematic diagram of overexpression of GAT1 by AAV-vGAT1-cre in G503D mice. B Individual distribution for days 14 of alcohol self-administration in AAV-vGAT1-Cre mice, AAV-vGAT1-cre G503D mice, AAV-vGAT1-cre-GAT1 mice, and AAV-vGAT1-cre-GAT1-G503D mice. C Proportion of alcohol preference in AAV-vGAT1-Cre mice, AAV-vGAT1-cre G503D mice, AAV-vGAT1-cre-GAT1 mice, and AAV-vGAT1-cre-GAT1-G503D mice. D-G Depressive-like phenotypes in these models were validated by forced swimming tests (FSTs) (D), tail suspension tests (TST) (E), sucrose preference tests (SPTs), and sucrose consumption tests (SCTs) (F-G). H-O Comparisons of behavioral tests in the low and high alcohol drinking group of AAV-vGAT1-Cre mice, AAV-vGAT1-cre G503D mice, AAV-vGAT1-cre-GAT1 mice, and AAV-vGAT1-cre-GAT1-G503D mice. The mean of the control group was used as the criterion. Each point will be obtained if it is higher than the criterion in TST and FST, or lower than the criterion in SPT and SCT. The ratio of low and high alcohol drinking groups of AAV-vGAT1-Cre+AAV-CMV-GFP mice, AAV-vGAT1-Cre+AAV-CMV-GFP-Men1F/F mice, and AAV-vGAT1-Cre+AAV-CMV-Slc6a1-GFP-Men1F/F mice for zero (D0), one (D1), two (D2), three (D3), or four(D4) behavioral criteria is shown in panel (H–P). Mouse number obtained in individual alcohol preferences and used in the depressive-like behaviors: AAV-vGAT1-Cre mice: low alcohol drinking: n = 5 mice, high alcohol drinking: n = 6 mice. AAV-vGAT1-cre G503D mice: low alcohol drinking: n = 5 mice, high alcohol drinking: n = 5 mice. AAV-vGAT1-cre-GAT1 mice: low alcohol drinking: n = 5 mice, high alcohol drinking: n = 9 mice. AAV-vGAT1-cre-GAT1-G503D mice: low alcohol drinking: n = 7 mice, high alcohol drinking: n = 7 mice. Data represent mean ± SEM, n.s.: not significant, *p < 0.05, **p < 0.01, ***p < 0.001, one-way ANOVA with Tukey’s post hoc analysis.

Discussion

The present study reports the central role of amygdala Menin signaling in regulating local inhibitory tone, which contributes to AUD and depression comorbidity. Amygdala Menin promotes GABA clearance by regulating Slc6a1 transcription, further inhibiting the onset of both AUD and depression. These results support the GABAergic pathogenicity hypothesis of AUD and depression, and point to amygdala Menin as a potential treatment target for the comorbidity of AUD and depression.

Men1 is located on human chromosome 11q13.1. To date, approximately 1500 MEN1 mutations have been reported in patients with endocrine disorders [29]. Menin consists of 610 residues and is conserved from Drosophila to humans, with tissue-specific function across different organs mediated via various distinct signaling pathways. Menin is a powerful epigenetic regulator of gene transcription and cell signaling [30]. It can interact with different proteins: transcription activators (MLL1 and PPAPγ) [30], transcription repressors (NF-κB, EZH2, JunD, and HDAC) [30, 38, 39], and cell signaling proteins (AKT, Smad1, Smad3, and Smad5) [30, 40], thereby playing different functions. We had previously found that Menin binds to the promoter region of p65 and inhibits its transcription [29]. It is plausible that Menin signaling contributes to activated Slc6a1 transcriptional activity. Small molecules targeting the Menin-GAT1 pathway and promoting GABA clearance are promising avenues toward treatment. These drugs not only may prevent the acquisition of an alcohol-preferring phenotype but might also be beneficial for the treatment of AUD, especially in individuals with MDD.

The study has several limitations. First, we did not distinguish in detail the kinds of interneurons that showed decreased Menin levels in the amygdala. The cellular heterogeneity of these interneurons is to be determined with different transgenic mouse lines. Second, the upstream regulator of Menin is unclear. Research shows that GLP-1 signaling-activated protein kinase A (PKA) directly phosphorylates Menin at the serine 487 residue, relieving Menin-mediated suppression of insulin expression and cell proliferation, while somatostatin stimulates Menin by suppressing PKA activity [41, 42]. Third, it will be important to identify the relevance of Menin and GAT1 changes in the postmortem brains of human patients, to obtain more direct evidence in clinical context.

In summary, we identified a neural substrate of comorbid depressive symptoms in alcohol use and point to the amygdala Menin as a possible treatment target for the comorbidity of AUD and depression.

Supplementary information

SUPPLEMENTAL MATERIAL (8.4MB, docx)

Acknowledgements

We thank Dr. Guanghui Jin and Dr. Xianxin Hua for providing the Men1F/F mice.

Author contributions

LL, TY, and JZ conceptualized the study and wrote the original draft. SY and TZ prepared and maintained the mice. LL, SY, HL, YW, DC, ZY, KZ, JD, and ZC designed and performed the morphological analysis and biochemical assays. LL and SY performed the behavior tests. LL, TY, and JZ supervised the project and contributed to writing—review & editing. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by the National Nature Science Foundation of China (Grant: U23A20430, 81925010, 91849205 and 92149303 to JZ; Grant: U24A20696, 82371566 and 82071520 to LL); The National Key Research and Development Program of China (Grant: 2021YFA1101402 to JZ); The Fundamental Research Funds for the Central Universities (Grant: 20720190118 and 20720180049 to JZ; Grant: 20720230065 to LL); The Opening Foundation of Key Laboratory of Neural and Vascular Biology, Ministry of Education of China (Grant: NV20230014 to LL).

Data availability

All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. The SRA accession number for RNA-seq data reported in this paper is: PRJNA784344 (SRR17060885- SRR17060890).

Competing interests

The authors declare no competing interest.

Ethics

All animal experiments were conducted in accordance with the guidelines set forth by the animal welfare committees at Xiamen University (approval numbers XMULAC20200054, XMULAC20190144, and XMULAC20190143).

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Zhenlei Chen, Shangchen Yang, Lige Leng.

Contributor Information

Lige Leng, Email: lenglige@xmu.edu.cn.

Ti-Fei Yuan, Email: ytf0707@126.com.

Jie Zhang, Email: jiezhang@xmu.edu.cn.

Supplementary information

The online version contains supplementary material available at 10.1038/s41380-025-03061-6.

References

  • 1.Carvalho AF, Heilig M, Perez A, Probst C, Rehm J. Alcohol use disorders. Lancet. 2019;394:781–92. [DOI] [PubMed] [Google Scholar]
  • 2.Grant BF, Stinson FS, Dawson DA, Chou SP, Dufour MC, Compton W, et al. Prevalence and co-occurrence of substance use disorders and independent mood and anxiety disorders - results from the National Epidemiologic Survey on Alcohol and Related Conditions (reprinted from Archives of General Phychiatry, vol 61, pg 807, 2004). Alcohol Res Health. 2006;29:107–20. [DOI] [PubMed] [Google Scholar]
  • 3.Whiteford HA, Degenhardt L, Rehm J, Baxter AJ, Ferrari AJ, Erskine HE, et al. Global burden of disease attributable to mental and substance use disorders: findings from the Global Burden of Disease Study 2010. Lancet. 2013;382:1575–86. [DOI] [PubMed] [Google Scholar]
  • 4.Hasin D, Liu X, Nunes E, McCloud S, Samet S, Endicott J. Effects of major depression on remission and relapse of substance dependence. Arch Gen Psychiatry. 2002;59:375–80. [DOI] [PubMed] [Google Scholar]
  • 5.Boden JM, Fergusson DM. Alcohol and depression. Addiction. 2011;106:906–14. [DOI] [PubMed] [Google Scholar]
  • 6.Boschloo L, Vogelzangs N, Smit JH, van den Brink W, Veltman DJ, Beekman AT, et al. Comorbidity and risk indicators for alcohol use disorders among persons with anxiety and/or depressive disorders: findings from the Netherlands Study of Depression and Anxiety (NESDA). J Affect Disord. 2011;131:233–42. [DOI] [PubMed] [Google Scholar]
  • 7.Flensborg-Madsen T. Alcohol use disorders and depression-the chicken or the egg? Addiction. 2011;106:916–8. [DOI] [PubMed] [Google Scholar]
  • 8.Kupfer DJ, Frank E, Phillips ML. Major depressive disorder: new clinical, neurobiological, and treatment perspectives. Lancet. 2012;379:1045–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kronenberg G, Tebartz van Elst L, Regen F, Deuschle M, Heuser I, Colla M. Reduced amygdala volume in newly admitted psychiatric in-patients with unipolar major depression. J Psychiatr Res. 2009;43:1112–7. [DOI] [PubMed] [Google Scholar]
  • 10.Dotson VM, Davatzikos C, Kraut MA, Resnick SM. Depressive symptoms and brain volumes in older adults: a longitudinal magnetic resonance imaging study. J Psychiatry Neurosci. 2009;34:367–75. [PMC free article] [PubMed] [Google Scholar]
  • 11.Fitzgerald PB, Laird AR, Maller J, Daskalakis ZJ. A meta-analytic study of changes in brain activation in depression. Hum Brain Mapp. 2008;29:683–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pfefferbaum A. Alcoholism damages the brain, but does moderate alcohol use? Lancet Neurol. 2004;3:143–4. [DOI] [PubMed] [Google Scholar]
  • 13.Mukamal KJ. Alcohol consumption and abnormalities of brain structure and vasculature. Am J Geriatr Cardiol. 2004;13:22–8. [DOI] [PubMed] [Google Scholar]
  • 14.Juarez B, Liu Y, Zhang L, Han MH. Optogenetic investigation of neural mechanisms for alcohol-use disorder. Alcohol. 2019;74:29–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kranzler HR, Koob G, Gastfriend DR, Swift RM, Willenbring ML. Advances in the pharmacotherapy of alcoholism: challenging misconceptions. Alcohol Clin Exp Res. 2006;30:272–81. [DOI] [PubMed] [Google Scholar]
  • 16.Stuber GD, Sparta DR, Stamatakis AM, van Leeuwen WA, Hardjoprajitno JE, Cho S, et al. Excitatory transmission from the amygdala to nucleus accumbens facilitates reward seeking. Nature. 2011;475:377–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Koob GF, Volkow ND. Neurobiology of addiction: a neurocircuitry analysis. Lancet Psychiatry. 2016;3:760–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Nie Z, Schweitzer P, Roberts AJ, Madamba SG, Moore SD, Siggins GR. Ethanol augments GABAergic transmission in the central amygdala via CRF1 receptors. Science. 2004;303:1512–4. [DOI] [PubMed] [Google Scholar]
  • 19.Pandey SC, Zhang H, Roy A, Xu T. Deficits in amygdaloid cAMP-responsive element-binding protein signaling play a role in genetic predisposition to anxiety and alcoholism. J Clin Invest. 2005;115:2762–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Roberto M, Cruz MT, Gilpin NW, Sabino V, Schweitzer P, Bajo M, et al. Corticotropin releasing factor-induced amygdala gamma-aminobutyric acid release plays a key role in alcohol dependence. Biol Psychiatry. 2010;67:831–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Roberto M, Madamba SG, Moore SD, Tallent MK, Siggins GR. Ethanol increases GABAergic transmission at both pre- and postsynaptic sites in rat central amygdala neurons. Proc Natl Acad Sci USA. 2003;100:2053–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Roberto M, Madamba SG, Stouffer DG, Parsons LH, Siggins GR. Increased GABA release in the central amygdala of ethanol-dependent rats. J Neurosci. 2004;24:10159–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ramirez S, Liu X, MacDonald CJ, Moffa A, Zhou J, Redondo RL, et al. Activating positive memory engrams suppresses depression-like behaviour. Nature. 2015;522:335–+. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tye KM, Prakash R, Kim SY, Fenno LE, Grosenick L, Zarabi H, et al. Amygdala circuitry mediating reversible and bidirectional control of anxiety. Nature. 2011;471:358–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhu X, Zhou W, Jin Y, Tang H, Cao P, Mao Y, et al. A central amygdala input to the parafascicular nucleus controls comorbid pain in depression. Cell Rep. 2019;29:3847–58.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Heilig M, Goldman D, Berrettini W, O’Brien CP. Pharmacogenetic approaches to the treatment of alcohol addiction. Nat Rev Neurosci. 2011;12:670–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Augier E, Barbier E, Dulman RS, Licheri V, Augier G, Domi E, et al. A molecular mechanism for choosing alcohol over an alternative reward. Science. 2018;360:1321–6. [DOI] [PubMed] [Google Scholar]
  • 28.Domi E, Xu L, Toivainen S, Nordeman A, Gobbo F, Venniro M, et al. A neural substrate of compulsive alcohol use. Sci Adv. 2021;7:eabg9045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Leng L, Zhuang K, Liu Z, Huang C, Gao Y, Chen G, et al. Menin deficiency leads to depressive-like behaviors in mice by modulating astrocyte-mediated neuroinflammation. Neuron. 2018;100:551–63 e7. [DOI] [PubMed] [Google Scholar]
  • 30.Matkar S, Thiel A, Hua X. Menin: a scaffold protein that controls gene expression and cell signaling. Trends Biochem Sci. 2013;38:394–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Shen X, Liu Y, Xu S, Zhao Q, Wu H, Guo X, et al. Menin regulates spinal glutamate-GABA balance through GAD65 contributing to neuropathic pain. Pharmacol Rep. 2014;66:49–55. [DOI] [PubMed] [Google Scholar]
  • 32.Crabtree JS, Scacheri PC, Ward JM, McNally SR, Swain GP, Montagna C, et al. Of mice and MEN1: insulinomas in a conditional mouse knockout. Mol Cell Biol. 2003;23:6075–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Juarez B, Morel C, Ku SM, Liu Y, Zhang H, Montgomery S, et al. Midbrain circuit regulation of individual alcohol drinking behaviors in mice. Nat Commun. 2017;8:2220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Can A, Dao DT, Terrillion CE, Piantadosi SC, Bhat S, Gould TD The tail suspension test. J Vis Exp. 2012;59:e3769. [DOI] [PMC free article] [PubMed]
  • 35.Chatterjee M, Jaiswal M, Palit G. Comparative evaluation of forced swim test and tail suspension test as models of negative symptom of schizophrenia in rodents. ISRN Psychiatry. 2012;2012:595141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gross M, Pinhasov A. Chronic mild stress in submissive mice: marked polydipsia and social avoidance without hedonic deficit in the sucrose preference test. Behav Brain Res. 2016;298:25–34. [DOI] [PubMed] [Google Scholar]
  • 37.Leng L, Zhuang K, Lin H, Ding J, Yang S, Yuan Z, et al. Menin Reduces Parvalbumin Expression and is Required for the Anti-Depressant Function of Ketamine. Adv Sci (Weinh). 2024;11:e2305659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Heppner C, Bilimoria KY, Agarwal SK, Kester M, Whitty LJ, Guru SC, et al. The tumor suppressor protein menin interacts with NF-kappaB proteins and inhibits NF-kappaB-mediated transactivation. Oncogene. 2001;20:4917–25. [DOI] [PubMed] [Google Scholar]
  • 39.Gang D, Hongwei H, Hedai L, Ming Z, Qian H, Zhijun L. The tumor suppressor protein menin inhibits NF-kappaB-mediated transactivation through recruitment of Sirt1 in hepatocellular carcinoma. Mol Biol Rep. 2013;40:2461–6. [DOI] [PubMed] [Google Scholar]
  • 40.Wang Y, Ozawa A, Zaman S, Prasad NB, Chandrasekharappa SC, Agarwal SK, et al. The tumor suppressor protein menin inhibits AKT activation by regulating its cellular localization. Cancer Res. 2011;71:371–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Xing B, Ma J, Jiang Z, Feng Z, Ling S, Szigety K, et al. GLP-1 signaling suppresses menin’s transcriptional block by phosphorylation in beta cells. J Cell Biol. 2019;218:855–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Mensah-Osman E, Zavros Y, Merchant JL. Somatostatin stimulates menin gene expression by inhibiting protein kinase A. Am J Physiol Gastrointest Liver Physiol. 2008;295:G843–54. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SUPPLEMENTAL MATERIAL (8.4MB, docx)

Data Availability Statement

All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. The SRA accession number for RNA-seq data reported in this paper is: PRJNA784344 (SRR17060885- SRR17060890).

Articles from Molecular Psychiatry are provided here courtesy of Nature Publishing Group

RESOURCES