Skip to main content
NCBI home page
Biochemistry Research International logoLink to Biochemistry Research International
. 2025 Sep 9;2025:8994730. doi: 10.1155/bri/8994730

The Antarctic Wintering Alters the Properties of Human Plasma Cell-Free DNA

Sergey Ponomarev 1,✉, Anastasia Kotikova 1,2, Nikolay Osetsky 1, Natalia Veiko 3, Elizaveta Ershova 3,4, Elena Malinovskaya 3,4, Ekaterina Savinova 5, Julia Chudakova 3,4, Julia Eliseeva 3, Vera Izhevskaia 3, Sergey Kutsev 3, Svetlana Kostyuk 3,4
PMCID: PMC12440658  PMID: 40963893

Abstract

Extracellular DNA of blood plasma (cell-free DNA, cfDNA) may potentially indicate a total level of apoptosis and mediate the immune response to stress induced by extreme environmental conditions, such as Antarctic wintering. We studied blood nuclease activity (NA); the content of 8-oxodG, rDNA, and SatIII(1q12) in cfDNA; and the levels of BAX, BCL2, TLR9, AIM2, STING, RIG-I, NF-kB, IL-8, and IL-17A mRNAs in 11 males, the members of the 64th Russian Antarctic Expedition. Blood was sampled before the wintering and on the 27th, 85th, 160th, 270th, and 315th days. The early months of the wintering are characterized by increased rates of apoptosis, an elevated BAX/BCL2 RNA ratio in blood leukocytes, and high cfDNA concentrations and NA in blood plasma. The properties of cfDNA are dramatically changed: the content of GC-rich rDNA rises, while AT-rich SatIII and 8-oxodG are low. We note individual multidirectional changes in the expression of TLR9 and AIM2, while STING and RIG-I are downregulated in all of the subjects. The mRNA levels of NFKB1, IL-8, and IL-17A increase dramatically, indicating immune system activation. In conclusion, (1) apoptosis is overactivated and remains elevated during the first half of the Antarctic wintering; (2) cfDNA is enriched with GC-repeats, which stimulates its biological activity; and (3) the expression of immunity genes associated with the inflammatory response is increased.

Keywords: cell-free DNA, confinement, rDNA, SatIII, TLR9, wintering

1. Introduction

Antarctic wintering can be considered a model of certain space flight factors. The Antarctic environment includes isolation, cold, low atmospheric pressure, UV radiation, an altered geomagnetic field, and circadian rhythm disruption. These significantly influence the physiological systems of the human body, inducing acute and chronic stress [1]. Members of Antarctic expeditions also suffer from emotional stress caused by physical confinement, social deprivation, and fear of the unknown [2].

Stress evokes two basic responses in the organism: adaptation and programmed cell death. We attempt to estimate the two processes by measuring apoptotic gene expression, cell-free DNA (cfDNA) and its properties, and immune gene expression.

The main executors of programmed cell death are the proteins of the BCL-2 family, namely, BAX and BCL-2. BAX codes for Bcl-2 associated X protein being the main activator of p53-mediated apoptosis [3], and BCL2 expresses B-cell lymphoma 2 protein being the key inhibitor of apoptosis [4]. Thus, the BAX/BCL2 mRNA ratio reflects the level of cell death in a cell population [5].

The DNA of dead cells enters the circulatory system forming the pool of cfDNA, which may be extracted from the blood plasma to assess apoptosis rates. It is widely used in clinical practice for diagnosis confirmation, disease prognosis, and medical observation. The concentration of cfDNA increases during sepsis, cancer, cardiovascular conditions, autoimmune reactions, and mental illnesses [6–15]. Pregnancy, physical activity, and psychosocial stress are also known to elevate cfDNA [16–20].

The increase in cfDNA is followed by the activation of blood nucleases, which cut it into fragments to be excreted with urine [21–24]. Because blood nuclease activity (NA) balances the concentration of cfDNA provided by cell death, we measure DNase I activity in the blood for a more appropriate estimation of apoptosis rates [13, 21, 25].

Some authors consider cfDNA not only as a diagnostic biomarker of pathology but also as a potential therapeutic target, for it demonstrates pronounced biological activity determined by its molecular characteristics distinct from those of the intracellular genomic DNA (gDNA) [6, 26–39]. Firstly, cfDNA is more oxidized than gDNA [13, 32, 36], which increases its ability to penetrate cell membranes [34, 40]. The fragments of cfDNA in cytoplasm may potentially induce the signaling pathways of nucleic acid sensing receptors discussed below. Secondly, the GC content in cfDNA significantly differs from that of gDNA [41]. In healthy donors, cfDNA extracted from blood plasma contains approximately 54% GC, compared to 42% GC in gDNA [42]. During pathologies or conditions accompanied by chronic oxidative stress, cfDNA consists predominantly of GC-rich DNA fragments such as mitochondrial DNA and ribosomal DNA (rDNA) [30, 43–47].

Immunity activation may be triggered by cfDNA through the activation of so-called DNA sensors: TLR9, AIM2, STING, and RIG-I. High GC content in cfDNA facilitates its binding to TLR9, which then induces an intracellular signaling cascade activating the transcription factor NF-kB. The latter is known to regulate the immune response, apoptosis, and cell cycle [48, 49]. Another innate immunity protein, AIM2, is a sensor of AT-rich double-stranded DNA in cytoplasm. The aberrant activation of AIM2 by cytoplasmic DNA is thought to be a motive force of inflammation [50–52]. In addition to TLR9 and AIM2, cGAS is able to bind cytosolic DNA, including cfDNA fragments which penetrated the cell, and to activate a pathway leading to interferon synthesis. A key protein in this pathway, STING, takes part in the activation of, among other proteins, NF-kB. DNA sensing through cGAS/STING is believed to have a key role in inflammation [53–55]. The RIG-I protein encoded by the DDX58 gene recognizes exogenic RNA molecules in cell cytoplasm. It interacts with the 5′-triphosphate on the nascent double-stranded RNA transcribed from AT-rich DNA by RNA polymerase III (PolIII) [56, 57]. When cfDNA penetrates the cell and is transcribed into dsRNAs, which are recognized by RIG-I, the induced signaling pathway leads to the expression of type-I interferons. Of note, the mediators in this signaling cascade, IRF3 and IRF7, interact with NF-kB in the nucleus [58].

Since the transcription factor NF-kB plays a substantial role in the signal transduction cascades from cfDNA to the cell nucleus leading to the synthesis of a vast spectrum of cytokines, its overexpression during stress conditions may be considered a major sign of immunity activation. Proinflammatory cytokines, such as IL-8 and IL-17, evidence inflammation.

Considering cfDNA as a main coordinator between apoptosis and adaptation to Antarctic conditions, we analyze its concentration, properties (oxidation and GC/AT content), and the nuclease activity (NA) in blood plasma of the members of a 1-year expedition at Vostok Station. We also compare these indices with the expression levels of the genes regulating apoptosis (BAX and BCL2), the genes of DNA sensors (TLR9, AIM2, STING, and RIG-I), and genes associated with proinflammatory NF-kB activity (NFKB1, IL8, and IL-17A) in blood leukocytes.

2. Materials and Methods

2.1. Experiment Design

The study was carried out during the 64th Russian Antarctic Expedition, which lasted from November 7, 2018, to June 6, 2020. Within this period, the participants of the expedition inhabited Vostok Station from February 7, 2019, to February 5, 2020 (Figure 1(a)). The study included male participants of the wintering (n = 11) aged from 32 to 64 (mean 49.7 ± 10.4 years). All participants were admitted by the medical expert commission and signed informed consent for participation in the study. The study was approved by the Bioethics Committee of SSC RF-IBMP RAS (protocol No 487 from October 11, 2018). The mean height and body mass were 174.3 ± 1.9 cm and 80.8 ± 2.9 kg, respectively. The physical activity of the expedition members during their stay at the station remained low during the whole wintering period, excluding the recurrent (1-2 times a week) snow stockpiling for the maintenance of the water supply of the station. The state of the participants remained satisfactory during the whole wintering period.

Figure 1.

Figure 1

Open in a new tab

Plasma cfDNA concentrations. (a) The overall plan of the 64th Russian Antarctic Expedition and the time intervals between the blood sampling time points. (b) The changes in the concentrations of cfDNA (CcfDNA) in the blood plasma of the expedition members during their stay at Vostok Station; b1—cfDNA concentrations in the blood samples of the subjects (1–11) at the indicated time points (mean values and SE); green columns indicate samples obtained before the arrival at the station (CA), yellow columns indicate samples obtained during polar day, and blue columns—samples obtained during polar night; b2—the analysis of the changes in blood CcfDNA of the subjects during their stay at Vostok Station (i) compared to control (CA); green cells—CcfDNA did not change (p > 0.05, U-test), brown cells—CcfDNA increased (p < 0.05), and blue cells—CcfDNA decreased (p < 0.05); b3—the analysis of the changes in blood CcfDNA of 10 subjects at the indicated time points; horizontal lines indicated medians (U-test); b4—the distribution of plasma CcfDNA samples from healthy male donors not subjected to extreme stress (control, C) and from the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test (D, α) and the Mann–Whitney U test (p).

The expedition doctor sampled blood from all the participants before their arrival at the station (samples CA, control) and at several time points during the wintering period (I-V). Samples I (6 Mar 2019), IV (5 Nov 2019), and V (18 Dec 2019) allow us to estimate the parameters during the conditions of the polar day, while samples II (3 May 2019) and III (16 July 2019) reflect the response to the polar night conditions.

Immediately after blood sampling, the plasma was fractionated from cells by centrifugation, and the erythrocytes were lysed and separated from white blood cells. The samples of both plasma and leukocyte mass were frozen. In total, 64 samples of blood plasma and 64 samples of leukocyte mass were analyzed upon delivery to Moscow. Two samples (time point V, participants #3 and #11) were not obtained for technical reasons.

The control group consisted of 95 healthy males (age 41 ± 15) with no history of any disorder or stress a month before blood sampling.

2.2. cfDNA Extraction and Measurement of Concentration

Phenol extraction with the prior hydrolysis of plasma and subsequent RNase A and protease K treatment was shown to be an optimal method for the analysis of cfDNA concentration [23]. 0.1 V of lysis buffer (10% sodium lauryl sarcosylate, 0.075 mg/mL RNase A [Sigma, USA], 0.2 M EDTA) was added to plasma, incubated for 1 h at 37°C, then treated with protease K 0.2 mg/mL (Promega, USA) for 24 h at 37°C. After two purification cycles using a saturated phenol solution, cfDNA fragments were precipitated in ethanol and 2 M ammonium acetate. The precipitate was then washed twice with 75% ethanol, dried, and dissolved in water. cfDNA concentration was determined after staining the samples with PicoGreen dye (Molecular Probes/Invitrogen, CA, USA) by measuring the fluorescence on EnSpire Plate Reader (PerkinElmer, Waltham, MA, USA) at excitation and emission wavelengths of 488 and 528 nm, respectively. The cfDNA concentration in the sample was calculated according to a DNA standard curve. The standard error for the assessment of cfDNA concentration in water solution by fluorescence was 3%–5%. The total error, including the step of DNA isolation, was 9 ± 5%.

2.3. Nuclease Activity Assessment

To assess NA, we applied a method of radial diffusion in agarose gel stained with EtBr [59]. To calculate NA, a calibration dependence was obtained, which relates the fluorescence of the dye in the spot with the concentration of the standard DNase I sample (Sigma, USA) in solution. The result is given in units of activity (U/mL). 1 unit corresponds to the activity of DNase I, taken at a concentration of 1 ng/mL (1 h, 37°C). At least three parallel measurements were made for one sample. The relative standard error of the method was 5%.

2.4. The Estimation of cfDNA Oxidation

The oxidation level of cfDNA was determined by ELISA with the anti-8-oxodG antibodies [11, 13, 35]. Briefly, the DNA samples were applied to a filter (Optitran BA-S85, GE Healthcare), with three dots (10 ng/dot) per sample. Four standard samples of oxidized gDNA (10 ng/dot) with the known concentration of 8-oxodG (determined by ESI-MS/MS on AB SCIEX 3200 Qtrap) were applied to the same filter to obtain a calibration dependence relating the signal intensity to the copy number in a sample. The filters were heated at 80°C in a vacuum for 1.5 h. For detection, alkaline phosphatase-conjugated anti-8-oxodG antibody (Abcam) and the corresponding substrates NBT and BCIP were used. For quantification analysis, Images 6.0 software (RCMG, Russia) was used. The relative standard error of the method was 15 ± 5%.

2.5. Nonradioactive Quantitative Hybridization (NQH)

The method of quantitative nonradioactive hybridization was specified in detail previously [60]. Briefly, the denatured cfDNA samples (50 ng/mL) were applied to a prepared filter (Optitran BA-S85, GE Healthcare) along with the standard samples of the gDNA (50 ng/mL) with a known content of the rDNA or SatIII to plot a calibration curve for the dependence of the signal intensity on the number of rDNA copies (or SatIII content) in a particular sample. Lambda phage DNA (50 ng/mL) was also applied to the same filter to control the nonspecific signal. The filter was heated at 80°C in a vacuum for 1.5 h, then hybridized with the corresponding probes, dried, scanned, and analyzed using Images 6.0 software (RCMG, Russia). The software determined the dot location, measured the nearest background signal, and calculated the integral dot intensity. Signals from several dots corresponding to the same sample were averaged. The rDNA or SatIII content in a studied DNA sample was calculated using the calibration curve equation. The relative standard error was 11 ± 8%.

For the detection of the human ribosomal repeat, the probe p (ETS-18S) (the fragment of rDNA 5.8 kb long, from −515 to 5321, relative to the transcription initiation point, HSU 13369, GeneBank) was used (Figure 2(a)). The f-SatIII probe was a 1.77 kb cloned EcoRI fragment of human satellite III DNA. Dr. H. Cook (MRC, Edinburgh, UK) kindly provided the human chromosome 1q12-specific repetitive satellite DNA probe pUC1.77. The DNA probes were biotinylated using the Biotin NT Labeling Kit (Jena Bioscience GmbH).

Figure 2.

Figure 2

Open in a new tab

The content of GC-rich fragments in the plasma of the volunteers, subjected to the Antarctic conditions. (a) The content of rDNA in the plasma samples of the subjects; a1—the scheme of the rDNA repeat with an arrow indicating a probe, and the changes in the cell-free rDNA; a2—the content of rDNA in the plasma samples of the subjects (1–11) at the indicated time points (mean values of four measurements and SE) compared to gDNA; a3—the analysis of the changes in the content of cell-free rDNA of the subjects during their stay at Vostok Station (i) compared to control (CA); a4—the analysis of the changes in plasma rDNA of 11 subjects at the indicated time points; horizontal lines indicate medians; a5—the distribution of rDNA content in the samples from healthy male donors not subjected to extreme stress (control, C) and from the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test; (b) the changes in the cf-rDNA concentrations (Ccf-rDNA) in the subjects during the wintering; b1—the concentration of rDNA in the plasma samples of the subjects (1–11) at the indicated time points; b2—the analysis of the changes in the concentration of cell-free rDNA of the subjects during their stay at Vostok Station (i) compared to control (CA); b3—the analysis of the changes in Ccf-rDNA of 11 subjects at the indicated time points; horizontal lines indicate medians; b4—the distribution of rDNA concentration in the samples from healthy male donors not subjected to extreme stress (control, C) and from the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test.

2.6. RNA Extraction, Reverse Transcription, and PCR

RNA was extracted from cells using YellowSolve kits (Klonogen, St. Petersburg, Russia) or Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturers' instructions. The RNA concentration was determined using a QuantiT RiboGreen RNA reagent dye (R11491, Invitrogen, Carlsbad, CA, USA) on EnSpire plate reader (PerkinElmer, Waltham, MA, USA). According to the standard protocol, the reverse transcription reaction was performed using reagents from Sileks (Moscow, Russia). PCR was performed using the specific primers, SYBR Green intercalating dye (Molecular Probes/Invitrogen, CA, USA), and StepOnePlus device and software (Applied Biosystems, Foster City, CA, USA). Evrogen (Moscow, Russia) performed the primer design and synthesis. The following primers were used (see Table 1).

Table 1.

Primer sequences for gene expression analysis.

Gene F R
AIM2 CAGAAATGATGTCGCAAAGCAA TCAGTACCATAACTGGCAAACAG
BAX GGAGCTGCAGAGGATGATTG AGTTGAAGTTGCCGTCAGAA
BCL2 TTTGGAAATCCGACCACTAA AAAGAAATGCAAGTGAATGA
IL-17A TAATGGCCCTGAGGAATGGC AGGAAGCCTGAGTCTAGGGG
IL8 GCACCGACTTTGGAGTTGG GGACCCCTCAAACGACTGT
NFKB1 CAGATGGCCCATACCTTCAAAT CGGAAACGAAATCCTCTCTGTT
RIG-I GAGATTTTCCGCCTTGGCTAT CCGTTTCACCTCTGCACTGTT
STING CCAGAGCACACTCTCCGGTA CGCATTTGGGAGGGAGTAGTA
TLR9 CCCACCTGTCACTCAAGTACA GTGGCTGAAGGTATCGGGATG
Open in a new tab

The PCR mixture for one reaction consisted of 1Х PCR buffer (70 mmol Tris-HCl, pH 8.6; 16 mmol ammonium sulfate, 3.5 mmol MgCl2), 0.1 mmol dNTP, 1 pmol of primers, and cDNA. The run consisted of denaturation for 4 min at 95°C, 40 amplification cycles: 94°C for 20 s, 56°C–62°C for 30 s, 72°C for 30 s, and final elongation at 72°C for 5 min. The results were processed using a calibration plot with CA as a reference sample and TBP as a reference gene. The error was 2%.

2.7. Statistical Analysis

All data within the manuscript are presented as mean ± SE. Data were analyzed using the Mann–Whitney U test and/or Bonferroni's multiple comparison test. p < 0.05 was considered statistically significant. The distributions of the samples by the parameter values were compared by the Kolmogorov–Smirnov method (D and α). The analysis of correlations between the parameters was performed by the Spearman rank correlation method (correlation coefficient Rs and probability p). The data were analyzed with Excel, Microsoft Office (Microsoft, Redmond, WA, USA), StatPlus 2007 (AnalystSoft, USA), and StatGraphics (Statgraphics Technologies, The Plains, VA, USA).

3. Results

3.1. Alterations in the Plasma cfDNA Concentration

Figure 1(b) demonstrates the concentrations of cfDNA (CcfDNA) of the participants during the wintering on Vostok Antarctic station at the indicated time points (panel b1) and the statistical analysis of their changes compared to the control (panel b2). In most cases, the blood concentration of cfDNA increased in 10 expedition members compared to the control (CA). Participant #3 showed an abnormally high plasma cfDNA concentration in the control sample, which then slightly decreased but was still relatively high. Apparently, it reflected a latent chronic kidney disease, which then manifested in acute form and caused the untimely evacuation of this participant from the station. Panel b3 in Figure 1(b) indicates a significant increase in CcfDNA in all members at time point I, i.e., a month after the arrival at the station (the data for participant #3 were excluded from the analysis).

Panel b4 in Figure 1(b) demonstrates the comparison between the cfDNA concentrations of the Antarctic expedition members (Group A, 53 samples, N = 11) and of healthy males of approximately the same age who were not subjected to extreme environmental conditions (Group C, N = 95). Group A had elevated concentrations of cfDNA fragments in their blood.

Thus, the extreme Antarctic conditions cause a temporary elevation in the blood cfDNA concentration, especially during the first month of the wintering.

3.2. Alterations in the Plasma Nuclease Activity

Electrophoretograms in Figure 3(a) illustrate the sizes of the cfDNA fragments extracted from the blood plasma of the expedition members (Group A, #1–#11) and several control samples obtained from healthy donors (Group C). In the control samples, cfDNA consists of a low quantity of long (> 15 kb) DNA fragments, while in Group A, it contains 0.1–15 kb molecules presented in high amounts. This indicates a significant upregulation of blood nuclease activity in the expedition members, which may happen due to increased apoptosis rates, followed by an elevated amount of DNA entering the bloodstream.

Figure 3.

Figure 3

Open in a new tab

The analysis of the blood nuclease activity (NA) dynamics of the subjects during their 1-year stay in Antarctica. (a) The electrophoretograms of plasma cfDNA from the subjects (1–11) at the indicated time points and the control samples (C); (b) the analysis of plasma NA; b1—NA indices in the plasma samples of the subjects (1–11) at the indicated time points (mean values of four measurements and SE); b2—the analysis of the changes in blood NA of the subjects during their stay at Vostok Station (i) compared to control (CA); b3—the analysis of the changes in plasma NA of 11 subjects at the indicated time points; horizontal lines indicate medians (U-test); b4—the distribution of plasma NA samples from healthy male donors (C, green) and from the group under study during the wintering period (A, red); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test (D, α); (c) the dependency of CcfDNA and NA toward each other in the three groups; (d) the distribution of plasma CcfDNA/NA samples (d1) and CcfDNA ∗NA samples (d2) in three groups; d3—the analysis of the changes in CcfDNA ∗NA of the subjects during their stay at Vostok Station (i) compared to control (CA).

Indeed, the plasma nuclease activity (NA) in Group A was especially pronounced during the first months after the arrival at the station, and it reached its maximal values at polar night (Figure 3(b), panels b1 and b2). During the second half of the wintering, plasma NA decreased in most participants (Figure 3(b), panel b3). In sum, people residing at Vostok Station demonstrated significantly higher blood plasma NA during their stay compared to that of healthy people in the absence of extreme stress conditions (Figure 3(b), panel b4).

For the control group, we found a negative correlation between blood NA and the concentration of cfDNA (Figure 3(c), Table 2): the higher the plasma nuclease activity was, the fewer cfDNA fragments resided in the blood. For Group A, this negative correlation was less pronounced. The high NA in the expedition members (> 10 U/mL, equal to the upper limit for the control group) was associated with the higher CcfDNA.

Table 2.

Correlation analysis between the characteristics of blood cfDNA in three groups.

graphic file with name BRI2025-8994730.f001.jpg
Open in a new tab

∗Yellow cells—positive correlation; blue cells—negative correlation; the probabilities are indicated in each of the cells.

Recently, we proposed applying the CcfDNA/NA ratio to characterize cfDNA in people subjected to chronic stress, such as increased radiation [25]. This index was significantly lower for people exposed to radiation. Neither Group C nor Group A demonstrated significant changes in the CcfDNA/NA ratio (Figure 3(d), panel d1). However, we noted pronounced differences between the two groups when multiplying the indices CcfDNA ∗ NA (Figure 3(d), panel d2). We conclude that Antarctic wintering causes an upregulation of nuclease activity in the blood with a simultaneous increase in cfDNA fragment concentration.

3.3. cfDNA Oxidation

Ten of the subjects demonstrated a decreased level of the oxidation biomarker in their cfDNA during their stay on Vostok Station, while one of them, namely, expedition member #1, did not (Figure 4(a), panels a1–a3). We noted no significant differences in cfDNA oxidation between the control group and the group under study (Figure 4(a), panel a4). At the same time, the concentration of 8-oxodG in the blood varied individually (Figure 4(b), panels b1, b2, and b5). Thus, the biological action may develop depending on the level of 8-oxodG in cfDNA (Figure 4(b), panel b3) and the total concentration of cfDNA fragments in the blood (Figure 4(b), panel b4).

Figure 4.

Figure 4

Open in a new tab

Oxidation of cfDNA during the Antarctic wintering. (a) The changes of 8-oxodG in plasma cfDNA; a1—the absolute content of 8-oxodG in the plasma samples of the subjects (1–11) at the indicated time points (mean values of three measurements and SE); a2—the analysis of the changes in the absolute values of 8-oxodG of the subjects during their stay at Vostok Station (i) compared to control (CA); a3—the analysis of the changes in 8-oxodG in plasma cfDNA of 11 subjects at the indicated time points; horizontal lines indicate medians; a4—the distribution of 8-oxodG content in the samples from healthy male donors not subjected to extreme stress (control, C) and from the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test; (b) the changes in 8-oxodG concentrations (C8-oxodG) in the blood of the subjects; b1—C8-oxodG in the plasma of the subjects (1–11) at the indicated time points (mean values for three measurements and SE); b2—the analysis of the changes in C8-oxodG of the subjects during their stay at Vostok Station (i) compared to control (CA); b3, b4—the dependency of 8-oxodG concentration from the absolute 8-oxodG content and the concentration of cfDNA (CcfDNA); b5—the analysis of the changes in plasma 8-oxodG concentration of 11 subjects at the indicated time points; horizontal lines indicate medians.

3.4. The Content of cf-rDNA in the Blood

GC content of cfDNA may significantly alter due to the accumulation of GC-rich fragments, such as rDNA repeat [41–45]. To analyze the level of extracellular rDNA in the cfDNA (cf-rDNA), we utilized the method of NQH [44, 46] and the DNA probe for the 73% GC-rich rDNA region (Figure 2(a)). Figure 2(a), panel a2, shows the rDNA copy number per genome equivalent of cfDNA; panel a3 demonstrates the analysis of rDNA content in the gDNA extracted from the same blood samples.

Figure 2(a), panel a4, demonstrates that cfDNA is more abundant in rDNA than gDNA, which is concordant with the published data [43, 44, 46]. In the subjects, the extracellular GC-rich rDNA fragments varied from 480 copies (in #5, CA) to 3200 copies (in #3, I) per diploid genome equivalent of cfDNA (mean 1015 ± 525; median 850; Kv = 0.52; n = 64). At the same time, gDNA contained from 380 (in #4) to 567 (in #2) rDNA copies per cell (mean 473 ± 32; median 472; Kv = 0.07; n = 64). Most of the expedition members had elevated rDNA levels at different time points of their mission, though subjects #10 and #11 had almost no changes in the cf-rDNA content (Figure 2(a), panel a3). In the group under study, we noted higher cf-rDNA levels compared to the control group (Figure 2(a), panel a5). The concentration of cf-rDNA (Ccf-rDNA) increased in all of the subjects at different time points, except for subject #3, who initially demonstrated abnormally high Ccf-rDNA (Figure 2(b), panels b1–b4).

3.5. The Content of cf-SatIII in the Blood Plasma

We applied NQH for the analysis of Satellite III (1q12) content in cfDNA (cf-SatIII, Figure 5(a)), which contains 62% AT pairs. In the control group, cf-SatIII varied within a narrower range and was generally higher (mean 30 ± 10 pg/ng DNA; median 25 pg/ng DNA; Кv = 0.38; n = 11). In Group A, the content of cell-free SatIII and, thus, the AT percentage of cfDNA were lower. However, these indices normalized in half of the subjects by the end of the expedition.

Figure 5.

Figure 5

Open in a new tab

The content of AT-rich fragments in the plasma of the volunteers, subjected to the Antarctic conditions. (a) The changes in the cell-free SatIII; a1—the content of SatIII in the plasma samples of the subjects (1–11) at the indicated time points (mean values of four measurements and SE); a2—the analysis of the changes in the content of cf-SatIII of the subjects during their stay at Vostok Station (i) compared to control (CA); a3—the analysis of the changes in plasma SatIII of 11 subjects at the indicated time points; horizontal lines indicate medians; a4—the distribution of SatIII content in the samples from healthy male donors not subjected to extreme stress (control, C) and from the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test; (b) the changes in the cf-SatIII concentrations (Ccf-SatIII) in the subjects during the wintering; b1—the concentration of cfSatIII in the plasma samples of the subjects (1–11) at the indicated time points; b2—the analysis of the changes in the concentration of cell-free SatIII of the subjects during their stay at Vostok Station (i) compared to control (CA); b3—the analysis of the changes in Ccf-SaIII of 11 subjects at the indicated time points; horizontal lines indicate medians; b4—the distribution of cf-SatIII concentration in the samples from healthy male donors not subjected to extreme stress (control, C) and from the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test; (c) the changes in the cell-free rDNA/SatIII ratio (R = cf-rDNA/cf-SatIII) in the subjects during the wintering; c1—the R value in the subjects (1–11) at the indicated time points; c2—the analysis of the changes in R during the wintering (i) compared to control (CA); c3—the analysis of the changes in R of 11 subjects at the indicated time points; horizontal lines indicate medians; c4—the distribution of R in healthy male donors not subjected to extreme stress (control, C) and the group under study before (CA) and during the wintering period (A); in the frame: the comparison of the distributions of the groups C and CA using the Kolmogorov–Smirnov test; the black dotted line indicates the distribution of R in the sample of people subjected to radiation [42].

The concentration of SatIII fragments in the blood plasma of the subjects (Ccf-SatIII) varied, and all of them demonstrated decreased Ccf-SatIII at different time points (Figure 5(b)). At the same time, this parameter did not differ between the control group and the group under study (Figure 5(b), panel b4).

In sum, the fraction of the extracellular DNA containing AT-rich fragments of SatIII was reduced in the blood of the expedition members with the simultaneous increase in GC-rich cf-rDNA. Earlier, we proposed the ratio of the two parameters (R = cf-rDNA/cf-SatIII) to assess the stress level caused by ionizing radiation [44]. The expedition members demonstrate elevated R during the whole wintering and, in general, a higher R compared to the control group (Figure 5(c)). Interestingly, the cumulative frequency for Group A samples coincides with that of the people subjected to radiation (black curve in Figure 5(c), panel c4) [44].

3.6. The Correlation Between the Characteristics of cfDNA

Table 1 illustrates the results of the correlation analysis of the cfDNA parameters under study. Figures 6(a) and 6(b) demonstrate the dependence of cf-rDNA, cf-SatIII, and the R ratio on the total concentration of cfDNA in the blood. The control group shows a negative correlation between cf-rDNA, R, and СcfDNA and a positive correlation between cf-SatIII and СcfDNA. The lower the cfDNA concentration is, the less disproportional GC- and AT-rich (or rDNA and SatIII) fragment concentrations appear to be. Similar trends were in the CA and A groups, though less pronounced (the correlations were nonsignificant, p > 0.05).

Figure 6.

Figure 6

Open in a new tab

The correlations between the characteristics of plasma cfDNA. (a) The correlation between the circulating rDNA fragments (cf-rDNA), circulating SatIII fragments (cf-SatIII), and the total cfDNA concentration in the blood samples of the three groups; (b) the correlation between R (cf-rDNA/cf-SatIII) and the total cfDNA concentration in the blood samples of the three groups; (c) the correlation between the concentration of cf-rDNA, the concentration of cf-SatIII, and the total cfDNA concentration in the blood samples of the three groups; (d) the correlation between the circulating rDNA fragments (cf-rDNA), circulating SatIII fragments (cf-SatIII), and their content in the blood samples of the three groups.

The concentrations of cf-rDNA and cf-SatIII depend on the total concentrations of the DNA fragments circulating in the blood plasma (Table 1, Figure 6(c)) and correlate positively. The concentration of cf-SatIII to a greater extent is defined by the absolute content of cf-SatIII. The concentration of cf-rDNA negatively correlates with the R ratio in both groups C and A.

3.7. The Expression of Genes Associated With Apoptosis

One of the reasons for the increased plasma cfDNA concentration and the alterations in GC/AT content, along with the upregulated nuclease activity, may be the high rate of cell deaths as a response to stress caused by the work in Antarctic conditions. To test this hypothesis, we analyzed the expression of the major pro- and antiapoptotic genes (BAX and BCL2, respectively) in the blood leukocytes of the expedition members using RT-qPCR (Figure 7). The mRNA level of BAX increased significantly in all of the expedition members and reached its maximum at time point II (the 85th day of the wintering, Figure 7(a), panel a3). The expression of BCL2 in leukocytes decreased in the subjects at different time points (Figure 7(b)). The BAX/BCL2 RNA ratio characterizing the apoptosis level [5] was significantly increased at time points I and II (Figure 7(c)) and decreased by the end of the mission (Figure 7(c), panel c3).

Figure 7.

Figure 7

Open in a new tab

The analysis of pro- and antiapoptotic gene expression in the blood cells of the expedition members. (a) The analysis of BAX expression; a1—BAX mRNA levels in the leukocytes of the subjects (1–11) at the indicated time points; a2—the analysis of the changes in BAX expression compared to control; a3—the analysis of the changes in BAX expression in 11 subjects at the indicated time points; horizontal lines indicate medians; (b) the analysis of BCL2 expression; b1—BCL2 mRNA levels in the leukocytes of the subjects (1–11) at the indicated time points; b2—the analysis of the changes in BCL2 expression compared to control; b3—the analysis of the changes in BCL2 expression in 11 subjects at the indicated time points; horizontal lines indicate medians; (c) the assessment of BAX/BCL2 mRNA ratio; c1—BAX/BCL2 mRNA ratio of the subjects (1–11) at the indicated time points; c2—the analysis of the changes in BAX/BCL2 ratio compared to control; c3—the analysis of the changes in BAX/BCL2 mRNA ratio in 11 subjects at the indicated time points; horizontal lines indicate medians.

The alterations in BAX RNA levels positively correlated with NA and cf-rDNA and negatively correlated with cf-SatIII (Figure 8(a)). We noted negative correlations between BCL2 RNA content in blood leukocytes and NA and a positive correlation between that and cf-SatIII. The higher the BAX/BCL2 RNA ratio was, the higher the NA and cf-rDNA parameters were. At this point, the content and concentration of the AT-rich fragment cf-SatIII remained low. Table S1 reports the correlation between the parameters of cfDNA under study and the expression of the two genes.

Figure 8.

Figure 8

Open in a new tab

The correlations between the expression of the genes under study and the characteristics of plasma cfDNA. (a) The correlation between the cfDNA parameters and the mRNA levels of the genes in Group A (n = 64). (b) The correlations between the parameters characterized by the maximal correlation coefficients.

3.8. The Gene Expression of DNA-Sensors

The alterations in the properties of the extracellular DNA are associated with its biological activity, realized through receptors capable of forming complexes with the cfDNA and/or mediating its influence on cell genome. We analyzed the mRNA expression of the four genes in charge of signal transmission from cfDNA to the nucleus, namely, TLR9, AIM2, STING, and RIG-I (Table 3).

Table 3.

The analysis of the changes in the expression of DNA-sensor genes (TLR9, AIM2, STING, and RIG-I) and NF-kB associated genes (NFKB, IL8, and IL17A).

graphic file with name BRI2025-8994730.f002.jpg
Open in a new tab

∗The mean values of three measurements. The mRNA quantities were normalized to the reference sample (CA). Green cells—the expression did not change compared to control (p > 0.05, U-test); brown cells—the expression increased (p < 0.05); blue cells—the expression decreased (p < 0.05).

5 out of 11 subjects, including subject #3, who showed abnormality before, had increased TLR9 expression. In others, mRNA levels of TLR9 either did not change or decreased 15%–50% at different time points of the wintering. These alterations positively correlated with the plasma concentration of the GC-rich ribosomal repeat (Figure 8) and the changes in the expression of the proapoptotic BAX gene (Table S1).

The mRNA levels of AIM2 decreased in 6 volunteers at different time points up to 9 times (Table 3). They negatively correlated with the rDNA content in cfDNA (Figure 8).

RIG-I (DDX58) expression was 10%–50% lower in 10 expedition members compared to control values, while subject #11 did not demonstrate any significant changes. Of note, we did not note upregulation of this gene at any of the time points. These changes in the RIG-I mRNA level negatively correlated with the rDNA concentration and the total concentration of cfDNA and positively correlated with the concentration of cf-SatIII (Figure 8). Also, the expression of this gene negatively correlated with the alterations in DNA oxidation and TLR mRNA levels.

STING (TMEM173) was either downregulated or unchanged during the wintering, though there was a significant negative correlation with TLR9 expression (Figure 9(b)) and a positive correlation with AIM2 mRNA levels.

Figure 9.

Figure 9

Open in a new tab

The analysis of the changes in the expression of DNA-sensor genes (TLR9, AIM2, STING, and RIG-I) and NF-kB associated genes (NFKB1, IL8, and IL17A). (a) The relative expression of the genes in the leukocytes from 11 subjects at the indicated time points; (b) the correlation analysis of mRNA levels of the indicated genes for the samples from Group A (n = 64).

3.9. The Alterations in the mRNA Levels of NFKB, IL8, and IL17A

The mRNA levels of the transcription factor NF-kB, as well as those of the NF-kB-controlled genes (IL8 and IL17A), were elevated in the blood leukocytes of the expedition members during different time points of the Antarctic wintering (Table 3, Figures 8 and 9). These alterations in the expression of the three genes positively correlated with the changes in the proapoptotic BAX expression and negatively correlated with the expression of its antagonist BCL2. We also noted a pronounced positive correlation between the mRNA levels of NFKB and AIM2. In addition, the alterations in the expression of NF-kB positively correlated with NA (Figure 8(a)) and negatively correlated with cfDNA oxidation. There was a negative correlation between IL8 mRNA levels and cf-SatIII and those of IL17A and cf-SatIII. The changes in the expression of IL17A also negatively correlated with the levels of 8-oxodG in cfDNA.

4. Discussion

4.1. Antarctic Conditions Increase Apoptosis

The first 2 months upon arrival at Concordia Station were shown to increase the level of ROS with the simultaneous downregulation of antioxidant systems [61], i.e., the Antarctic conditions stimulate oxidative stress, which, in turn, significantly impairs the functioning of immunity. It manifests as proinflammatory cytokines and the activation of T-cells, possibly mediated by latent lentiviruses [62–68]. Even though the level of stress may lower in the course of the expedition, it remains high compared to the control.

We suppose that stress induces apoptosis in some cells of the body, including blood cells, as indicated by the high BAX/BCL2 RNA ratio in leukocytes detected in the current study, with the maximal value during the polar night (Figure 7(c)). The upregulation of apoptosis is also confirmed by the elevated cfDNA concentrations (Figure 1(b)), which become high as early as 27 days upon arrival at Vostok; however, then they changed individually. At the same time, we did not note a significant correlation between the BAX/BCL2 RNA ratio and the CcfDNA, which has two possible explanations. First, the blood cfDNA pool can be replenished with the DNA fragments from other body cells that died in response to stress [69]. Second, in response to high blood concentration of extracellular DNA, a protective mechanism for its elimination from the circulation is activated. The latter is essential, for a large amount of high-molecular-weight cfDNA negatively affects blood rheology [70]. In addition, cfDNA shows pronounced biological activity toward many cell types. The malfunctioning of the cfDNA elimination system is associated with severe immune pathologies, such as systemic lupus erythematosus [71, 72].

Extracellular DNA is destroyed primarily by blood endonucleases. In this study, the blood NA remained relatively elevated during the whole wintering period, reaching its maximum during the polar night. This fact can be explained by intense apoptosis, which results in a high concentration of cfDNA and claims a more effective cfDNA elimination. The high NA compared to the control, together with the positive correlation between NA and BAX/BCL2 RNA ratio, indicates the persistent entry of additional cfDNA into the bloodstream. In one of our studies, the interconnection between NA and cfDNA concentration (CcfDNA) was analyzed in the blood of people exposed to ionizing radiation for a prolonged period of time [25]. We showed elevated NA with decreased CcfDNA, which resulted in a low CcfDNA/NA ratio compared to the control, while CcfDNA ∗ NA did not differ from the control parameter. For the members of the Antarctic expedition, we noted a significant increase in the latter parameter compared to the control (Figure 3(d)). Apparently, CcfDNA ∗ NA may be used for the assessment of total apoptosis in the body in conditions like Antarctic wintering.

4.2. Antarctic Conditions Cause Alterations in cfDNA

The analysis of cfDNA oxidation and the GC/AT ratio serves two purposes. First, these parameters report on the nature and duration of both acute and chronic stress induced by a disease or environmental conditions causing cell death. Second, the content of 8-oxodG and the GC percentage indicate cfDNA biological activity, both positive and pathogenic [47, 73].

In our study, cfDNA oxidation decreased during the wintering (see Figure 4). Similarly, Nirwan et al. reported a decreased 8-oxodG level in the blood of people who practiced yoga in Antarctica [72]. Low oxidation level of cfDNA is associated with its lowered bioactivity and less effective cell penetration [32, 34, 40]. We hypothesize that the elevated NA effectively eliminates the previously oxidized cfDNA fragments from the blood of the expedition members. With that, the pool of extracellular DNA fragments is replenished with the DNA fragments from cells that died for reasons other than DNA oxidation. Because the oxidation of cfDNA decreases with the increase in its concentration, the content of the oxidized fragments remains unchanged and depends both on the oxidation level and the total concentration of cfDNA in the blood.

We assessed the GC percentage by detecting the rDNA repeat in the blood, the content of which increased during the wintering (see Figure 2). Similarly, we observed increased cf-rDNA concentrations in people subjected to ionizing radiation, who had a simultaneous increase in NA and decrease in cfDNA total concentration [44]. Together with the elevated GC percentage, represented by rDNA, the cfDNA of the expedition members is characterized by the decreased concentration of AT-rich fragments, represented by cf-SatIII (Figure 5). The R ratio of the two parameters (cf-rDNA/cf-SatIII) was elevated in all of the subjects during the first half of the wintering (160 days, time points I–III). Interestingly, Antarctic conditions caused the same rise in R as the exposure to ionizing radiation (consider the black curve in Figure 5(c), panel c4). Thus, we propose to use R as a marker of cell death, especially in the conditions of Antarctica. The mechanism underlying the GC/AT disproportion was considered previously [44].

4.3. cfDNA Is Potentially an Active Biological Agent

Our in vitro studies on skin fibroblasts demonstrate that plasma cfDNA causes alterations in the expression of genes associated with DNA sensing (TLR9, AIM2, STING, and RIG-I) [34]. Based on these data, we analyzed the mRNA levels of these genes in the blood leukocytes of the expedition members. The expression of STING and RIG-I either decreased in some of the subjects or did not change in others, while the changes in the expression of TLR9 and AIM2 were individual and multidirectional (Table 3).

TLR9 gene expression positively correlated with the expression of the proapoptotic gene BAX and the concentration of TLR9 ligands in the blood, i.e., the GC-rich fragments of cfDNA (Figures 8 and 9). The significant negative correlation between the mRNA levels of TLR9 and STING in the presence of cfDNA was reported before in in vitro studies [36]. This fact may be explained by the cytoplasmic location of STING and RIG-I receptors, while TLR9 receptor can be both in the cell membranes and in endosomes. STING and RIG-I recognize AT-rich regions in the cytoplasmic DNA. During the Antarctic wintering, we observed both low AT content (see Figure 5) and low cfDNA oxidation (Figure 4), which negatively affect cfDNA penetration into the cell. The individual differences in the alterations of cfDNA characteristics detected in the expedition members may be caused by different plasma cfDNA parameters and by alterations in blood cell subpopulations expressing either of the DNA sensors. A high degree of individual variability should be kept in mind while preparing for long polar expeditions or long-term interplanetary missions for implementing a personalized approach in biomedical support. Individual reactions should be studied to increase the efficiency of countermeasures and medicine.

The conditions in Antarctica stimulate the expression of NFKB1, IL8, and IL17A genes in blood leukocytes, which are the inducers/mediators of inflammation. These data are confirmed by the proinflammatory cytokines in the blood during wintering reported elsewhere [64–70]. The alterations in the expression of these genes positively correlate with the apoptosis markers (see Figure 9), NA level (NFKB1, Figure 8(a)), and the R parameter (IL17A).

4.4. Limitation of the Study

According to the study program, the final blood sample was scheduled at the end of the wintering, a year after the first control sampling. As we demonstrate here and as it is shown by other researchers, adaptive response to the Antarctic conditions develops within the first 100 days (sampling time points I and II). During this very period, all the measured parameters change dramatically, while by the end of the wintering, most of them are similar to the control ones. However, their analysis after the return of the expedition members to normal climate conditions would be quite expedient, as the parameters may change again during the readaptation. Thus, the dynamics of human cfDNA properties in response to the change of a stress-generating environment to a usual habitat may be the topic of another promising research.

5. Conclusions

The analyses of cfDNA parameters and the expression of genes associated with cell death and DNA-sensors demonstrated that the Antarctic conditions cause (1) upregulation of apoptosis, which remains active in the first half of the wintering; (2) enrichment of cfDNA with GC fragments, which increase its biological activity; and (3) activation of expression of proinflammatory genes.

Acknowledgments

We thank Dr. H. Cook (MRC, Edinburgh, UK) who kindly provided the human chromosome lql2-specific repetitive satellite DNA probe pUC1.77 and Roman Veiko (Research Center for Medical Genetics, Moscow) for the Images 6.0 software.

Data Availability Statement

The data that support the findings of this study are available in the supporting information of this article.

Ethics Statement

This study was conducted in accordance with the Declaration of Helsinki and approved by the Bioethics Committee of SSC RF-IBMP RAS (protocol No 487 from October 11, 2018).

Consent

Informed consent was obtained from all subjects involved in the study.

Disclosure

All authors have read and agreed to the published version of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

Author Contributions

Sergey Ponomarev: validation and formal analysis, Anastasia Kotikova: draft translation, review, and editing, Nikolay Osetsky: resources and data curation, Natalia Veiko: conceptualization and original draft preparation, Elizaveta Ershova: methodology and investigation, Elena Malinovskaya, Ekaterina Savinova, Julia Chudakova, and Julia Eliseeva: investigation, Vera Izhevskaia: visualization, Sergey Kutsev: project administration, and Svetlana Kostyuk: supervision.

Funding

This study was supported by the Ministry of Science and Higher Education of the Russian Federation, grant number 075-15-2022-298.

Supporting Information

Supporting Information

Additional supporting information can be found online in the Supporting Information section.

8994730.f1.docx (119.1KB, docx)

Table S1 demonstrates the correlation analysis between the parameters studied in the work (values normalized to CA control), reflecting the properties of cfDNA and the levels of mRNAs of the genes under study. The analysis was carried out for the entire sample (64 samples) and for each wintering period (I–V).

References

  • 1.Ponomarev S., Kalinin S., Sadova A., Rykova M., Orlova K., Crucian B. Immunological Aspects of Isolation and Confinement. Frontiers in Immunology . 2021;12:p. 697435. doi: 10.3389/fimmu.2021.697435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Strewe C., Moser D., Buchheim J. I., et al. Sex Differences in Stress and Immune Responses During Confinement in Antarctica. Biology of Sex Differences . 2019 April;10(1):p. 20. doi: 10.1186/s13293-019-0231-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hardwick J. M., Soane L. Multiple Functions of BCL-2 Family Proteins. Cold Spring Harbor Perspectives in Biology . 2013 February;5(2):p. a008722. doi: 10.1101/cshperspect.a008722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Oltval Z. N., Milliman C. L., Korsmeyer S. J. Bcl-2 Heterodimerizes In Vivo With a Conserved Homolog, Bax, That Accelerates Programed Cell Death. Cell . 1993 August;74(4):609–619. doi: 10.1016/0092-8674(93)90509-o. [DOI] [PubMed] [Google Scholar]
  • 5.Korsmeyer S. J., Shutter J. R., Veis D. J., Merry D. E., Oltvai Z. N. Bcl-2/Bax: a Rheostat That Regulates an Anti-Oxidant Pathway and Cell Death. Seminars in Cancer Biology . 1993 December;4(6):327–332. [PubMed] [Google Scholar]
  • 6.de Miranda F. S., Barauna V. G., Dos Santos L., Costa G., Vassallo P. F., Campos L. C. G. Properties and Application of Cell-Free DNA as a Clinical Biomarker. International Journal of Molecular Sciences . 2021 August;22(17):p. 9110. doi: 10.3390/ijms22179110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rahat B., Ali T., Sapehia D., Mahajan A., Kaur J. Circulating Cell-Free Nucleic Acids as Epigenetic Biomarkers in Precision Medicine. Frontiers in Genetics . 2020 August;11:p. 844. doi: 10.3389/fgene.2020.00844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sherwood K., Weimer E. T. Characteristics, Properties, and Potential Applications of Circulating Cell-Free DNA in Clinical Diagnostics: A Focus on Transplantation. Journal of Immunological Methods . 2018 December;463:27–38. doi: 10.1016/j.jim.2018.09.011. [DOI] [PubMed] [Google Scholar]
  • 9.Kustanovich A., Schwartz R., Peretz T., Grinshpun A. Life and Death of Circulating Cell-Free DNA. Cancer Biology & Therapy . 2019;20(8):1057–1067. doi: 10.1080/15384047.2019.1598759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Duvvuri B., Lood C. Cell-Free DNA as a Biomarker in Autoimmune Rheumatic Diseases. Frontiers in Immunology . 2019 March;10:p. 502. doi: 10.3389/fimmu.2019.00502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hashimoto T., Yoshida K., Hashiramoto A., Matsui K. Cell-Free DNA in Rheumatoid Arthritis. International Journal of Molecular Sciences . 2021 August;22(16):p. 8941. doi: 10.3390/ijms22168941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gerovska D., Araúzo-Bravo M. J. Systemic Lupus Erythematosus Patients With DNASE1L3·Deficiency Have a Distinctive and Specific Genic Circular DNA Profile in Plasma. Cells . 2023 March;12(7):p. 1061. doi: 10.3390/cells12071061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ershova E. S., Jestkova E. M., Chestkov I. V., et al. Quantification of Cell-Free DNA in Blood Plasma and DNA Damage Degree in Lymphocytes to Evaluate Dysregulation of Apoptosis in Schizophrenia Patients. Journal of Psychiatric Research . 2017 April;87:15–22. doi: 10.1016/j.jpsychires.2016.12.006. [DOI] [PubMed] [Google Scholar]
  • 14.Jiang J., Chen X., Sun L., et al. Analysis of the Concentrations and Size Distributions of Cell-Free DNA in Schizophrenia Using Fluorescence Correlation Spectroscopy. Translational Psychiatry . 2018 May;8(1):p. 104. doi: 10.1038/s41398-018-0153-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chen L. Y., Qi J., Xu H. L., Lin X. Y., Sun Y. J., Ju S. Q. The Value of Serum Cell-Free DNA Levels in Patients With Schizophrenia. Frontiers in Psychiatry . 2021 March;12:p. 637789. doi: 10.3389/fpsyt.2021.637789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bianchi D. W., Chiu R. W. K. Sequencing of Circulating Cell-Free DNA During Pregnancy. New England Journal of Medicine . 2018 August;379(5):464–473. doi: 10.1056/NEJMra1705345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hummel E. M., Hessas E., Müller S., et al. Cell-Free DNA Release Under Psychosocial and Physical Stress Conditions. Translational Psychiatry . 2018 October;8(1):p. 236. doi: 10.1038/s41398-018-0264-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Haller N., Tug S., Breitbach S., Jörgensen A., Simon P. Increases in Circulating Cell-Free DNA During Aerobic Running Depend on Intensity and Duration. International Journal of Sports Physiology and Performance . 2017 April;12(4):455–462. doi: 10.1123/ijspp.2015-0540. [DOI] [PubMed] [Google Scholar]
  • 19.Breitbach S., Tug S., Simon P. Circulating Cell-Free DNA: An Up-Coming Molecular Marker in Exercise Physiology. Sports Medicine . 2012 July;42(7):565–586. doi: 10.2165/11631380-000000000-00000. [DOI] [PubMed] [Google Scholar]
  • 20.Konorova I. L., Veiko N. N. Emotional Stress in Rats Changes Concentration and Composition of Extracellular DNA Circulating in Blood Plasma Under Normal Conditions and in Cerebral Ischemia. Bulletin of Experimental Biology and Medicine . 2012 July;153(3):305–308. doi: 10.1007/s10517-012-1701-0. [DOI] [PubMed] [Google Scholar]
  • 21.Ershova E., Sergeeva V., Klimenko M., et al. Circulating Cell-Free DNA Concentration and DNase I Activity of Peripheral Blood Plasma Change in Case of Pregnancy With Intrauterine Growth Restriction Compared to Normal Pregnancy. Biomedical Reports . 2017 October;7(4):319–324. doi: 10.3892/br.2017.968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hofbauer T. M., Mangold A., Ondracek A. S., et al. Deoxyribonuclease 1 Q222R Single Nucleotide Polymorphism and Long-Term Mortality After Acute Myocardial Infarction. Basic Research in Cardiology . 2021 April;116(1):p. 29. doi: 10.1007/s00395-021-00864-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kawai Y., Yoshida M., Arakawa K., et al. Diagnostic Use of Serum Deoxyribonuclease I Activity as a Novel Early-Phase Marker in Acute Myocardial Infarction. Circulation . 2004 May;109(20):2398–2400. doi: 10.1161/01.CIR.0000129232.61483.43. [DOI] [PubMed] [Google Scholar]
  • 24.Kuribara J., Tada H., Kawai Y., et al. Levels of Serum Deoxyribonuclease I Activity on Admission in Patients With Acute Myocardial Infarction Can Be Useful in Predicting Left Ventricular Enlargement due to Remodeling. Journal of Cardiology . 2009 April;53(2):196–203. doi: 10.1016/j.jjcc.2008.10.013. [DOI] [PubMed] [Google Scholar]
  • 25.Korzeneva I. B., Kostuyk S. V., Ershova L. S., et al. Human Circulating Plasma DNA Significantly Decreases While Lymphocyte DNA Damage Increases Under Chronic Occupational Exposure to Low-Dose Gamma-Neutron and Tritium β-Radiation. Mutation Research, Fundamental and Molecular Mechanisms of Mutagenesis . 2015 September;779:1–15. doi: 10.1016/j.mrfmmm.2015.05.004. [DOI] [PubMed] [Google Scholar]
  • 26.Fernández-Domínguez I. J., Manzo-Merino J., Taja-Chayeb L., Dueñas-González A., Pérez-Cárdenas E., Trejo-Becerril C. The Role of Extracellular DNA (exDNA) in Cellular Processes. Cancer Biology & Therapy . 2021 April;22(4):267–278. doi: 10.1080/15384047.2021.1890319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Moya G. E., Rivera P. D., Dittenhafer-Reed K. E. Evidence for the Role of Mitochondrial DNA Release in the Inflammatory Response in Neurological Disorders. International Journal of Molecular Sciences . 2021 June;22(13):p. 7030. doi: 10.3390/ijms22137030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tian Y., Charles E. J., Yan Z., et al. The Myocardial Infarct-Exacerbating Effect of Cell-Free DNA Is Mediated by the High-Mobility Group Box 1-Receptor for Advanced Glycation End Products-Toll-Like Receptor 9 Pathway. The Journal of Thoracic and Cardiovascular Surgery . 2019 June;157(6):2256–2269.e3. doi: 10.1016/j.jtcvs.2018.09.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Szilágyi M., Pös O., Márton É., et al. Circulating Cell-Free Nucleic Acids: Main Characteristics and Clinical Application. International Journal of Molecular Sciences . 2020 September;21(18):p. 6827. doi: 10.3390/ijms21186827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Speranskii A. I., Kostyuk S. V., Kalashnikova E. A., Veiko N. N. Enrichment of Extracellular DNA From the Cultivation Medium of Human Peripheral Blood Mononuclears With Genomic CpG Rich Fragments Results in Increased Cell Production of IL-6 and TNF-a via Activation of the NF-kB Signaling Pathway. Biomeditsinskaya Khimiya . 2016 March;62(3):331–340. doi: 10.18097/PBMC20166203331. [DOI] [PubMed] [Google Scholar]
  • 31.Aucamp J., Bronkhorst A. J., Badenhorst C. P., Pretorius P. J. A Historical and Evolutionary Perspective on the Biological Significance of Circulating DNA and Extracellular Vesicles. Cellular and Molecular Life Sciences . 2016 December;73(23):4355–4381. doi: 10.1007/s00018-016-2370-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ermakov A. V., Konkova M. S., Kostyuk S. V., Izevskaya V. L., Baranova A., Veiko N. N. Oxidized Extracellular DNA as a Stress Signal in Human Cells. Oxidative Medicine and Cellular Longevity . 2013;2013:1–12. doi: 10.1155/2013/649747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Glebova K., Veiko N., Kostyuk S., Izhevskaya V., Baranova A. Oxidized Extracellular DNA as a Stress Signal That May Modify Response to Anticancer Therapy. Cancer Letters . 2015 January;356(1):22–33. doi: 10.1016/j.canlet.2013.09.005. [DOI] [PubMed] [Google Scholar]
  • 34.Kozhina E. A., Ershova E. S., Okorokova N. A., et al. Extracellular DNA Containing (dG)n Motifs Penetrates Into MCF7 Breast Cancer Cells, Induces the Adaptive Response, and Can Be Expressed. Oxidative Medicine and Cellular Longevity . 2019 November;2019:1–16. doi: 10.1155/2019/7853492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kostyuk S. V., Ershova E. S., Martynov A. V., et al. In Vitro Analysis of Biological Activity of Circulating Cell-Free DNA Isolated From Blood Plasma of Schizophrenic Patients and Healthy Controls-Part 2: Adaptive Response. Genes . 2022 December;13(12):p. 2283. doi: 10.3390/genes13122283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ershova E. S., Shmarina G. V., Porokhovnik L. N., et al. In Vitro Analysis of Biological Activity of Circulating Cell-Free DNA Isolated From Blood Plasma of Schizophrenic Patients and Healthy Controls. Genes . 2022 March;13(3):p. 551. doi: 10.3390/genes13030551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Mittra I., Pal K., Pancholi N., et al. Cell-Free Chromatin Particles Released From Dying Host Cells Are Global Instigators of Endotoxin Sepsis in Mice. PLoS One . 2020 March;15(3):p. e0229017. doi: 10.1371/journal.pone.0229017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dutta A., Das M., Ghosh A., Rana S. Molecular and Cellular Pathophysiology of Circulating Cardiomyocyte-Specific Cell Free DNA (cfDNA): Biomarkers of Heart Failure and Potential Therapeutic Targets. Genes & Diseases . 2023 August;10(3):948–959. doi: 10.1016/j.gendis.2022.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hudecova I., Smith C. G., Hänsel-Hertsch R., et al. Characteristics, Origin, and Potential for Cancer Diagnostics of Ultrashort Plasma Cell-Free DNA. Genome Research . 2022 February;32(2):215–227. doi: 10.1101/gr.275691.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kostyuk S. V., Konkova M. S., Ershova E. S., et al. An Exposure to the Oxidized DNA Enhances Both Instability of Genome and Survival in Cancer Cells. PLoS One . 2013 October;8(10):p. e77469. doi: 10.1371/journal.pone.0077469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Puszyk W. M., Crea F., Old R. W. Unequal Representation of Different Unique Genomic DNA Sequences in the Cell-Free Plasma DNA of Individual Donors. Clinical Biochemistry . 2009;42(7-8):736–738. doi: 10.1016/j.clinbiochem.2008.11.006. [DOI] [PubMed] [Google Scholar]
  • 42.Sano H., Morimoto C. DNA Isolated From DNA/Anti-DNA Antibody Immune Complexes in Systemic Lupus Erythematosus Is Rich in Guanine-Cytosine Content. The Journal of Immunology . 1982 March;128(3):1341–1345. doi: 10.4049/jimmunol.128.3.1341. [DOI] [PubMed] [Google Scholar]
  • 43.Veiko N. N., Shubaeva N. O., Ivanova S. M., Speranskii A. I., Lyapunova N. A., Spitkovskii D. M. Blood Serum DNA in Patients With Rheumatoid Arthritis Is Considerably Enriched With Fragments of Ribosomal Repeats Containing Immunostimulatory CpG-Motifs. Bulletin of Experimental Biology and Medicine . 2006 September;142(3):313–316. doi: 10.1007/s10517-006-0354-2. [DOI] [PubMed] [Google Scholar]
  • 44.Korzeneva I. B., Kostuyk S. V., Ershova E. S., et al. Human Circulating Ribosomal DNA Content Significantly Increases While Circulating Satellite III (1Q12) Content Decreases Under Chronic Occupational Exposure to Low-Dose Gamma-Neutron and Tritium Beta-Radiation. Mutation Research, Fundamental and Molecular Mechanisms of Mutagenesis . 2016 September;791-792:49–60. doi: 10.1016/j.mrfmmm.2016.09.001. [DOI] [PubMed] [Google Scholar]
  • 45.Suárez-Méndez S., García-de la Cruz D. D., Tovilla-Zárate C. A., et al. Diverse Roles of mtDNA in Schizophrenia: Implications in Its Pathophysiology and as Biomarker for Cognitive Impairment. Progress in Biophysics and Molecular Biology . 2020 September;155:36–41. doi: 10.1016/j.pbiomolbio.2020.04.004. [DOI] [PubMed] [Google Scholar]
  • 46.Ershova E. S., Jestkova E. M., Martynov A. V., et al. Accumulation of Circulating Cell-Free CpG-Enriched Ribosomal DNA Fragments on the Background of High Endonuclease Activity of Blood Plasma in Schizophrenic Patients. International Journal of Genomics . 2019 August;2019:1–12. doi: 10.1155/2019/8390585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ershova E. S., Konkova M. S., Malinovskaya E. M., Kutsev S. I., Veiko N. N., Kostyuk S. V. Noncanonical Functions of the Human Ribosomal Repeat. Russian Journal of Genetics . 2020;56(1):30–40. doi: 10.1134/S1022795420010044. [DOI] [Google Scholar]
  • 48.Lawrence T. The Nuclear Factor NF-kappa B Pathway in Inflammation. Cold Spring Harbor Perspectives in Biology . 2009 December;1(6):p. a001651. doi: 10.1101/cshperspect.a001651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kawai T., Akira S. Toll‐Like Receptor and RIG‐1‐Like Receptor Signaling. Annals of the New York Academy of Sciences . 2008 November;1143:1–20. doi: 10.1196/annals.1443.020. [DOI] [PubMed] [Google Scholar]
  • 50.Briard B., Place D. E., Kanneganti T. D. DNA Sensing in the Innate Immune Response. Physiology . 2020 March;35(2):112–124. doi: 10.1152/physiol.00022.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wang B., Tian Y., Yin Q. AIM2 Inflammasome Assembly and Signaling. Advances in Experimental Medicine and Biology . 2019;1172:143–155. doi: 10.1007/978-981-13-9367-9_7. [DOI] [PubMed] [Google Scholar]
  • 52.Sharma B. R., Karki R., Kanneganti T. D. Role of AIM2 Inflammasome in Inflammatory Diseases, Cancer and Infection. European Journal of Immunology . 2019 November;49(11):1998–2011. doi: 10.1002/eji.201848070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Rajesh Y., Kanneganti T. D. Innate Immune Cell Death in Neuroinflammation and Alzheimer’s Disease. Cells . 2022 June;11(12):p. 1885. doi: 10.3390/cells11121885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Motwani M., Pesiridis S., Fitzgerald K. A. DNA Sensing by the cGAS-STING Pathway in Health and Disease. Nature Reviews Genetics . 2019 November;20(11):657–674. doi: 10.1038/s41576-019-0151-1. [DOI] [PubMed] [Google Scholar]
  • 55.Roh J. S., Sohn D. H. Damage-Associated Molecular Patterns in Inflammatory Diseases. Immune Network . 2018 August;18(4):p. e27. doi: 10.4110/in.2018.18.e27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Xu X. X., Wan H., Nie L., Shao T., Xiang L. X., Shao J. Z. RIG-I: A Multifunctional Protein Beyond a Pattern Recognition Receptor. Protein & Cell . 2018 March;9(3):246–253. doi: 10.1007/s13238-017-0431-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Chiu Y. H., Macmillan J. B., Chen Z. J. RNA Polymerase III Detects Cytosolic DNA and Induces Type I Interferons Through the RIG-I Pathway. Cell . 2009 August;138(3):576–591. doi: 10.1016/j.cell.2009.06.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mitchell S., Vargas J., Hoffmann A. Signaling via the NFκB System. WIREs Systems Biology and Medicine . 2016 May;8(3):227–241. doi: 10.1002/wsbm.1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Macanovic M., Lachmann P. J. Measurement of Deoxyribonuclease I (DNase) in the Serum and Urine of Systemic Lupus Erythematosus (SLE)-Prone NZB/NZW Mice by a New Radial Enzyme Diffusion Assay. Clinical and Experimental Immunology . 2003 May;108(2):220–226. doi: 10.1046/j.1365-2249.1997.3571249.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Chestkov I. V., Jestkova E. M., Ershova E. S., et al. Abundance of Ribosomal RNA Gene Copies in the Genomes of Schizophrenia Patients. Schizophrenia Research . 2018 July;197:305–314. doi: 10.1016/j.schres.2018.01.001. [DOI] [PubMed] [Google Scholar]
  • 61.Mrakic-Sposta S., Montorsi M., Porcelli S., et al. Effects of Prolonged Exposure to Hypobaric Hypoxia on Oxidative Stress: Overwintering in Antarctic Concordia Station. Oxidative Medicine and Cellular Longevity . 2022 April;2022(1):p. 4430032. doi: 10.1155/2022/4430032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Yadav A. P., Mishra K. P., Ganju L., Singh S. B. Wintering in Antarctica: Impact on Immune Response of Indian Expeditioners. Neuroimmunomodulation . 2012;19(6):327–333. doi: 10.1159/000339512. [DOI] [PubMed] [Google Scholar]
  • 63.Shearer W. T., Lee B. N., Cron S. G., et al. Suppression of Human Anti-Inflammatory Plasma Cytokines IL-10 and IL-1RA With Elevation of Proinflammatory Cytokine IFN-Gamma During the Isolation of the Antarctic Winter. Journal of Allergy and Clinical Immunology . 2002 May;109(5):854–857. doi: 10.1067/mai.2002.123873. [DOI] [PubMed] [Google Scholar]
  • 64.Feuerecker M., Crucian B., Salam A. P., et al. Early Adaption to the Antarctic Environment at Dome C: Consequences on Stress-Sensitive Innate Immune Functions. High Altitude Medicine & Biology . 2014 September;15(3):341–348. doi: 10.1089/ham.2013.1128. [DOI] [PubMed] [Google Scholar]
  • 65.Shirai T., Magara K. K., Motohashi S., et al. TH1-Biased Immunity Induced by Exposure to Antarctic Winter. Journal of Allergy and Clinical Immunology . 2003 June;111(6):1353–1360. doi: 10.1067/mai.2003.1504. [DOI] [PubMed] [Google Scholar]
  • 66.Mehta S. K., Pierson D. L., Cooley H., Dubow R., Lugg D. Epstein-Barr Virus Reactivation Associated With Diminished Cell-Mediated Immunity in Antarctic Expeditioners. Journal of Medical Virology . 2000 June;61(2):235–240. doi: 10.1002/(sici)1096-9071(200006)61:2<235::aid-jmv10>3.0.co;2-4. [DOI] [PubMed] [Google Scholar]
  • 67.Razavi P., Li B. T., Brown D. N., et al. High-Intensity Sequencing Reveals the Sources of Plasma Circulating Cell-Free DNA Variants. Nature Medicine . 2019 December;25(12):1928–1937. doi: 10.1038/s41591-019-0652-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Gannushkina I. V., Konorova I. L. [Cell-Free Plasmic DNA as a Blood Factor Determining Hemodynamics in Health and in Vascular Pathology] Patologicheskaya Fiziologiya I Eksperimental’naya Terapiya . 2008 July;3:2–10. [PubMed] [Google Scholar]
  • 69.Yasuda T., Kawai Y., Ueki M., Kishi K. Clinical Applications of DNase I, a Genetic Marker Already Used for Forensic Identification. Legal Medicine . 2005 July;7(4):274–277. doi: 10.1016/j.legalmed.2004.10.008. [DOI] [PubMed] [Google Scholar]
  • 70.Yasutomo K., Horiuchi T., Kagami S., et al. Mutation of DNASE1 in People With Systemic Lupus Erythematosus. Nature Genetics . 2001 August;28(4):313–314. doi: 10.1038/91070. [DOI] [PubMed] [Google Scholar]
  • 71.Veĭko N. N., Bulycheva N. V., Roginko O. A., et al. [Ribosomal Repeat in the Cell Free DNA as a Marker for Cell Death] Biomeditsinskaya Khimiya . 2008 January;54(1):78–93. [PubMed] [Google Scholar]
  • 72.Nirwan M., Halder K., Saha M., Pathak A., Balakrishnan R., Ganju L. Improvement in Resilience and Stress-Related Blood Markers Following Ten Months Yoga Practice in Antarctica. Journal of Complementary and Integrative Medicine . 2020 June;18(1):201–207. doi: 10.1515/jcim-2019-0240. [DOI] [PubMed] [Google Scholar]
  • 73.Malinovskaya E. M., Ershova E. S., Okorokova N. A., et al. Ribosomal DNA as DAMPs Signal for MCF7 Cancer Cells. Frontiers Oncology . 2019 May;9:p. 445. doi: 10.3389/fonc.2019.00445. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Additional supporting information can be found online in the Supporting Information section.

8994730.f1.docx (119.1KB, docx)

Data Availability Statement

The data that support the findings of this study are available in the supporting information of this article.

Articles from Biochemistry Research International are provided here courtesy of Wiley

RESOURCES