Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2025 Sep 16;15(10):351. doi: 10.1007/s13205-025-04459-3

A simplified crude sap-based detection of cucumber mosaic virus in chilli germplasm through reverse transcription recombinase polymerase amplification assay (RT-RPA)

CH Anusha 1, A Rajashree 2, B Parameswari 2,✉, Vijay Mahanthesh 3, V Venkataravanappa 4, P Pranusha 2, Vinod Kumar Sharma 5, S K Mangrauthia 6, V Kavi Sidharthan 7, B Vidya Sagar 1, B Bhaskar 2, L Saravanan 2, V Celia Chalam 5
PMCID: PMC12440836  PMID: 40969861

Abstract

Chilli cultivation is under constant threat by many pests and diseases, and about 35 viruses are known to infect chilli globally. Among the viruses, the cucumber mosaic virus (CMV) is the most significant constraint to chilli production worldwide. Detection of CMV in infected plants, reverse transcription-polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA) methods are employed frequently. These conventional methods have been time consuming, laborious and expensive for detection of samples in low resource laboratories. In order to provide alternatives for the conventional methods currently various isothermal amplification methods have been employed. The present study exhibits the optimisation of the reverse transcription recombinase polymerase amplification (RT-RPA) assay by eliminating the steps of ribonucleic acid extraction, cDNA conversion, and the use of a thermal cycler. The optimized RT-RPA assay successfully detected CMV at concentrations as low as 10–10 (100 fg) and 10–9 dilutions of both RNA and crude sap templates, demonstrating high sensitivity comparable to the routine RT-PCR assay. Specificity tests confirmed that the RT-RPA assay did not exhibit cross-reactivity with other common chilli-infecting viruses, such as chilli leaf curl virus (ChiLCV), chilli veinal mottle virus (ChiVMV), capsicum chlorosis virus (CaCV), and groundnut bud necrosis virus (GBNV). Its ability to function efficiently with crude sap as a template further enhances its field applicability, making it a promising tool for early virus detection in low-resource laboratories and onsite diagnostics. The integration of such isothermal amplification techniques could revolutionize plant virus detection and management strategies, ultimately aiding in the mitigation of crop losses and ensuring food security.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-025-04459-3.

Keywords: Cucumber mosaic virus, Reverse transcription polymerase chain reaction, Reverse transcription recombinase polymerase amplification, Crude leaf sap, Rapid detection

Introduction

Chilli (Capsicum spp.) has been an indispensable crop with both commercial and cultural importance all over the world. Apart from that, India being the largest producer, consumer and exporter of chillies, production and protection of quantity and quality of the has been given more importance. Chilli crops are vulnerable for infection of various pathogens such as fungi, bacteria and viruses (Awasthi and Kumar 2008). Among these, viral diseases transmitted by insect vectors are posing a serious threat to chilli production. According to Pernezny et al. (2003), there are roughly 68 viruses that infect chillies. Groundnut bud necrosis virus (GBNV), tomato leaf curl New Delhi virus (TLCNDV) (Khan et al. 2006), cucumber mosaic virus (CMV) (Kiranmai et al. 1998; Rajamanickam and Nakkeeran 2020; Vinodhini et al. 2021), and chilli veinal mottle virus (ChiVMV) (Banerjee et al. 2014) are some of the viral diseases that are reported. Cucumber mosaic virus (CMV), belonging to the Cucumovirus genus from the family Bromoviridae, is a tripartite linear single stranded positive sense RNA virus. Its presence is seen globally due to its diversified host range. Apart from chilli, it is found to have infected approximately 1250 plant species around the world and it includes vegetable and fruit crops which includes tomato, cucurbits, legumes and more. It is also found to infect woody, semi woody plants and in weeds. In weeds the virus is not associated with symptoms but it is found to have been a seed transmitted disease (Palukaitis et al. 1992; Grube et al. 2000; Palukaitis and García-Arenal 2003; Jacquemond 2012). In addition to being easily spread by mechanically inoculating plant sap, CMV is also spread by over 80 aphid species across 33 genera in a non-persistent manner (Shah et al. 2015). Early-stage CMV infection in crops, such as chilli plants, manifests as chlorotic local lesions between the secondary leaf veins. The CMV causes different types of symptoms in chilli and the most common symptoms observed are mosaic, mottling, vein clearing, yellow discoloration, leaf narrowing or shoe-string (Conti et al. 1979). The occurrence of CMV on chilli based on symptoms in Hyderabad and Warangal region of erstwhile Andhra Pradesh state was reported by Anjaneyula and Appa Rao (1967). Plants can be asymptomatic initially but necrosis of fruits (losses are fairly decreased in this case) or typical but harsher symptoms (losses might be extremely high in this case), depending on a number of circumstances, including the presence of satellite RNAs. (Vinodhini et al. 2020).

CMV isolates have been clustered into two groups, I and II, according to serology, nucleic acid hybridization, and gene sequences (Dubey and Aminuddin 2010; Dubey et al. 2015). Roossinck (2001) divided subgroup I into IA and IB based on gene sequences and phylogenetic analysis. IA and IB are more common in tropical and subtropical regions, where they significantly reduce plant yields, while group II isolates are more common in temperate regions. The CMV genome has three segments of RNA (RNA1, RNA2 and RNA3) along with two subgenomic RNAs as RNA4 and RNA4a (Dreher 2009). All the three segments are encapsulated into capsid and are translated and replicated using the host machinery (Vinodhini et al. 2020). CMV induces systemic infection in host plants and once the host plant is infected it cannot escape virus takeover of host machineries. There is no significant defence mechanism against CMV from the host side (Pagán and García-Arenal 2022). Removal and quarantining of infected plant materials have been used as the effective disease management strategy. Use of viral free propagative plant material has been a preventive measure against CMV infection (Anikina et al. 2023). Hence early detection and diagnosis plays a major role in the disease management of CMV in chilli.

Multiple techniques have been deployed to identify CMV and distinguish between virus groups which includes serology based techniques viz., Double Antibody Sandwich Enzyme-Linked Immuno-Sorbent Assay (DAS-ELISA) and Direct Antigen Coating Enzyme-Linked Immunosorbent Assay (DAC-ELISA) (Haase et al. 1989), RT-PCR (Wylie et al. 1993) coupled with the RFLP (Sialer et al. 1999) or sequence analyses (Wikoff et al. 1997) and recent assays using isothermal amplification such as RT-LAMP and exo-RT-RPA (Peng et al. 2012; Srivastava et al. 2019).

Recombinase Polymerase Amplification assay was pioneered by Piepenburg et al. (2006), which is now commercialised by TwistDx, United Kingdom. The assay is initiated by the recombinase enzyme obtained from T4 bacteriophage, which forms a complex with the RPA specific primers. This complex is loaded to the target nucleic acid using loading factors in the presence of ATP. The recombinase enzyme displaces the target nucleic acid strand which is stabilised by the Single Stranded Binding protein (SSB). The polymerase enzyme obtained from Bacillus subtilis binds to the 3′ end of the primer, extending the primer in the presence of dNTPs. Repeated cycles of this amplification lead to the achievement of exponential amplification (Anbazhagan et al. 2024). This technique has been established for the detection various plant pathogens such as Phytophthora infestans (Lu et al. 2020), Aphelenchoides besseyi (Subbotin 2024), sugarcane bacilliform virus (Parameswari et al. 2023) and peanut mottle virus (Parameswari et al. 2025) etc. In this study we have developed reverse transcription recombinase polymerase amplification assay for the first time to detect cucumber mosaic virus infecting in chilli crop.

Materials and methods

Sample collection

For the isolation of the potential pathogen, CMV suspected samples were collected from various fields of Telangana. In order to maintain the virus for subsequent testing in the glasshouse, the samples that were positive, confirmed using DAC-ELISA and RT-PCR assay were employed as inoculum. On two leaf-staged chilli and cucumber seedlings, the inoculation was carried out manually utilising the crude sap of the infected chilli leaves made with 0.5 M phosphate buffer with pH 7.0.

Nucleic acid extraction and molecular confirmation

The CMV infected leaf samples were subjected to RNA extraction using the Trizol method (Huczynski and Sacchi 1987). The quality and quantity of total RNA was quantified using a nanodrop. Using the TAKARA cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit), the in vitro transcription of the viral RNA was performed with CMV reverse primer according to the manufacturers protocol. To confirm the presence of CMV in the suspected samples, coat protein conserved domain primer CMVF/R was used to perform reverse transcription-polymerase chain reaction. The details of CMVF/R are mentioned in Table 1. The reaction mixture of 25 μL containing 12.5 μL of 1X Taq polymerase from G Biosciences, 1.25 μL of both forward and reverse primer CMVF/R, 7.5 μL of nuclease free water and 2.5 μL of. The following condition was used for amplification using the thermocycler: initial denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, initial extension at 72 °C for 2 min, final extension at 72 °C for 10 min. The process was repeated for 35 cycles from denaturation to initial extension. The end product was subjected to gel electrophoresis using 1% agarose gel stained with lab-safe stain (G-BIOSCIENCES, St. Louis, USA) and was further visualised using the gel-documentation system (IG-618GD, iGene Labserve Pvt. Ltd.). The amplified product was purified using PCR purification kit (QIAquick® PCR Purification Kit, Qiagen) and then cloned into the pGEM-T easy-vector (Promega, USA). Transformation of Escherichia coli DH5α competent cells was performed using recombinant vector. Transformants were chosen using blue-white screening on Luria agar plates that contained 23.8 mg/mL IPTG, 20 mg/mL Xgal, and 25 mg/mL ampicillin, followed by visualisation through gel electrophoresis. The transformed colonies were further validated by restriction digestion using EcoRI enzyme. The final validation was done using the sequencing of the amplified products of colony PCR of transformed colonies by Eurofins, Bangalore, India. Thus, obtained sequence was analysed using NCBI Blastn tool (http://www.ncbi.nlm.nih.gov/blast) and sequence submitted to NCBI GenBank with accession no: PV424336.

Table 1.

List of primers utilized for the current work

S. No Name of the Primer Primer Sequences (5´-3´) Bases GC (%) Annealing temperature Expected Amplicon length
Coat protein primers
1 CMV F GCATTCTAGATGGACAAATCTGAATC 26 38.5 58 °C 720 bp
2 CMV R GCATGGTACCTCAAACTGGGAGCAC 25 56
RPA primers
1 CMV FP1 GGTCGTCCTACTATTAACCACCCAACCTTTGTGG 34 50 58 °C 241 bp
2 CMV RP1 GAACTTTACGGACTGTCACCCACACGGTAGAATC 34 50
3 CMV FP2 ACCTGTCCGTTTCCGCCATCTCTGCCATGTTTG 33 55 58 °C 239 bp
4 CMV RP2 CGTGGGAATGCGTTGGTGCTCAATGTCGACATG 33 55
5 CMV FP3 TGTGGGTGACAGTCCGTAAAGTTCCTGCCTC 31 55 58 °C 230 bp
6 CMV RP3 GTCCGTCTCGAGCGCATCGTCTTTTGAATACACG 34 53
Open in a new tab

RPA primers designing and standardisation

The RPA-specific primers were designed according to the TwistAmp kit protocol from the coat protein sequence of CMV submitted to NCBI (Accession no: PV424336) as reference. Main difference between the normal RT-PCR primers and RT-RPA primers is the length of nucleotides and the size of the amplicon which is 30–35 nt and 100–300 bp, respectively. The Table 1. shows the list of RT-RPA primers along with its GC% content and amplicon size. Thus designed three pairs of RPA primers were synthesised from Integrated DNA technologies (IDT) (Iowa, USA). The standardisation of the RPA primers of CMV were done using RT-PCR at three different annealing temperatures of 54 °C, 56 °C and 58 °C under following conditions: initial denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, initial extension at 72 °C for 2 min, final extension at 72 °C for 10 min. The process was repeated for 35 cycles from denaturation to initial extension. The end product was subjected to gel electrophoresis using 1% agarose gel and was further visualised using the geldocumentation system (IG-618GD, iGene Labserve Pvt. Ltd.). The optimised primer was used to perform for further RT-RPA assays.

Reverse transcription-recombinase polymerase amplification assay

The RT-RPA assay was optimised for the all the three primer pairs such as CMV 1F/1R, CMV 2F/2R and CMV 3F/3R respectively with at standard temperature of 37 °C for 30 min followed by heat inactivation at 65 °C for 10 min using dry bath (BT-MINIB-100, BT Lab Systems) to evaluate their efficiency in RPA condition. The reaction mixture consists of 2.1 µL of forward and reverse primer of RPA primer pair (10 µmol µL−1), 29.5 µL of Rehydration Buffer and 8.3 µL of nuclease free water (NFW), totalling 43.5 µL which was then added to the frozen pellets and were mixed thoroughly using pipette. The final reaction mixture was then transferred equal in to two 1.5 mL capacity microcentrifuge tubes (21.75 µL each). Subsequently 1 µL of template cDNA and 1.25 µL of 280 µM magnesium acetate to each tube (1.5 mL capacity). The final reaction mixture was quick spined in a mini spin (Mini -10k+, BR Biochem Life Science pvt.ltd.) to facilitate proper mixing and to initiate the process of amplification. The amplified product along with loading dye was mixed properly and loaded in 1% agarose gel electrophoresis and visualized in UV-Gel imager (IG-618GD, iGene Labserve pvt. ltd.).

Optimisation of Crude sap based RT-RPA assay

The RT-RPA assay was performed using the crude sap as template, where the crude sap was prepared from 10 different buffers such as sterile distilled water, SDW, Tris buffer, 1N NaOH buffer, Trizol, 0.5 M Phosphate buffer, 5% CTAB buffer, 10% CTAB buffer, RLC buffer, RLT buffer, 1:1 NaOH: EDTA respectively. CMV infection confirmed leaf samples of 100 mg was homogenised with 1 ml of each buffer with a sterile pre chilled mortar and pestle to yield crude sap. Thus, obtained sap was subjected for the centrifugation at 10,000 g for 2 min and supernatant obtained was used as template-in the RT-RPA assay along with 0.5 µL of RNAse-inhibitor and 1 µL of reverse-transcriptase enzyme to the reaction mixture. The reaction carried out at standard temperature of 37 °C for 30 min then heat inactivated at 65 °C for 10 min using dry bath (BT-MINIB-100, BT Lab Systems). The crude-sap obtained from the buffer which gave specific, thick and bright product was utilised for the further optimisation of temperature and time. The temperature standardisation was performed using the crude sap as template at temperatures ranging from 5 °C to 50 °C with increment of 5 °C. Similarly, the time period was standardised at the standardised temperature using crude sap as template at time period from 5 to 50 min with time interval of 5 min. RT-RPA assays were standardized and performed in triplicates; only reproducible results were included in subsequent analyses.

Comparative analysis of sensitivity between RT-PCR, RT-RPA and RPA

The limit-of-detection of CMV was evaluated using several serial-dilutions of purified RNA with initial concentration of 102 (100 ng/ µL), Crude-Sap of infected leaf obtained from 100 mg of leaf sample homogenised in 1 ml of standardised lysis buffer and plasmid-DNA containing CMV CP specific gene with initial concentration of 102 (100 ng/ µL) as templates for RT-PCR and RT-RPA techniques. The RT-PCR and RT-RPA was performed at standardised conditions with respective templates and the amplified products were subjected to gel electrophoresis analysis.

Cross reactivity test for developed RT-RPA assay

Cross reactivity of the developed RT-RPA assay was tested by using the crude-sap obtained from chilli leaf samples infected with other common viruses like chilli leaf curl virus (ChiLCV), chilli veinal mottle virus (ChiVMV), capsicum chlorosis virus (CaCV), and groundnut bud necrosis virus (GBNV) as template for the developed assay.

Field validation of the developed RT-RPA assay

The developed RT-RPA assay was further evaluated by employing RT-PCR and RT-RPA assay for detection of CMV in samples collected from 50 chilli germplasms grown in the kharif season of 2024 at ICAR-NBPGR Regional Station, Hyderabad. The supplementary Table 1 consists of the details of the chilli germplasm.

Results

Detection and confirmation of CMV in symptomatic chili crops

Chilli leaf samples showing possible CMV infection were gathered from farmer’s fields across Telangana state. The CMV virus inoculum was maintained in chilli and cucumber hosts in the glasshouse at NBPGR-RS, Hyderabad (Fig. 1). Molecular confirmation of CMV infection was confirmed using CMVF/R primers designed for targeting the coat protein region of CMV virus with amplicon size 720 bp. The suspected samples were tested along with healthy and negative control (Fig. 2a). Nucleotide Blast analysis of the obtained sequence showed more than 90% identity with CP gene sequence of a CMV isolate with NCBI accession no: ON013895.

Fig. 1.

Fig. 1

Open in a new tab

a Chilli field in NBPGR, RS Hyderabad, Telangana; b Chilli plant showing mosaic symptoms; c Chilli plants maintained in glass house showing CMV symptoms; d CMV maintained in cucumber plants in glass house

Fig. 2.

Fig. 2

Open in a new tab

a Molecular confirmation of CMV using conserved primers of coat protein; b RPA primer optimisation in different temperatures: M represents GeneRuler™ 1 kb ladder (Gene BioScience), lane 1–3 represents CMVFP1/RP1 at 54 °C, 56 °C and 58 °C, lane 4–6 represents CMVFP2/RP2 at 54 °C, 56 °C and 58 °C, lane 7–9 represents CMVFP3/RP3 at 54 °C, 56 °C and 58 °C respectively using RT-PCR; c RPA primer optimisation at standard RT-RPA conditions at 37 °C for 30 min: lane 1–2 represents CMVFP1/RP1, lane 3–4 represents CMVFP2/RP2, lane 4–5 represents CMVFP3/RP3; (D) Replicability test of RT-RPA assay using the optimised primer CMVFP2/RP2

Evaluation of RT-RPA primers using RT-PCR and RT-RPA

With the sequenced coat protein region as reference, three pairs of RPA primers such as CMV FP1/RP1, CMV FP2/RP2, and CMV FP3/RP3 respectively were designed (Table 1). The efficiency of the designed primers was evaluated initially using RT-PCR and later with RT-RPA (Fig. 2). Among the three pairs of primer, CMV FP1/RP1 and CMV FP2/ RP2 primers showed amplification for all the three temperatures such as 54 °C, 56 °C and 58 °C in RT-PCR (Fig. 2b), whereas the CMV FP2/RP2 and CMV FP3/RP3 showed amplification in RT-RPA assay at 37 °C for 30 min (Fig. 2c). The primer pair CMV FP2/RP2 showed amplification of desired amplicon size of 239 bp both in RT-PCR and RT-RPA while other pair of primers failed to amplify either in RT-PCR or RT-RPA assay in standard conditions. Hence CMV FP2/RP2 primer pair was used for the further assay.

Crude sap-based RT-RPA assay optimisation

The crude sap prepared from 10 different buffers were employed as template for RT-RPA assay at standard temperature and time of 37 °C for 30 min (Fig. 3). The templates obtained from lysis buffers such as Tris buffer (pH 7.5, 1 M), 1N NaOH buffer, Trizol reagent (RDP Trio ™ Reagent), phosphate buffer (pH 7.0, 0.1 M) and NaOH: EDTA (1:1) were found to be amplified using RT-RPA assay at standard temperature (Fig. 3a). The amplification obtained using crude sap obtained using phosphate buffer (pH 7.0, 0.1 M) was found to be precise whereas other lysis buffers showed smeared bands even after thrice repeating the assay. Hence the crude sap obtained from phosphate buffer (pH 7.0, 0.1 M) was used for standardising the temperature and time of the RT-RPA assay. Crude sap-based RT-RPA assays conducted at temperatures between 5 °C and 50 °C with increment of 5 °C, the amplification was seen in the temperatures of 20–40 °C and out of which the amplification was quantitatively more at 35 °C (Fig. 3b). The crude sap-based RT-RPA assays performed at 35 °C at different time periods from 5 to 50 min with 5 min intervals, the amplification was observed to be most at 20 min of incubation (Fig. 3c).

Fig. 3.

Fig. 3

Open in a new tab

Crude sap based RT-RPA assay optimisation of CMV infected leaf sample a Buffer optimisation: GeneRuler™ 1 kb ladder (Gene BioScience), lane 1- 10 represents RT-RPA assay using SDW, Tris buffer, 1N NaOH buffer, TRIzol, 0.5 M Phosphate buffer, 5% CTAB buffer, 10% CTAB buffer, RLC buffer, RLT buffer, 1:1 NaOH: EDTA respectively; b Temperature optimisation of RT-RPA assay using different temperatures: 5 °C, 10 °C, 15 °C, 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C and 60 °C. c Time optimisation of RT-RPA assay at different time intervals: 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min and 50 min

Specificity of the developed RT-RPA in detection of CMV

Crude sap obtained from chilli leaf sample infected with chilli leaf curl virus (ChiLCV), chilli veinal mottle virus (ChiVMV), capsicum chlorosis virus (CaCV) and groundnut bud necrosis virus (GBNV) were tested with the developed RT-RPA assay. There was no cross-reactivity was found with all the above viruses (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Validation of RT-RPA assay for its detection and specificity towards CMV infected plants and absence of amplification from the plants and absence of amplification from the plants infected with other viruses viz., chilli leaf curl virus (ChiLCV), chilli veinal mottle virus(ChiVMV), capsicum chlorosis virus (CaCV), and groundnut bud necrosis virus (GBNV) using CMVFP2/RP2 amplifying 239 bp of amplicon where, Lane M: GeneRuler™ 1 kb DNA ladder (Gene BioScience). (1) ChiLCV (Negative amplification) (2) ChiVMV (Negative amplification) (3) CaCV (Negative amplification) (4) GBNV (Negative amplification) and (5) CMV (Positive amplification)

Comparison of sensitivity of the developed assay using RNA, crude sap and plasmid as template

The sensitivity of the developed RT-RPA (Ribonucleic acid as template) and RPA (plasmid as template) assays was compared with the regular RT-PCR and PCR assays by detection of template after serial dilution of the original stock of RNA with an initial concentration of 102 ng/µL. Crude sap with initial stock made up of 100 mg of infected tissue homogenized in 1000 µl of phosphate buffer and plasmid DNA with an initial concentration of 102 ng/µl. In comparison to RT-PCR, which detected up to the dilution of 10–11 (1.0 × 10–6 pg/Ll) with cDNA as a template, the developed RT-RPA was able to detect a dilution of 10–10 (1.0 × 10–5 pg/µL) with RNA as a template (Fig. 5). In the case of crude sap as a template, the RT-PCR did not amplify, whereas the developed RT-RPA assay was able to detect till the dilution of 10–12 of crude sap as a template (Fig. 6). The comparative analysis of PCR and RPA assays in the case of plasmid DNA as a template found the amplification till 10–21 and 10–20 respectively (Fig. 7).

Fig. 5.

Fig. 5

Open in a new tab

Comparative analytical sensitivity of RT-PCR and RT -RPA using RNA as template. Lane M: GeneRuler™ 1 kb ladder (G-BioSciences), Lane 1–11: shows different dilutions i.e. 102, 101, 100, 10–1, 10–2, 10–3, 10–4, 10–5, 10–6, 10–7, 10–8,10–9, 10–10 and 10–11

Fig. 6.

Fig. 6

Open in a new tab

Comparative analytical sensitivity of RT-PCR and RT -RPA using crude sap as template. Lane M: GeneRuler™ 1 kb ladder (G-BioSciences), Lane 1–11: shows different dilutions i.e. 102, 101, 100, 10–1, 10–2, 10–3, 10–4, 10–5, 10–6, 10–7, 10–8, 10–9, 10–10, 10–11 and 10–12

Fig. 7.

Fig. 7

Open in a new tab

Comparative analytical sensitivity of PCR and RPA using plasmid as template. Lane M: GeneRuler™ 1 kb ladder (G-BioSciences), Lane 1–11: shows different dilutions i.e. 102 to 10–21 

Evaluation of RT-RPA method for identifying CMV

The evaluation of the developed RT-RPA assay in the detection CMV, it was employed in detection of random samples from 50 germplasms grown in the kharif season of 2024 at ICAR- National Bureau of Plant Genetic Resources, Regional Station at Hyderabad, Telangana, along with RT-PCR assay (Supplementary Table 1). The deployed RT-RPA assay was able to detect 31 positive samples and RT-PCR was able to detect only 26 positive samples (Supplementary Fig. 1.). Out of the 5 samples which showed positive in RT-RPA but showed negative in RT-PCR, 2 samples were asymptomatic at the time detection but later in the upcoming weeks developed the typical symptoms of CMV infection.

Discussion

Cucumber mosaic virus (CMV) is regarded as one of the earliest known viruses (Tomlinson 1987) and is notorious for causing severe infections across a wide range of crops. Its extensive host range, along with transmission through aphid vectors, mechanical means, and in some cases through seeds, makes CMV a highly destructive pathogen. It affects a variety of crops including vegetables, cereals, ornamentals, and fruit plants (Palukaitis and García-Arenal 2003). CMV poses a major challenge to chilli production globally (Palukaitis et al. 1992), and outbreaks have been reported in key vegetable crops such as chilli (pepper), tomato, celery, melon, zucchini squash, and tobacco in Italy (Gallitelli 2000). In China, CMV has been responsible for a reduction of 20–40% in marketable yield in several chilli-producing regions (Li et al. 2020). In India, Ramesh and Sreenivasulu (2018) identified CMV as the most damaging virus affecting chilli and brinjal in terms of both incidence and yield loss in the Chittoor region of Andhra Pradesh. Ashwathappa et al. (2021) also highlighted CMV, ChiVMV, and ChiLCV as major pathogens capable of causing up to complete (100%) crop loss.

The widely used detection techniques are either serological (DAC-ELISA) or nucleic acid-based detection methods (RT-PCR and qRT-PCR). The conventional methods require high resources, skilled labour and are time consuming. Recently various methods have been explored for overcoming the disadvantages in the traditional methods and incorporating the efficiency and sensitivity at least as comparable to the traditional methods. Currently various isothermal amplification methods such RT-LAMP, RT-RPA and RT-RAA have been exploited in the detection RNA viruses. Recently various isothermal amplification methods such as Reverse Transcription- Loop Mediated Isothermal Amplification (RT-LAMP) have been employed in the detection of CMV in banana (Peng et al. 2012). Srivastava et, al. (2019) has successfully detected CMV in banana plants using fluorescence-based real-time isothermal reverse transcription recombinase polymerase amplification assay. All these studies have aimed in the development of detection methods that can be utilised in low resource laboratory and can further be utilised in the development of rapid and on-site detection of CMV.

Using crude sap as a template, the current study sought to increase the applicability of RT-RPA for ultra-sensitive detection of CMV. The efficiency and specificity of the newly developed RT-RPA assay were assessed by optimizing and validating it against RT-PCR. With cDNA as a template, RT-PCR was only able to identify CMV up to a 10⁻11 dilution (1.0 × 10⁻⁶ pg/µL), whereas RT-RPA was able to detect it up to a 10⁻1⁰ dilution (1.0 × 10⁻5 pg/µL). Additionally, when crude sap was employed as a template, RT-RPA performed better than RT-PCR, effectively detecting CMV even at a 10⁻12 dilution, whereas RT-PCR was unable to amplify the samples. Notably, the assay outperformed RT-PCR in terms of sensitivity while using crude sap as template. Specificity tests confirmed that the RT-RPA assay did not exhibit cross-reactivity with other common chilli-infecting viruses, such as chilli leaf curl virus (ChiLCV),chilli veinal mottle virus (ChiVMV), capsicum chlorosis virus (CaCV), and groundnut bud necrosis virus (GBNV). This specificity underscores the robustness of RT-RPA for CMV detection in chilli crops. The field validation of the developed RT-RPA assay further reinforced its reliability, when tested on 50 chilli germplasms. The developed RT-RPA assay successfully identified 31 CMV-positive samples, whereas RT-PCR detected only 26. Interestingly, five samples that were RT-RPA positive but RT-PCR negative were later confirmed to be CMV-infected as they exhibited symptoms weeks after testing. This suggests that RT-RPA is not only more sensitive but also capable of detecting CMV infection at the early-stage, even before visible symptoms appear. When comparing the RT-PCR and RT-RPA assays, the RT-RPA assay takes one to one and a half hours from sample preparation to final results and costs roughly 290 Rupees each sample, which is five times less expensive than the RT-PCR assay, which takes 3.5 h and costs almost 1300 Rupees per sample (Parameswari et al. 2025).

In the real-time application, the potential of the currently developed diagnostic technique to detect cucumber mosaic virus can be widened by coupling crude sap-based RPA assay with detection techniques such as probe based fluorescence detection, nano-material based biosensors, and lateral flow strip-based assay. CRISPR-based diagnostics, such as those using Cas12 or Cas13, have been developed for other plant and human viruses, leveraging their ability to specifically recognize and cleave viral nucleic acids. These systems can be adapted for rapid, sensitive, and field-deployable detection of RNA viruses like CMV (Robertson et al. 2022; Zhan et al. 2024) However, as of now, there is no published protocol or commercial kit utilizing CRISPR for CMV detection in chilli. The technology holds promise, and the principles established for other viruses suggest that with appropriate guide RNA design targeting CMV-specific sequences, a CRISPR-based detection assay could be developed for chilli in the future. When paired with a cost-effective fluorescence visualization setup, the portable assay delivers sensitivity that is 100 times higher than traditional methods (Anbazhagan et al. 2024).

Conclusion

In summary, the RT-RPA assay developed in this study offers a highly sensitive, specific, and rapid alternative for CMV detection in chilli crops. Its ability to function efficiently with crude sap as a template further enhances its field applicability, making it a promising tool for early virus detection in low-resource laboratories and on-site diagnostics. The integration of such isothermal amplification techniques could revolutionize plant virus detection and management strategies, ultimately aiding in the mitigation of crop losses and ensuring food security.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 2969 KB) (2.9MB, docx)

Acknowledgements

This research was supported by grants from Science and Engineering Research Board, New Delhi for providing SERB POWER Fellowship Project to B. Parameswari (SPF/2023/000025) and the support from Director, ICAR-NBPGR, New Delhi for facilitating the required inputs.

Data availability

Sequence obtained in this study was submitted to NCBI GenBank with accession number: PV424336. The data that support the findings of this study are openly available in this manuscript and the supporting information is attached.

Declarations

Conflict of interest

The authors have no conflicts of interest.

Research involving human participants and/or animals

This experiment does not involve humans or animals.

References

  1. Anbazhagan P, Parameswari B, Anitha K, Chaitra GV, Bajaru B, Rajashree A, Mangrauthia SK, Yousuf F, Chalam VC, Singh GP (2024) Advances in plant pathogen detection: integrating recombinase polymerase amplification with CRISPR/Cas systems. 3 Biotech 14(9):214. 10.1007/s13205-024-04055-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anikina I, Kamarova A, Issayeva K, Issakhanova S, Mustafayeva N, Insebayeva M, Mukhamedzhanova A, Khan SM, Ahmad Z, Lho LH, Han H (2023) Plant protection from virus: a review of different approaches. Front Plant Sci 14:1163270. 10.3389/fpls.2023.1163270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anjaneyula A, Appa Rao A (1967) Natural occurrence of cucumber mosaic virus on chilli in India. Indian Phytopathol 20:380–381 [Google Scholar]
  4. Ashwathappa KV, Krishna Reddy M, Venkataravanappa V, Madhavi Reddy K, Hemachandra Reddy P, Lakshminarayana Reddy CN (2021) Genome characterization and host range studies of Cucumber mosaic virus belonging to the subgroup IB infecting chilli in India and screening of chilli genotypes for identification of resistance. VirusDis 32:535–547. 10.1007/s13337-021-00713-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Awasthi LP, Kumar P (2008) Response of chilli genotypes/cultivars against viral diseases. Indian Phytopathol 61(2):282–284 [Google Scholar]
  6. Banerjee A, Dutta R, Roy S, Ngachan SV (2014) First report of Chilli veinal mottle virus in Naga chilli (Capsicum chinense) in Meghalaya, India. VirusDis 25:142–143. 10.1007/s13337-013-0167-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Conti M, Caciagli P, Casetta A (1979) Infection sources and aphid vectors in relation to the spread of cucumber mosaic virus in pepper crops. Phytopathol Mediterr 18:123–128 [Google Scholar]
  8. Dreher TW (2009) Role of tRNA-like structures in controlling plant virus replication. Virus Res 139(2):217–229. 10.1016/j.virusres.2008.06.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dubey VK, Aminuddin SVP (2010) Molecular characterization of Cucumber mosaic virus infecting Gladiolus, revealing its phylogeny distinct from the Indian isolate and alike the Fny strain of CMV. Virus Genes 41:126–134. 10.1007/s11262-010-0483-6 [DOI] [PubMed] [Google Scholar]
  10. Dubey VK, Chandrasekhar K, Srivastava A, Aminuddin SVP, Dhar K, Arora PK (2015) Expression of coat protein gene of Cucumber mosaic virus (CMV-subgroup IA) Gladiolus isolate in Nicotiana tabacum. J Plant Interact 10(1):296–304. 10.1080/17429145.2015.1101496 [Google Scholar]
  11. Gallitelli D (2000) The ecology of Cucumber mosaic virus and sustainable agriculture. Virus Res 71(1–2):9–21. 10.1016/S0168-1702(00)00184-2 [DOI] [PubMed] [Google Scholar]
  12. Grube RC, Zhang Y, Murphy JF, Loaiza-Figueroa F, Lackney VK, Provvidenti R, Jahn MK (2000) New source of resistance to Cucumber mosaic virus in Capsicum frutescens. Plant Dis 84(8):885–891. 10.1094/PDIS.2000.84.8.885 [DOI] [PubMed] [Google Scholar]
  13. Haase A, Richter J, Rabenstein F (1989) Monoclonal antibodies for detection and serotyping of cucumber mosaic virus. J Phytopathol 127(2):129–136. 10.1111/j.1439-0434.1989.tb01121.x [Google Scholar]
  14. Jacquemond M (2012) Cucumber mosaic virus. Adv Virus Res 84:439–504. 10.1016/B978-0-12-394314-9.00013-0 [DOI] [PubMed] [Google Scholar]
  15. Khan MS, Raj SK, Singh R (2006) First report of Tomato leaf curl New Delhi virus infecting chilli in India. Plant Pathol 55(2):289. 10.1111/j.1365-3059.2006.01324.x [Google Scholar]
  16. Kiranmai G, Sreenivasulu P, Nayudu MV (1998) Epidemiology of cucumber mosaic cucumovirus isolates naturally infecting three solanaceous vegetable crops around Tirupati. Indian Phytopathol 51(4):315–318 [Google Scholar]
  17. Li N, Yu C, Yin Y, Gao S, Wang F, Jiao C, Yao M (2020) Pepper crop improvement against cucumber mosaic virus (CMV): a review. Front Plant Sci 11:598798. 10.3389/fpls.2020.598798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lu X, Zheng Y, Zhang F, Yu J, Dai T, Wang R, Tian Y, Xu H, Shen D, Dou D (2020) A rapid, equipment-free method for detecting Phytophthora infestans in the field using a lateral flow strip-based recombinase polymerase amplification assay. Plant Dis 104(11):2774–2778. 10.1094/PDIS-01-20-0203-SC [DOI] [PubMed] [Google Scholar]
  19. Pagán I, García-Arenal F (2022) Cucumber mosaic virus-induced systemic necrosis in Arabidopsis thaliana: determinants and role in plant defense. Viruses 14(12):2790. 10.3390/v14122790 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Palukaitis P, García-Arenal F (2003) Cucumoviruses. Adv Virus Res 62:241–323. 10.1016/s0065-3527(03)62005-1 [DOI] [PubMed] [Google Scholar]
  21. Palukaitis P, Roossinck MJ, Dietzgen RG, Francki RI (1992) Cucumber mosaic virus. Adv Virus Res 41:281–348. 10.1016/s0065-3527(08)60039-1 [DOI] [PubMed] [Google Scholar]
  22. Parameswari B, Sharma SK, Karthikaiselvi L, Wangkhem B, Nithya K, Viswanathan R, Rao GP, Chalam VC, Anitha K (2023) A simplified isothermal recombinase polymerase amplification assay for detection of sugarcane bacilliform virus infection. Sugar Tech 25(4):995–999. 10.1007/s12355-023-01258-z [Google Scholar]
  23. Parameswari B, Anbazhagan P, Rajashree A, Chaitra GV, Sidharthan K, Mangrauthia SK, Yousuf F, Anitha K, Prasanthi Y, Bhaskar B, Chalam C, Singh GP (2025) Development of reverse transcription recombinase polymerase amplification assay for rapid diagnostics of Peanut mottle virus. Physiol Mol Biol Plants 31(1):131–142. 10.1007/s12298-024-01545-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Peng J, Shi M, Xia Z, Huang J, Fan Z (2012) Detection of cucumber mosaic virus isolates from banana by one-step reverse transcription loop-mediated isothermal amplification. Arch Virol 157:2213–2217. 10.1007/s00705-012-1376-x [DOI] [PubMed] [Google Scholar]
  25. Pernezny K, Roberts PD, Murphy JF, Goldberg NP (2003) Compendium of pepper diseases, vol 88. APS Press, St Paul [Google Scholar]
  26. Piepenburg O, Williams CH, Stemple DL, Armes NA (2006) DNA detection using recombination proteins. PLoS Biol 4(7):204. 10.1371/journal.pbio.0040204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Rajamanickam S, Nakkeeran S (2020) Molecular characterization of Cucumber mosaic virus infection in chilli (Capsicum annuum L.) and its phylogenetic analysis. Int J Chem Stud 8(4):2967–2970. 10.22271/chemi.2020.v8.i4aj.10099 [Google Scholar]
  28. Ramesh B, Sreenivasulu P (2018) Detection of cucumber mosaic virus in brinjal and chilli by RT-PCR. Int J Pharm Biol Sci 8(3):128–131 [Google Scholar]
  29. Robertson G, Burger J, Campa M (2022) CRISPR/Cas-based tools for the targeted control of plant viruses. Mol Plant Pathol 23(11):1701–1718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Roossinck MJ (2001) Cucumber mosaic virus, a model for RNA virus evolution. Mol Plant Pathol 2(2):59–63. 10.1046/j.1364-3703.2001.00058.x [DOI] [PubMed] [Google Scholar]
  31. Shah MA, Khan AA, Junaid JM, Majid S, Mohi-ud-din S (2015) Aphid vectored viral diseases and their management. In: Pandey AK, Mall P (ed) Insect pests management of fruit crops. Biotech Books, New Delhi, pp 511–554 [Google Scholar]
  32. Sialer MF, Cillo F, Barbarossa L, Gallitelli D (1999) Differentiation of cucumber mosaic virus subgroups by RT-PCR RFLP. Plant Pathol J 81:145–148 [Google Scholar]
  33. Srivastava N, Kapoor R, Kumar R, Kumar S, Saritha RK, Kumar S, Baranwal VK (2019) Rapid diagnosis of Cucumber mosaic virus in banana plants using a fluorescence-based real-time isothermal reverse transcription-recombinase polymerase amplification assay. J Virol Methods 270:52–58 [DOI] [PubMed] [Google Scholar]
  34. Subbotin SA (2024) Rapid detection of the strawberry foliar nematode Aphelenchoides fragariae using recombinase polymerase amplification assay with lateral flow dipsticks. Int J Mol Sci 25(2):844. 10.3390/ijms25020844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tomlinson JA (1987) Epidemiology and control of virus diseases of vegetables. Ann Appl Biol 110(3):661–681. 10.1111/j.1744-7348.1987.tb04187.x [Google Scholar]
  36. Vinodhini J, Rajendran L, Raveendran M, Rajasree V, Karthikeyan G (2020) Characterization of cucumber mosaic virus (CMV) subgroup IB infecting chilli in Tamil Nadu, India. 3 Biotech 10:1–10. 10.1007/s13205-020-02492-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Vinodhini J, Rajendran L, Abirami R, Karthikeyan G (2021) Co-existence of chlorosis inducing strain of Cucumber mosaic virus with tospoviruses on hot pepper (Capsicum annuum) in India. Sci Rep 11(1):8796. 10.1038/s41598-021-88282-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wikoff WR, Tsai CJ, Wang G, Baker TS, Johnson JE (1997) The structure of cucumber mosaic virus: cryoelectron microscopy, X-ray crystallography, and sequence analysis. Virol 232(1):91–97. 10.1006/viro.1997.8543 [DOI] [PubMed] [Google Scholar]
  39. Wylie S, Wilson CR, Jones RAC, Jones MGK (1993) A polymerase chain reaction assay for cucumber mosaic virus in lupin seeds. Aust J Agric Res 44(1):41–51. 10.1071/AR993004 [Google Scholar]
  40. Zhan X, Zhang F, Li N, Xu K, Wang X, Gao S, Yin Y, Yuan W, Chen W, Ren Z, Yao M (2024) CRISPR/Cas: an emerging toolbox for engineering virus resistance in plants. Plants 13(23):3313. 10.3390/plants13233313 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOCX 2969 KB) (2.9MB, docx)

Data Availability Statement

Sequence obtained in this study was submitted to NCBI GenBank with accession number: PV424336. The data that support the findings of this study are openly available in this manuscript and the supporting information is attached.

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES