Oleanolic acid alleviates ovarian cancer by regulating the miR-122/PDK4 axis to induce autophagy and inhibit glycolysis in vivo and in vitro

Zhen Zeng; Qing Lin; Jing Yu; Min Lin; Ningwei Zhao

doi:10.3389/fonc.2025.1670758

. 2025 Sep 3;15:1670758. doi: 10.3389/fonc.2025.1670758

Oleanolic acid alleviates ovarian cancer by regulating the miR-122/PDK4 axis to induce autophagy and inhibit glycolysis in vivo and in vitro

Zhen Zeng ^1,^*, Qing Lin ², Jing Yu ¹, Min Lin ¹, Ningwei Zhao ^3,^*

PMCID: PMC12440953 PMID: 40969279

Abstract

Background

Ovarian cancer (OC) is a gynecological tumor with a high incidence and poor prognosis. Oleanolic acid (OA) plays a crucial role in cancers with its anti-cancer function. The study aimed to identify the effects of OA on OC development in vivo and in vitro.

Methods

The cell viability, migration, and invasion were analyzed by the CCK-8 approach and the Transwell assay. The glycolysis was evaluated by the glucose uptake rate, lactate content, and glycolysis-related protein expression. The autophagy was analyzed by determining autophagy-related protein expression. The tumor volume and weight were measured. The H&E and immunohistochemical staining were performed to determine pathological injuries and Ki67 expression of the tumor tissue. The levels of miR-122 and PDK4 were measured by qRT-PCR.

Results

OA inhibited the cell viability, migration, invasion, and glycolysis, and induced the autophagy of OC cells in a dose-dependent manner. Moreover, miR-122 was down-regulated in OC cells and increased by OA. Knocking down miR-122 effectively reversed the effects of OA on OC cells. PDK4 was clarified as a miR-122 target. Moreover, OA suppressed tumor volume and weight and Ki67 expression but induced pathological injuries of in tumor tissue. In vivo and in vitro, the overexpression of PDK4 and miR-122 effectively abolished the effects of OA and the overexpression of PDK4 on OC cells and tumor tissue, respectively.

Conclusions

In conclusion, OA induced autophagy and inhibited glycolysis to attenuate OC progression by regulating the miR-122/PDK4 axis, providing a theoretical basis for clinical treatment of OC with OA, and novel therapeutic targets of OC.

Keywords: ovarian cancer, oleanolic acid, miR-122, PDK4, glycolysis, autophagy

Highlights

Oleanolic acid inhibited OC cell development and OC growth in vivo and in vitro.
Oleanolic acid increased miR-122 expression in OC, which targeted PDK4.
Oleanolic acid induced autophagy and suppressed glycolysis of OC via regulating the miR-122/PDK4 axis.

Introduction

Ovarian cancer (OC) is the third most common gynecologic tumor, but has the highest mortality rate (1). The morbidity of OC is unchanged or declining in developed countries, but increasing in developing countries, with the 5-year survival rate of OC being less than 45% (2). Early screening can significantly improve the survival rate; however, there are no reliable diagnostic markers that can definitively diagnose the initiation of OC (3). Most patients are diagnosed at an advanced stage and cannot be completely cured with current treatments, so recurrence is extremely common (4). Therefore, it is urgent to further elucidate the pathogenesis of OC, control its progress, and explore effective treatment.

Autophagy is one of the ways that maintains cellular homeostasis, mainly participating in the occurrence and development of tumors by degrading excess molecules to produce new substances (5). It has been proposed as a way of programmed cell death. It was found that the abnormal expression of autophagy-related genes and proteins in OC cells regulated the apoptosis resistance, gene stability, and metabolic disorders, thereby affecting the progression of OC (6). Additionally, because of the high metabolic activity of cancer cells, they obtain energy through glycolysis (7). Even though glycolysis is less productive than oxidative phosphorylation. However, under hypoxic conditions, glycolysis is still the main energy generation pathway (8). Moreover, autophagy is associated with glycolysis in cancers (9). Therefore, targeting autophagy and glycolysis may be an effective strategy for OC.

Despite the emergence of chemically synthesized drugs, natural products remain the basis and major resource for drug innovation. Hitherto, half of the drugs on the market are derived from natural products (10). Oleanolic acid (OA) is a pentacyclic triterpenoid compound that can be isolated from a variety of plants, especially those in the Oleaceae family (11, 12). It has a variety of pharmacological effects, including liver protection, anti-inflammatory, antiviral, antibacterial, antioxidant, and anticancer activity (13). The anti-tumor activity of OA has been identified in numerous cancers, such as non-small cell lung cancer (14), hepatocellular carcinoma (15), pancreatic cancer (16), and OC (17). OA inhibits OC cell proliferation, invasion, and epithelial-mesenchymal transition (17). One previous study affirmed that the OA derivative, K73-03, induced autophagy in pancreatic cancer by regulating the miR-421/SPINK1 pathway (18). In addition, another previous study demonstrated that OA inhibited the proliferation of gastric cancer cells by regulating metabolism to suppress glycolysis, as reflected in the decrease in the uptake and consumption of glucose, intracellular lactate levels, and extracellular acidification rate (19). However, whether OA affects the autophagy and glycolysis of OC is largely unknown.

Therefore, the present study aimed to investigate whether OA affected autophagy and glycolysis of OC by regulating the miR-122/pyruvate dehydrogenase kinase 4 (PDK4) axis in vivo and in vitro, providing a theoretical basis for clinical treatment of OC with OA, and novel therapeutic targets of OC.

Materials and methods

Cell culture

The OC cell line (SKOV-3 and CAOV3) and normal ovarian epithelial cell line (IOSE-80 cells), bought from American Type Culture Collection (Virginia, USA), were cultured in RPMI 1640 medium (Cat., 11875093, Gibco, Massachusetts, USA) supplemented with 10% fetal bovine serum (Cat., A5670701, Gibco, Massachusetts, USA) and 100 U/mL penicillin with 100 mg/mL streptomycin (Cat., 15070063, Gibco, Massachusetts, USA). All cells were maintained under 37 °C with 5% CO₂ conditions.

Cell transfection

The miR-122 inhibitor, miR-122 mimic, inhibitor NC, PDK4 overexpression vector, and empty vector were purchased from Genepharma (China). The SKOV-3 and CAOV3 cells were transfected with these transfectants using Lipofectamine 3000 (Invitrogen, USA) for 72 hours before the OA treatment.

Cell experiment grouping

To investigate the effects of OA on SKOV-3 and CAOV3 cells, they were randomly divided into five groups, including the control, DMSO, OA (low), OA (middle), and OA (high) groups. SKOV-3 and CAOV3 cells in the control group were normally cultured. Apart from the former two groups, SKOV-3 and CAOV3 cells in the latter three groups were treated with OA (Cat., O5504, purity≥97%, Sigma-Aldrich, Missouri, USA) at low- (25 µg/mL), middle- (50 µg/mL), and high- (100 µg/mL) concentration for 12 h, which were dissolved in the dimethyl sulfoxide (DMSO, Lot, 472301; Sigma-Aldrich, Missouri, USA) and diluted by the culture medium (20). SKOV-3 and CAOV3 cells in the DMSO group were treated with the DMSO vehicle at the same concentration. To determine whether OA regulates miR-122 in SKOV-3 and CAOV3 cells, they were randomly divided into four groups, including DMSO, OA, OA + inhibitor NC, and OA + miR-122 inhibitor groups. SKOV-3 and CAOV3 cells in the DMSO group were treated with the DMSO vehicle at the same concentration. Apart from the DMSO group, SKOV-3 and CAOV3 cells in other groups were treated with 100 µg/mL OA for 24 h. In addition, SKOV-3 and CAOV3 cells in the latter two groups were additionally transfected with corresponding transfectants for 72 hours before the OA treatment. To determine whether OA regulates the miR-122/PDK4 axis in SKOV-3 and CAOV3 cells, they were randomly divided into five groups, including DMSO, OA, OA + vector, OA + PDK4, and OA + PDK4 + mimic groups. SKOV-3 and CAOV3 cells in the DMSO group were treated with the DMSO vehicle at the same concentration. Apart from the DMSO group, SKOV-3 and CAOV3 cells in other groups were treated with 100 µg/mL OA for 24 h. In addition, the empty vector, PDK4 overexpression vector, and PDK4 overexpression vector with miR-122 mimic were additionally transfected to SKOV-3 and CAOV3 cells in corresponding groups before the OA treatment, respectively.

Cell counting kit-8 assay

After finishing the treatments as mentioned above, the 10 μL CCK-8 solution (Cat., CK04, Dojindo, Kyoto, Japan) was subsequently incubated with SKOV-3 and CAOV3 cells for 4 h. The absorbance was examined using a Multiskan™ FC microplate reader (Thermo Fisher Scientific, Massachusetts, USA).

Transwell assay

The cell migration was evaluated using Transwell chambers without Matrigel, and the cell invasion was evaluated using Transwell chambers pre-coated with Matrigel. After SKOV-3 and CAOV3 cells were suspended in serum-free medium and added into the top chamber, the RPMI-1640 supplemented with 10% FBS (600 μL) was added into the bottom chamber. After incubation for 24 h, the chambers were taken out. The cells in the bottom chamber were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Cat., C0121, Beyotime, Shanghai, China). The stained cells were imaged and counted under a Mateo TL microscope (Leica, Hessen, Germany).

Glucose uptake and lactate production assays

The glucose uptake and lactate production of SKOV-3 and CAOV3 cells were detected using the glucose uptake assay kit (Cat., MAK542) and lactic acid assay kit (Cat., MAK329) according to the manufacturer’s protocol. The two kits were both purchased from Sigma-Aldrich (Missouri, USA).

Dual luciferase reporter analysis

The binding sites between miR-122 and PDK4 were predicted using the TargetScan database, among which PDK4 was predicted as a possible target. To verify the targeting relationship between miR-122 and PDK4, the wild-type (WT) and mutant (MUT) sequences of PDK4 were cloned into pGL3 vectors (Promega, USA). SKOV-3 cells were co-transfected with WT-PDK4 or MUT-PDK4 together with miR-122 mimic or mimic NC using Lipofectamine 3000. After transfection of 72 h, the luciferase activity was detected using the dual-luciferase reporter assay system (Cat., E1910, Promega, Wisconsin, USA).

Animals and establishing the xenograft model

A total of 24 female BALB/c nude mice (4 – 6 weeks, weighed 12 – 18 g; Charles River Laboratories, Beijing, China) were adaptively fed in an environment with a 12 h light-dark alternation and approximately 22°C and 50% humidity for two weeks. During the adoption period, all mice were free of food and water. According to the previous study, the 5×10⁶ SKOV-3 cells with or without transfection suspended in 200 μL PBS were subcutaneously injected into the left anterior armpit of mice for model establishment (21). The animal study procedures followed the “Guide for the Care and Use of Laboratory Animals, 8th Edition”, and were approved by the Ethics Committee of Fujian Medical University (Ethical No.: IACUC FJMU 2022-0893).

Animal experiment grouping and tumor volume and weight assays

To explore the effects of OA on OC in vivo, based on the procedure of simple randomization, the mice were randomly divided into four groups (n = 6) until the tumors grew to 100 mm³, including the control, OA, OA + PDK4, and OA + PDK4 + mimic groups. The normally cultured SKOV-3 cells without transfection were subcutaneously injected into mice in the control and OA groups. The SKOV-3 cells transfected with the PDK4 overexpression vector and the PDK4 overexpression vector with miR-122 mimic were subcutaneously injected into mice in the latter two groups. In addition, apart from the control group, mice in the latter three groups were treated with OA (50 mg/kg, i.g.) for 28 days (22). The length and width of the tumor were measured every week to calculate its volume using the formula (1/2 × Length × Width²). After 28 days, all mice were anesthetized with pentobarbital sodium (50 mg/kg, i.p.). Then, they were sacrificed, and the tumor tissue was collected for photographing, weighing, and subsequent studies.

H&E staining

After the fixed and embedded tumor tissue was cut into 3-μm sections, they were deparaffinized and rehydrated. Then, the sections were stained with hematoxylin for 5 min. After that, they were washed using tap water until the cell nuclei were blue. Finally, the sections were stained with eosin for 2 min until the cytoplasm was pink. The stained results were observed under the microscope.

Immunohistochemical assay

After the fixed and embedded tumor tissue was cut into 4-μm sections, they were deparaffinized in xylene and rehydrated with ethanol. Next, the citrate buffer and normal goat serum were used for antigen retrieval and blocking. After that, the sections were incubated with anti-Ki-67 (1: 200, Cat., ab15580) at 4 °C overnight, and immersed in the goat anti-rabbit IgG H&L (HRP) antibody (1: 1000, Cat., ab6721) at 37 °C for 1 h. All antibodies were bought from Abcam (Cambridge, UK). Finally, after being stained with the DAB solution, the stained results were visualized under the microscope, and the positively stained rate of Ki-67 was analyzed using the Image J software according to the proportion of positively stained cell number and total cell number.

Quantitative real-time PCR

The total RNA in SKOV-3 and CAOV3 cells was extracted using the TRIzol reagent (Cat., 15596026). Following RNA purity and concentration determination, based on the following reaction conditions, 25°C for 10 min and 0 cycle, 42°C for 15 min and 0 cycle, 85°C for 5 min and 1 cycle, and 4°C for 1 min and 1 cycle, the reverse transcription was conducted using the miRNA 1st Strand cDNA synthesis kit (by tailing A) (Cat., MR201-01) for miRNAs and the HiScript II 1st Strand cDNA synthesis kit (Cat., R211-01, Vazyme, Nanjing, China) for mRNAs. Based on the following reaction conditions, 95°C for 10 min and 0 cycle, 95°C for 0.25 min and 50 cycles, 60°C for 1 min and 50 cycles, 95°C for 0.25 min and 0 cycle, 60°C for 1 min and 0 cycle, and 95°C for 0.25 min and 0 cycle, the real-time PCR was performed using the miRNA Unimodal SYBR qPCR Master Mix (Cat., MQ102-01) for miRNAs and the ChamQ Universal SYBR qPCR Master Mix (Cat., Q711-02) for mRNAs. All kits were obtained from Vazyme (Nanjing, China). The relative levels of miR-122 and PDK4 mRNA were calculated using the 2^-ΔΔCt method. The primer sequences were listed in Table 1 , among which U6 and GAPDH were the endogenous controls of miR-122 and PDK4.

Table 1.

The primer for qRT-PCR.

Primers	Forward/Reverse	Sequence
miR-122	Forward	CGCGTGGAGTGTGACAATGG
	Reverse	AGTGCAGGGTCCGAGGTATT
PDK4	Forward	CAATGGCACAAGGAATCATAGA
	Reverse	TCATCAGCATCCGAGTAGAAAT
U6	Forward	CTCGCTTCGGCAGCACA
	Reverse	AACGCTTCACGAATTTGCGT
GAPDH	Forward	GAGTCAACGGATTTGGTCGT
	Reverse	TTGATTTTGGAGGGATCTC

Open in a new tab

Western blotting

After the RIPA buffer was used to lyse SKOV-3 and CAOV3 cells as well as tumor tissue for 2 min, the protein concentration was examined using the BCA kit (Cat., P0012, Beyotime, Shanghai, China). The protein samples were loaded into the 10% SDS-PAGE and then transferred to PVDF membranes. Next, the membranes were incubated with the specific anti-p62 (1: 1000, Cat., ab109012), anti-Beclin-1 (1: 2000, Cat., ab207612), anti-glucose transporter type 1 (GLUT1, 1: 1000, Cat., ab115730), anti-hexokinase 2 (HK2, 1: 1000, Cat., ab209847), and anti-PDK4 (1: 1000, Cat., ab214938), and anti-GAPDH (1: 2500, Cat., ab9485) at 4 °C overnight and the goat anti-rabbit IgG H&L (HRP) antibody (1: 10000, Cat., ab6721) at 25 °C for 2 h. All antibodies were bought from Abcam (Cambridge, UK). After the bands were visualized using the ECL reagent (Cat., abs920, Absin, Shanghai, China) for 3 min, their grayscale value were analyzed with the help of the Image J software.

Statistical analysis

Data acquired from three independent experiments were shown as mean ± standard deviation and presented in figures using the GraphPad Prism 7 software. All generated data were used for statistical analysis without exclusion. Differences between the two groups were analyzed using the Student’s t-test, and differences among multiple groups were analyzed using one-way or two-way analysis of variance followed by Tukey’s post-hoc test. According to a previous study, the statistical power was calculated using simulations and with a power formula (23). After calculating, the statistical power of all statistical data achieved 80%. The statistical effect sizes were analyzed using the fixed effect model and represented by a 95% confidence interval. P < 0.05 was considered statistically significant.

Results

OA suppressed cell viability, migration, and invasion of SKOV-3 and CAOV3 cells

To explore the role of OA on SKOV-3 and CAOV3 cells, they were treated with 25, 50, and 100 µg/mL OA for 24 h, respectively. SKOV-3 and CAOV3 cells treated with DMSO were the negative control. The results of the CCK-8 assay showed that there was no significant difference in the cell viability of SKOV-3 and CAOV3 cells between the control and DMSO groups, and OA significantly inhibited the cell viability of SKOV-3 and CAOV3 cells in a dose-dependent manner compared with DMSO (P<0.05, Figure 1A ). Moreover, there were no significant differences in the migration and invasion of SKOV-3 and CAOV3 cells between the control and the DMSO groups, and OA dramatically suppressed cell migration and invasion of SKOV-3 and CAOV3 cells in a dose-dependent way (P<0.0001, Figures 1B–E ). Our data suggested that OA inhibited the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells.

Bar graph A shows cell viability percentages for SKOV-3 and CAOV3 under various treatments with levels of significance indicated. Image panels B and C display microscopic views of SKOV-3 and CAOV3 cells under control, DMSO, and varying concentrations of OA. Bar graphs D and E depict cell migration and invasion folds, respectively, for both cell lines, highlighting significant differences across treatments. — OA suppressed cellular viability, migration, and invasion of SKOV-3 and CAOV3 cells. **(A)** The cell viability of SKOV-3 and CAOV3 cells was assessed using the CCK-8 approach (n = 3). The representative images of the migrated **(B)** and invaded **(C)** SKOV-3 and CAOV3 cells were detected by the Transwell assay (magnification: 200 ×). The statistical analysis of the cell migration **(D)** and invasion **(E)** of SKOV-3 and CAOV3 cells (n = 5). OA, oleanolic acid. ^* P<0.05, ^** P<0.01, ^*** P<0.001, and ^**** P<0.0001 vs. the DMSO group.

OA induced autophagy and inhibited glycolysis of SKOV-3 and CAOV3 cells

As the above results have demonstrated the roles of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells, the effects of OA on the glycolysis and autophagy of SKOV-3 and CAOV3 cells were further investigated. As presented in Figures 2A, B , OA significantly reduced the glucose uptake rate and lactate content of SKOV-3 and CAOV3 cells, suggesting that OA might inhibit their glycolysis (P<0.001). In addition, the protein levels of autophagy markers (p62 and Beclin-1) and glycolysis markers (GLUT1 and HK2) in SKOV-3 and CAOV3 cells were determined. As illustrated in Figures 2C–H , OA dramatically up-regulated Beclin-1 protein expression levels and markedly down-regulated p62, GLUT1, and HK2 protein expression levels. The above results affirmed that OA induced autophagy and suppressed the glycolysis of SKOV-3 and CAOV3 cells.

Graphs and protein expression blots depict the effects of different concentrations of octanoic acid (OA) on SKOV-3 and CAOV3 cells. Graph A shows relative glucose uptake rates, and Graph B shows lactate content, both decreasing with higher OA concentrations. Panels C and D display protein expressions of p62, Beclin-1, GLUT1, and HK2 in both cell lines, normalized to GAPDH. Graphs E to H present relative protein expression levels compared to GAPDH, showing significant decreases in p62, Beclin-1, GLUT1, and HK2 with increasing OA concentrations in SKOV-3 and CAOV3 cells. — OA induced autophagy and inhibited glycolysis of SKOV-3 and CAOV3 cells. The glucose uptake rate **(A)** and lactate content **(B)** of SKOV-3 and CAOV3 cells were measured using the corresponding kits (n = 3). The protein blots of SKOV-3 **(C)** and CAOV3 **(D)** cells. The protein levels of autophagy markers (p62 **(E)** and Beclin-1 (F)) and glycolysis markers (GLUT1 **(G)** and HK2 **(H)** of SKOV-3 and CAOV3 cells were examined using western blotting (n = 3). OA, oleanolic acid; GLUT1, glucose transporter type 1; HK2, hexokinase 2. ^*** P<0.001 and ^**** P<0.0001 vs. the DMSO group.

Knocking down MiR-122 reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells

As it has been revealed that miR-122 suppressed the progression of OC, we subsequently explored the effects of OA on miR-122 expression of SKOV-3 and CAOV3 cells (24, 25). First, the miR-122 expression level between normal ovarian epithelial cells and OC cells was compared. It was shown that the miR-122 expression level in SKOV-3 and CAOV3 cells was significantly down-regulated compared in IOSE-80 cells (P<0.0001, Figure 3A ). Meanwhile, it was found that OA dramatically up-regulated miR-122 expression level in SKOV-3 and CAOV3 cells (P<0.0001, Figure 3B ). Since the above studies revealed that OA inhibited the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells, we subsequently investigated whether knocking down miR-122 reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells. First, the qRT-PCR approach was used to determine the transfection efficiency. As presented in Figure 3C , compared with the inhibitor NC group, the miR-122 expression level of SKOV-3 and CAOV3 cells in the miR-122 inhibitor group was markedly reduced (P<0.01), suggesting that the miR-122 inhibitor was successfully transfected. Subsequently, the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells were detected. As illustrated in Figure 3D , OA prominently suppressed SKOV-3 and CAOV3 cell viability (P<0.0001), while knocking down miR-122 effectively counteracted the effects of OA on the cell viability (P<0.05). In addition, the migration and invasion of SKOV-3 and CAOV3 cells were significantly inhibited by treating with OA (P<0.0001), and knocking down miR-122 effectively reversed the effects of OA on migration and invasion (P<0.0001, Figures 3E–H ). The above results indicated that knocking down miR-122 effectively reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells.

The image contains multiple panels depicting bar graphs and microscopy images related to cell studies. Panels A to D show bar graphs representing relative expression of miR-122 and cell viability under various treatments in SKOV-3 and CAOV3 cell lines, with significant differences noted by asterisks and hashes. Panels E and F display microscopy images of cell migration and invasion assays under different treatments marked DMSO, OA, OA + inhibitor NC, and OA + miR-122 inhibitor. Panels G and H show bar graphs of cell migration and invasion fold changes, with statistical significance indicated. — Knocking down miR-122 reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells. **(A)** The miR-122 expression level in IOSE-80, SKOV-3, and CAOV3 cells (n = 3). **(B)** The miR-122 expression level in SKOV-3 and CAOV3 cells after OA treatment (n = 3). **(C)** The miR-122 expression level in SKOV-3 and CAOV3 cells after knocking down miR-122 (n = 3). **(D)** The cell viability of SKOV-3 and CAOV3 cells was assessed using the CCK-8 approach (n = 3). The representative images of the migrated **(E)** and invaded **(F)** SKOV-3 and CAOV3 cells were detected by the Transwell assay (magnification: 200 ×). The statistical analysis of the cell migration **(G)** and invasion **(H)** of SKOV-3 and CAOV3 cells (n = 5). OA, oleanolic acid. ^** P<0.01, ^*** P<0.001, and ^**** P<0.0001 vs. the IOSE-80/DMSO/inhibitor NC group; ^# P<0.05, ^## P<0.01, and ^#### P<0.0001 vs. the OA + inhibitor NC group.

Knocking down MiR-122 reversed the effects of OA on the autophagy and glycolysis of SKOV-3 and CAOV3 cells

As the above results demonstrated that OA induced autophagy and inhibited glycolysis of SKOV-3 and CAOV3 cells, and knocking down miR-122 effectively reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells, we subsequently explored whether knocking down miR-122 reversed the effects of OA on the autophagy and glycolysis of SKOV-3 and CAOV3 cells. As presented in Figures 4A, B , OA significantly reduced the glucose uptake rate and lactate content of SKOV-3 and CAOV3 cells (P<0.0001), and knocking down miR-122 effectively reversed the effects of OA on the glucose uptake rate and lactate content (P<0.001). In addition, as shown in Figures 4C–H , OA dramatically up-regulated Beclin-1 protein expression levels (P<0.0001) and prominently down-regulated p62, GLUT1, and HK2 protein expression levels (P<0.0001). Meanwhile, knocking down miR-122 effectively reversed the effects of OA on p62, Beclin-1, GLUT1, and HK2 protein expression levels (P<0.0001). The above results confirmed that knocking down miR-122 reversed the effects of OA on the autophagy and glycolysis of SKOV-3 and CAOV3 cells.

Bar graphs and Western blot images depict the effects of different treatments on SKOV-3 and CAOV3 cells. Bar graphs (A, B, E, F, G, H) show changes in glucose uptake, lactate content, and protein expression levels under treatments with DMSO, OA, OA with inhibitor NC, and OA with miR-122 inhibitor. Western blots (C, D) illustrate the expression of proteins p62, Beclin-1, GLUT1, HK2, and GAPDH in the different treatment conditions for both cell lines. Statistical significance is indicated by asterisks and hashtags. — Knocking down miR-122 reversed the effects of OA on autophagy and glycolysis of SKOV-3 and CAOV3 cells. The glucose uptake rate **(A)** and lactate content **(B)** of SKOV-3 and CAOV3 cells were measured using the corresponding kits (n = 3). The protein blots of SKOV-3 **(C)** and CAOV3 **(D)** cells. The protein levels of autophagy markers (p62 **(E)** and Beclin-1 **(F)** and glycolysis markers (GLUT1 **(G)** and HK2 (H)) of SKOV-3 and CAOV3 cells were examined using western blotting (n = 3). OA, oleanolic acid; GLUT1, glucose transporter type 1; HK2, hexokinase 2. ^**** P<0.0001 vs. the DMSO group; ^### P<0.001 and ^#### P<0.0001 vs. the OA + inhibitor NC group.

MiR-122 targeted and inhibited PDK4

Since the previous study demonstrated that overexpressing PDK4 enhanced the cell proliferation, invasion, and chemoresistance in OC, and the above results indicated that knocking down miR-122 up-regulated the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells, we speculated that PDK4 might be a downstream target of miR-122 (26). Therefore, after determining that PDK4 was significantly up-regulated in SKOV-3 and CAOV3 cells compared to IOSE-80 cells (P<0.0001, Figure 5A ), we subsequently explored the targeting relationship between miR-122 and PDK4. Due to the similar results in SKOV-3 and CAOV3 cells, we randomly chose one cell line (SKOV-3 cells) for the following study. After predicting the binding sites between miR-122 and PDK4 with the help of the TargetScan online database ( Figure 5B ), the dual luciferase reporter analysis was performed to determine the targeted relationship between miR-122 and PDK4. As presented in Figure 5C , although there were no significant differences in the luciferase activity between the mimic NC and miR-122 mimic groups in SKOV-3 cells transfected with MUT-PDK4, the luciferase activity of SKOV-3 cells transfected with WT-PDK4 in the miR-122 mimic group was significantly lower than that in the mimic NC group, indicating that PDK4 was the downstream target of miR-122 (P<0.0001). In addition, the mRNA and protein expression levels of PDK4 in SKOV-3 cells were prominently down-regulated after knocking down miR-122 (P<0.001, Figures 5D, E ). The above results affirmed that miR-122 targeted and inhibited PDK4.

Five-part scientific illustration showing: A) Bar graph of PDK4 mRNA expression levels across three cell types, with SKOV-3 and CAOV3 displaying significant increases. B) Table showing predicted miRNA target pairing for PDK4, featuring context scores. C) Bar graph comparing luciferase activity in the presence of miR-122 mimic versus control, indicating a reduction in wild type. D) Bar graph indicating increased PDK4 mRNA levels with miR-122 inhibitor treatment. E) Western blot showing increased PDK4 protein expression with miR-122 inhibitor, alongside GAPDH as a control. — MiR-122 targeted and inhibited PDK4. **(A)** The mRNA protein expression level in IOSE-80, SKOV-3, and CAOV3 cells (n = 3). **(B)** The potential binding sites between miR-122 and PDK4 were predicted using TargetScan database. **(C)** The targeting relationship was confirmed using the luciferase reporter analysis (n = 3). The mRNA **(D)** and protein **(E)** expression levels of PDK4 in SKOV-3 cells after knocking down miR-122 (n = 3). PDK4, pyruvate dehydrogenase kinase 4. ^*** P<0.001 and ^**** P<0.0001 vs. the first group.

OA induced autophagy and inhibited glycolysis of SKOV-3 cells via regulating the MiR-122/PDK4 axis

As the above results proved that miR-122 targeted and inhibited PDK4, and knocking down miR-122 effectively reversed the effects of OA on the cell viability, migration, invasion, autophagy, and glycolysis of SKOV-3 and CAOV3 cells, the rescue experiments were performed to explore whether OA inhibited the biological behaviors of SKOV-3 cells via the miR-122/PDK4 axis. First, the qRT-PCR approach was used to investigate whether the miR-122 mimic and PDK4 vector were successfully transfected. As illustrated in Figures 6A, B , compared with the mimic NC and empty vector groups, the miR-122 and PDK4 mRNA expression levels of SKOV-3 cells in the miR-122 mimic and PDK4 vector groups were significantly up-regulated (P<0.0001), suggesting that the miR-122 mimic and PDK4 vector were successfully transfected into SKOV-3 cells. Subsequently, the cell viability, migration, and invasion of SKOV-3 cells were determined. As presented in Figures 6C–F , compared with the DMSO group, the cell viability, migration, and invasion of SKOV-3 cells were significantly reduced (P<0.0001). Meanwhile, the additional overexpression of PDK4 effectively reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 cells (P<0.01). In addition, the additional overexpression of miR-122 prominently reversed the effects of overexpressing PDK4 on the cell viability, migration, and invasion of SKOV-3 cells (P<0.05). After that, we further explored whether OA induced autophagy and inhibited glycolysis of SKOV-3 cells via the miR-122/PDK4 axis. As shown in Figures 6G, H , OA dramatically decreased the glucose uptake rate and lactate content (P<0.0001). Overexpressing PDK4 effectively reversed the effects of OA on the glucose uptake rate and lactate content of SKOV-3 cells (P<0.0001). Meanwhile, the overexpression of miR-122 also effectively reversed the effects of overexpressing PDK4 on these indicators of SKOV-3 cells (P<0.0001). In addition, as illustrated in Figures 6I–M , OA markedly down-regulated the protein expression levels of p62, GLUT1, and HK2 but up-regulated the Beclin-1 protein expression level of SKOV-3 cells (P<0.0001). Overexpressing PDK4 effectively reversed the effects of OA on the protein expression levels of p62, Beclin-1, GLUT1, and HK2 of SKOV-3 cells (P<0.0001). Additionally, the overexpression of miR-122 effectively reversed the effects of overexpressing PDK4 on these protein expression levels of SKOV-3 cells (P<0.05). The above results demonstrated that OA induced autophagy and inhibited glycolysis of SKOV-3 cells via the miR-122/PDK4 axis.

Bar graphs and microscopic images display experimental results on mRNA expression, cell density, migration, and invasion under different treatments: DMSO, OA, OA with vector, OA with PDK4, and OA with PDK4 mimic. Western blots show protein levels of p62, Beclin-1, GLUT1, HK2, and GAPDH. Data indicate significant differences between conditions, highlighting molecular and cellular changes. — OA induced autophagy and inhibited glycolysis of SKOV-3 cells via regulating the miR-122/PDK4 axis. The miR-122 expression level **(A)** and PDK4 mRNA expression level **(B)** of SKOV-3 cells (n = 3). **(C)** The cell viability of SKOV-3 cells was determined by the CCK-8 approach (n = 3). **(D)** The representative images of the migrated and invaded SKOV-3 and CAOV3 cells were detected by the Transwell assay (magnification: 200 ×). The statistical analysis of the cell migration **(E)** and invasion **(F)** of SKOV-3 and CAOV3 cells (n = 5). The glucose uptake rate **(G)** and lactate content **(H)** of SKOV-3 cells were assessed using corresponding kits (n = 3). **(I)** The protein blots of SKOV-3 cells. The protein levels of autophagy markers (p62 **(J)** and Beclin-1 **(K)**) and glycolysis markers (GLUT1 **(L)** and HK2 **(M)**) of SKOV-3 cells were examined using western blotting (n = 3). OA, oleanolic acid; GLUT1, glucose transporter type 1; HK2, hexokinase 2; PDK4, pyruvate dehydrogenase kinase 4. ^*** P<0.001 and ^**** P<0.0001 vs. the first group; ^## P<0.01 and ^#### P<0.0001 vs. the OA + vector group; ^& P<0.05, ^&& P<0.01, and ^&&&& P<0.0001 vs. the OA + PDK4 group.

OA induced autophagy and inhibited glycolysis of OC via regulating the MiR-122/PDK4 axis in vivo

As the above results indicated that OA induced autophagy and inhibited glycolysis of SKOV-3 cells via the miR-122/PDK4 axis, we further explored whether OA induced autophagy and inhibited glycolysis of OC via the miR-122/PDK4 axis in vivo. As presented in Figures 7A–C , compared with the control group, the tumor volume and weight were significantly reduced (P<0.0001). Overexpressing PDK4 effectively reversed the effects of OA on the volume and weight of tumor tissue (P<0.0001). The overexpression of miR-122 effectively reversed the effects of overexpressing PDK4 on these indicators of the tumor tissue (P<0.0001). In addition, as shown in Figure 7D , in the control group, the number of tumor cells was large, the tumor cells were tightly arranged, and their nucleus were deeply stained. Meanwhile, after being treated with OA, the number of tumor cells was reduced, the tumor cells were sparsely arranged, and their nucleus were shallowly stained. The overexpression of PDK4 and miR-122 effectively reversed the effects of OA and the overexpression of PDK4 on the above alterations in the tumor tissue, respectively. Moreover, OA also dramatically reduced Ki67 expression in the tumor tissue (P<0.0001, Figures 7E, F ). The overexpression of PDK4 and miR-122 effectively reversed the effects of OA and the overexpression of PDK4 on the Ki67 expression in the tumor tissue, respectively (P<0.01). Then, the protein expression levels of the autophagy markers, p62 and Beclin-1, and glycolysis markers, GLUT1 and HK2, in tumor tissue were determined. As illustrated in Figures 7G–K , after administering OA, the protein expression level of Beclin-1 was prominently up-regulated, and the protein expression levels of p62, GLUT1, and HK2 were markedly down-regulated in the tumor tissue (P<0.0001). The overexpression of PDK4 and miR-122 effectively reversed the effects of OA and overexpressing PDK4 on the protein expression levels of Beclin-1, p62, GLUT1, and HK2 in the tumor tissue, respectively (P<0.05). The above results confirmed that OA induced autophagy and inhibited glycolysis of OC via the miR-122/PDK4 axis in vivo.

A composite image displays multiple panels related to a scientific study involving mice and tumor growth. Panel A shows mice divided into four groups: Control, OA, OA + PDK4, and OA + PDK4 + mimic, with excised tumors shown beside a ruler. Panel B presents a line graph of tumor volumes over seven weeks for each group. Panel C is a bar graph showing tumor weights for each group. Panel D features histological images of tissue samples stained to reveal cell morphology, with variations across the groups. Panel E shows Ki67 staining indicating cell proliferation in tissues. Panel G displays a Western blot for proteins p62, Beclin-1, GLUT1, HK2, and GAPDH with corresponding bar graphs H-K illustrating relative protein expression levels. Each grouping shows differential effects of treatments on tumor characteristics and protein expressions. — OA induced autophagy and inhibited glycolysis of OC via regulating the miR-122/PDK4 axis *in vivo*. **(A)** The representative images of the tumor in each group. **(B)** The tumor volume was calculated weekly (n = 6). **(C)** The tumor weight was measured (n = 6). **(D)** The pathological state of tumors was analyzed by H&E staining. **(E)** The representative IHC staining results of the tumor. **(F)** The Ki67 expression in the tumor was analyzed (n = 3). **(G)** The protein blots of tumor tissue. The protein levels of autophagy markers (p62 **(H)** and Beclin-1 **(I)**) and glycolysis markers (GLUT1 **(J)** and HK2 **(K)**) of tumor tissue were examined using western blotting (n = 3). OA, oleanolic acid; OC, ovarian cancer; IHC, immunohistochemical; GLUT1, glucose transporter type 1; HK2, hexokinase 2. ^**** P<0.0001 vs. the control group; ^### P<0.001 and ^#### P<0.0001 vs. the OA group; ^& P<0.05, ^&& P<0.01, and ^&&&& P<0.0001 vs. the OA + PDK4 group.

Discussion

Although several preclinical findings have shown that EHT5372 and R05454948 produced effects in OC cell lines, more effective treatments are required due to the prevalence of drug resistance in vivo (27). The study of natural products in diseases is increasing. OA cannot be used directly for disease treatment due to its water insolubility, but a variety of OA derivatives can be used to alleviate or treat disease. Therefore, elucidating the mechanism of OA is important for its derivatives to play a clinical role (28). OA can decelerate the progression of numerous diseases, such as Alzheimer’s disease, diabetes mellitus, inflammation, and cancer (29–31). Previous studies have revealed that OA suppressed OC development by regulating multiple biological functions, including cellular proliferation, metastasis, and apoptosis (17, 32). In this study, we observed that OA suppressed the cell viability, migration, and invasion of OC cells in vitro and the tumor growth and Ki67 expression of the tumor tissue in vivo, and promoted the pathological damages of tumor tissue in vivo, which were consistent with previous studies mentioned above.

Tumor development, metastasis and drug resistance are still major problems in the clinical treatment of OC. Autophagy has the function to promote or inhibit OC development. In detail, tumor cells have drug resistance to chemoradiotherapy by utilizing autophagy. On the other hand, autophagy enhances drug cytotoxicity to induce tumor cell death (33). Additionally, glycolysis epigenetic changes in tumor cells and thereby promoting OC growth, metastasis, and drug resistance (34). Glycolysis drives tumor progression by regulating autophagy capability, and autophagy participates in energy metabolism, including glycolysis (35, 36). The previous studies demonstrated that OA induced autophagy in colon cancer cells by regulating the p38/FOXO3a/Sirt6 pathway, and in hepatoma cells through the Akt/mTOR pathway, reflected in the decreased p62 expression and increased LC3-II and Beclin-1 expression (37, 38). In addition, the previous studies also suggested that OA inhibited the glycolysis of prostate carcinoma, breast cancer, and gastric cancer (19, 39). However, it is still unclear whether OA influences the autophagy and glycolysis of OC. Therefore, after determining the effects of OA on OC cells, the effects of OA on the autophagy and glycolysis of OC were further investigated. In the present study, we demonstrated that OA induced autophagy and inhibited glycolysis of OC in vivo and in vitro, manifested as the up-regulation of Beclin-1 protein expression level and the down-regulation of protein expression levels of p62, GLUT1, and HK2, which were consistent with previous studies mentioned above. It is proven that inhibiting glycolysis blunts hypoxia-inducible factor-1α (HIF-1α) accumulation (40). The suppressed HIF-1α prevented the OC progression by down-regulating angiogenic factors to reduce angiogenesis, inhibiting matrix metalloproteinases and key transcription factors for epithelial-mesenchymal transition to reduce the metastasis, and improving the immune microenvironment to promote the recovery of T cell killing function (41–43).

MiRNAs are crucial in physiological and pathological processes by modulating cell growth, differentiation, immune response, angiogenesis, and tumorigenesis (44). OA functions in disease by regulating the expression of multiple miRNAs. For example, OA inhibits Hippocampal neuronal cell pyroptosis by downregulating miR-186-5p (45). OA impedes dysfunctions of chondrocytes by regulating miR-148-3p, which targets FGF2 expression (46). In addition, OA promoted Treg/Th17 balance to inhibit gastric cancer by increasing miR-98-5p expression (47). It was reported that OA also suppressed the migration and epithelial-mesenchymal transition of hepatocellular carcinoma cells by inhibiting miR-130b-3p-induced macrophage M2 polarization and glycolysis (48). Moreover, the previous studies also demonstrated that OA suppressed lung cancer and liver cancer development by elevating the levels of miR-122 (49, 50). However, whether OA can affect OC by regulating miR-122 remains unknown. In the study, we discovered that OA up-regulated miR-122 expression level in OC cells. In addition, we also found that knocking down miR-122 abrogated OA-induced inhibition of cell viability, migration, invasion, and glycolysis and the promotion of autophagy of OC cells, indicating that OA might decelerate the progression of OC by up-regulating miR-122 expression.

PDK4 is a mitochondrial matrix enzyme that regulates energy metabolism (51). It was reported that PDK4 facilitates tumor cell proliferation, invasion, glycolysis, and chemotherapy resistance in OC (26, 52). In the regulation of glycolysis of tumor cells, depletion of PDK4 reduces glucose consumption, lactic acid, and ATP production (53). In addition, it was demonstrated that OA improved glucose consumption and lactate production to modulate the energy metabolism of breast cancer by regulating the key rate-limiting enzymes of aerobic glycolysis (54). However, it is still unclear whether OA targeted regulates PDK4 in OC. Therefore, we first investigated whether regulating PDK4 affects the effects of OA on OC. Our studies found that overexpressing PDK4 counteracted the suppression of cell viability, migration, invasion, and glycolysis and the promotion of autophagy of OC cells induced by OA in vitro. Meanwhile, overexpressing PDK4 reversed the inhibition of tumor volume and weight, Ki67 expression, and glycolysis, and the promotion of pathological injuries and autophagy of tumor tissue induced by OA in vivo. As the above studies demonstrated that inhibiting miR-122 also reversed the effects of OA on OC, we speculated that there might be a targeted relationship between miR-122 and PDK4. In the present study, we identified that PDK4 is a miR-122 target with the help of dual luciferase reporter analysis as well as qRT-PCR and Western blotting approaches. In addition, one previous study also affirmed that miR-122-5p suppresses neuropathic pain development by targeting PDK4, which proves our findings (55). Thus, we further evaluated whether OA functioned through the miR-122/PDK4 axis. The results showed that, in vivo and in vitro, overexpressing PDK4 effectively reversed the effects of OA on the autophagy and glycolysis of OC, and overexpressing miR-122 produced the opposite effects to overexpressing PDK4, suggesting that OA induced autophagy and inhibited glycolysis to attenuate OC progression by regulating the miR-122/PDK4 axis.

Taken together, OA inhibited the cell viability, migration, and invasion of OC cells in vitro, suppressed the tumor volume and weight and Ki67 expression, and induced pathological injuries of tumor tissue in vivo. In addition, knocking down miR-122 effectively reversed the effects of OA on OC cells mentioned above, and overexpressing PDK4 effectively reversed the effects of OA on OC cells and tumor tissue mentioned above. Moreover, overexpressing miR-122 produced the opposite effects to overexpressing PDK4. In conclusion, OA induced autophagy and inhibited glycolysis to attenuate OC progression by regulating the miR-122/PDK4 axis ( Figure 8 ), providing a theoretical basis for clinical treatment of OC with OA and novel therapeutic targets of OC. However, there are still some shortcomings in this study. Although our studies demonstrated that OA effectively induced autophagy and inhibited glycolysis to attenuate OC progression, it is still unclear whether there is a crosstalk between autophagy and glycolysis. The current studies have indicated that the cross-talk between autophagy and glycolysis regulates senescence and stemness of tumor subpopulations, and lactate was a bridge linking glycolysis and autophagy through lactylation (56, 57). As our studies have demonstrated that OA significantly reduced the lactate content in SKOV-3 and CAOV3 cells, we consider that the effects of OA on the cross-talk between autophagy and glycolysis in OC should be further investigated. In addition, although the targeted relationship between OA and miR-122 and between miR-122 and PDK4 has been affirmed in our studies, there are still some other possible pathways acting. The previous studies have reported that OA alleviated gastric cancer by up-regulating miR-98-5p expression, and miR-98-5p also played an essential role in the progression of OC (47, 58). In addition, the previous studies also demonstrated that P4HA1 and SLC1A5 acted as the downstream targets of miR-122 in OC (24, 25). Therefore, we consider that the gene sequencing technologies could be used to comprehensively discover the differentially expressed genes in OC after being treated with OA in subsequent studies, providing a more comprehensive theoretical basis for the clinical treatment of OA in OC. Moreover, although our studies have affirmed that OA induced autophagy and inhibited glycolysis to attenuate OC progression by regulating the miR-122/PDK4 axis, it is still unclear whether OA also affects the immune cells in the tumor microenvironment of OC. The previous studies demonstrated that OA not only regulated the Treg/Th17 imbalance but also down-regulated PD-L1 in gastric cancer (47, 59). Therefore, we believe that in the future, the effects of OA on the immune cells in the tumor microenvironment of OC should be further investigated to broaden the implications for clinical application.

Diagram illustrating the molecular pathway involving oleanolic acid impacting miR-122, which inhibits PDK4. PDK4 regulates p62/Beclin-1 leading to autophagy, while also affecting GLUT1/HK2, linked to glycolysis. — The therapeutic mechanisms of OA on OC. After being treated with OA, miR-122 was up-regulated and PDK4 was down-regulated in OC. In OC, the down-regulated PDK4 induced autophagy by promoting Beclin-1 expression and reducing p62 expression, and inhibited glycolysis by suppressing the GLUT1 and HK2 expression. OA, oleanolic acid; OC, ovarian cancer; PDK4, pyruvate dehydrogenase kinase 4; GLUT1, glucose transporter type 1; HK2, hexokinase 2.

Funding Statement

The author(s) declare that no financial support was received for the research and/or publication of this article.

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

The animal study was approved by Ethics Committee of Fujian Medical University (Ethical No.: IACUC FJMU 2022-0893). The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

ZZ: Conceptualization, Supervision, Writing – original draft, Writing – review & editing. QL: Investigation, Methodology, Writing – original draft, Writing – review & editing. JY: Data curation, Formal Analysis, Writing – original draft, Writing – review & editing. ML: Resources, Validation, Writing – original draft, Writing – review & editing. NZ: Conceptualization, Supervision, Writing – original draft, Writing – review & editing.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declare that no Generative AI was used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

1. Kuroki L, Guntupalli SR. Treatment of epithelial ovarian cancer. Bmj. (2020) 371:m3773. doi: 10.1136/bmj.m3773, PMID: [DOI] [PubMed] [Google Scholar]
2. Webb PM, Jordan SJ. Global epidemiology of epithelial ovarian cancer. Nat Rev Clin Oncol. (2024) 21:389–400. doi: 10.1038/s41571-024-00881-3, PMID: [DOI] [PubMed] [Google Scholar]
3. Zeng S, Wang XL, Yang H. Radiomics and radiogenomics: extracting more information from medical images for the diagnosis and prognostic prediction of ovarian cancer. Mil Med Res. (2024) 11:77. doi: 10.1186/s40779-024-00580-1, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Stewart C, Ralyea C, Lockwood S. Ovarian cancer: an integrated review. Semin Oncol Nurs. (2019) 35:151–6. doi: 10.1016/j.soncn.2019.02.001, PMID: [DOI] [PubMed] [Google Scholar]
5. Liu S, Yao S, Yang H, Liu S, Wang Y. Autophagy: Regulator of cell death. Cell Death Dis. (2023) 14:648. doi: 10.1038/s41419-023-06154-8, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Park M, Choe S, Shin M, Kim A, Mo K, Kwon H, et al. Potential therapeutic targets in ovarian cancer: autophagy and metabolism. Front Biosci (Landmark Ed). (2023) 28:47. doi: 10.31083/j.fbl2803047, PMID: [DOI] [PubMed] [Google Scholar]
7. Abbaszadeh Z, Çeşmeli S, Biray Avcı Ç. Crucial players in glycolysis: Cancer progress. Gene. (2020) 726:144158. doi: 10.1016/j.gene.2019.144158, PMID: [DOI] [PubMed] [Google Scholar]
8. Ganapathy-Kanniappan S, Geschwind JF. Tumor glycolysis as a target for cancer therapy: progress and prospects. Mol Cancer. (2013) 12:152. doi: 10.1186/1476-4598-12-152, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Fan Q, Yang L, Zhang X, Ma Y, Li Y, Dong L, et al. Autophagy promotes metastasis and glycolysis by upregulating MCT1 expression and Wnt/β-catenin signaling pathway activation in hepatocellular carcinoma cells. J Exp Clin Cancer Res. (2018) 37:9. doi: 10.1186/s13046-018-0673-y, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Zhang M, Otsuki K, Li W. Molecular networking as a natural products discovery strategy. Acta Materia Medica. (2023) 2:126–41. doi: 10.15212/AMM-2023-0007 [DOI] [Google Scholar]
11. Pollier J, Goossens A. Oleanolic acid. Phytochemistry. (2012) 77:5. doi: 10.1016/j.phytochem.2011.12.022, PMID: [DOI] [PubMed] [Google Scholar]
12. Ayeleso TB, Matumba MG, Mukwevho E. Oleanolic acid and its derivatives: biological activities and therapeutic potential in chronic diseases. Molecules. (2017) 22:1915. doi: 10.3390/molecules22111915, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Castellano JM, Ramos-Romero S, Perona JS. Oleanolic acid: extraction, characterization and biological activity. Nutrients. (2022) 14:623. doi: 10.3390/nu14030623, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Lúcio KA, Rocha Gda G, Monção-Ribeiro LC, Fernandes J, Takiya CM, Gattass CR. Oleanolic acid initiates apoptosis in non-small cell lung cancer cell lines and reduces metastasis of a B16F10 melanoma model. vivo. PloS One. (2011) 6:e28596. doi: 10.1371/journal.pone.0028596, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Wang X, Bai H, Zhang X, Liu J, Cao P, Liao N, et al. Inhibitory effect of oleanolic acid on hepatocellular carcinoma via ERK-p53-mediated cell cycle arrest and mitochondrial-dependent apoptosis. Carcinogenesis. (2013) 34:1323–30. doi: 10.1093/carcin/bgt058, PMID: [DOI] [PubMed] [Google Scholar]
16. Wei J, Liu H, Liu M, Wu N, Zhao J, Xiao L, et al. Oleanolic acid potentiates the antitumor activity of 5-fluorouracil in pancreatic cancer cells. Oncol Rep. (2012) 28:1339–45. doi: 10.3892/or.2012.1921, PMID: [DOI] [PubMed] [Google Scholar]
17. Zeng Z, Yu J, Jiang Z, Zhao N. Oleanolic acid (OA) targeting UNC5B inhibits proliferation and EMT of ovarian cancer cell and increases chemotherapy sensitivity of niraparib. J Oncol. (2022) 2022:5887671. doi: 10.1155/2022/5887671, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Shopit A, Li X, Tang Z, Awsh M, Shobet L, Niu M, et al. miR-421 up-regulation by the oleanolic acid derivative K73 – 03 regulates epigenetically SPINK1 transcription in pancreatic cancer cells leading to metabolic changes and enhanced apoptosis. Pharmacol Res. (2020) 161:105130. doi: 10.1016/j.phrs.2020.105130, PMID: [DOI] [PubMed] [Google Scholar]
19. Li Y, Xu Q, Yang W, Wu T, Lu X. Oleanolic acid reduces aerobic glycolysis-associated proliferation by inhibiting yes-associated protein in gastric cancer cells. Gene. (2019) 712:143956. doi: 10.1016/j.gene.2019.143956, PMID: [DOI] [PubMed] [Google Scholar]
20. Liu J, Zheng L, Zhong J, Wu N, Liu G, Lin X. Oleanolic acid induces protective autophagy in cancer cells through the JNK and mTOR pathways. Oncol Rep. (2014) 32:567–72. doi: 10.3892/or.2014.3239, PMID: [DOI] [PubMed] [Google Scholar]
21. Liu Y, Liu X, Wang H, Ding P, Wang C. Agrimonolide inhibits cancer progression and induces ferroptosis and apoptosis by targeting SCD1 in ovarian cancer cells. Phytomedicine. (2022) 101:154102. doi: 10.1016/j.phymed.2022.154102, PMID: [DOI] [PubMed] [Google Scholar]
22. Wang H, Zhong W, Zhao J, Zhang H, Zhang Q, Liang Y, et al. Oleanolic acid inhibits epithelial-mesenchymal transition of hepatocellular carcinoma by promoting iNOS dimerization. Mol Cancer Ther. (2019) 18:62–74. doi: 10.1158/1535-7163.Mct-18-0448, PMID: [DOI] [PubMed] [Google Scholar]
23. Weiss J, Pham NA, Pintilie M, Li M, Liu G, Shepherd FA, et al. Optimizing drug response study design in patient-derived tumor xenografts. Cancer Inform. (2022) 21:11769351221136056. doi: 10.1177/11769351221136056, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Huang X, Luo Y, Li X. Circ_0072995 promotes ovarian cancer progression through regulating miR-122-5p/SLC1A5 axis. Biochem Genet. (2022) 60:153–72. doi: 10.1007/s10528-021-10092-5, PMID: [DOI] [PubMed] [Google Scholar]
25. Duan Y, Dong Y, Dang R, Hu Z, Yang Y, Hu Y, et al. MiR-122 inhibits epithelial mesenchymal transition by regulating P4HA1 in ovarian cancer cells. Cell Biol Int. (2018) 42:1564–74. doi: 10.1002/cbin.11052, PMID: [DOI] [PubMed] [Google Scholar]
26. Wang J, Qian Y, Gao M. Overexpression of PDK4 is associated with cell proliferation, drug resistance and poor prognosis in ovarian cancer. Cancer Manag Res. (2019) 11:251–62. doi: 10.2147/cmar.S185015, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Wang ZS, Liu ZC, Qu J, Sun Y, Zhou WC. Role of natural products in tumor therapy from basic research and clinical perspectives. Acta Materia Medica. (2024) 3:163–206. doi: 10.15212/AMM-2023-0050 [DOI] [Google Scholar]
28. Zuo JH, Gao X, Xiao JR, Cheng YY. Carrier-free supramolecular nanomedicines assembled by small-molecule therapeutics for cancer treatment. Chin Chem Lett. (2023) 34:107827. doi: 10.1016/j.cclet.2022.107827 [DOI] [Google Scholar]
29. Guo Q, He J, Zhang H, Yao L, Li H. Oleanolic acid alleviates oxidative stress in Alzheimer’s disease by regulating stanniocalcin-1 and uncoupling protein-2 signalling. Clin Exp Pharmacol Physiol. (2020) 47:1263–71. doi: 10.1111/1440-1681.13292, PMID: [DOI] [PubMed] [Google Scholar]
30. Sen A. Prophylactic and therapeutic roles of oleanolic acid and its derivatives in several diseases. World J Clin cases. (2020) 8:1767–92. doi: 10.12998/wjcc.v8.i10.1767, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Zheng Y, Li Z, Yang Y, Shi H, Chen H, Gao Y. A nanosensitizer self-assembled from oleanolic acid and chlorin e6 for synergistic chemo/sono-photodynamic cancer therapy. Phytomedicine. (2021) 93:153788. doi: 10.1016/j.phymed.2021.153788, PMID: [DOI] [PubMed] [Google Scholar]
32. Bian M, Sun Y, Liu Y, Xu Z, Fan R, Liu Z, et al. A gold(I) complex containing an oleanolic acid derivative as a potential anti-ovarian-cancer agent by inhibiting trxR and activating ROS-mediated ERS. Chemistry. (2020) 26:7092–108. doi: 10.1002/chem.202000045, PMID: [DOI] [PubMed] [Google Scholar]
33. Pan Y, Chen L, Shen J, Hong S, Guan X, Ma X, et al. GANT61 modulates autophagy and lipid metabolism in ovarian cancer. Cell Prolif. (2025) 58:e70051. doi: 10.1111/cpr.70051, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Icard P, Shulman S, Farhat D, Steyaert JM, Alifano M, Lincet H. How the Warburg effect supports aggressiveness and drug resistance of cancer cells? Drug Resist Update. (2018) 38:1–11. doi: 10.1016/j.drup.2018.03.001, PMID: [DOI] [PubMed] [Google Scholar]
35. Chu Y, Chang Y, Lu W, Sheng X, Wang S, Xu H, et al. Regulation of autophagy by glycolysis in cancer. Cancer Manag Res. (2020) 12:13259–71. doi: 10.2147/cmar.S279672, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Lin PW, Chu ML, Liu HS. Autophagy and metabolism. Kaohsiung J Med Sci. (2021) 37:12–9. doi: 10.1002/kjm2.12299, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Potočnjak I, Šimić L, Vukelić I, Batičić L, Domitrović R. Oleanolic acid induces HCT116 colon cancer cell death through the p38/FOXO3a/Sirt6 pathway. Chem Biol Interact. (2022) 363:110010. doi: 10.1016/j.cbi.2022.110010, PMID: [DOI] [PubMed] [Google Scholar]
38. Zhou W, Zeng X, Wu X. Effect of oleanolic acid on apoptosis and autophagy of SMMC-7721 hepatoma cells. Med Sci Monit. (2020) 26:e921606. doi: 10.12659/msm.921606, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Liu J, Wu N, Ma L, Liu M, Liu G, Zhang Y, et al. Oleanolic acid suppresses aerobic glycolysis in cancer cells by switching pyruvate kinase type M isoforms. PloS One. (2014) 9:e91606. doi: 10.1371/journal.pone.0091606, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Dang B, Gao Q, Zhang L, Zhang J, Cai H, Zhu Y, et al. The glycolysis/HIF-1α axis defines the inflammatory role of IL-4-primed macrophages. Cell Rep. (2023) 42:112471. doi: 10.1016/j.celrep.2023.112471, PMID: [DOI] [PubMed] [Google Scholar]
41. Wang X, Du ZW, Xu TM, Wang XJ, Li W, Gao JL, et al. HIF-1α Is a rational target for future ovarian cancer therapies. Front Oncol. (2021) 11:785111. doi: 10.3389/fonc.2021.785111, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Rahman MA, Jalouli M, Bhajan SK, Al-Zharani M, Harrath AH. The role of hypoxia-inducible factor-1α (HIF-1α) in the progression of ovarian cancer: perspectives on female infertility. Cells. (2025) 14:437. doi: 10.3390/cells14060437, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Lv Q, Su T, Liu W, Wang L, Hu J, Cheng Y, et al. Low serum apolipoprotein A1 levels impair antitumor immunity of CD8+ T cells via the HIF-1α-glycolysis pathway. Cancer Immunol Res. (2024) 12:1058–73. doi: 10.1158/2326-6066.Cir-23-0506, PMID: [DOI] [PubMed] [Google Scholar]
44. Bayraktar R, Van Roosbroeck K. miR-155 in cancer drug resistance and as target for miRNA-based therapeutics. Cancer Metastasis Rev. (2018) 37:33–44. doi: 10.1007/s10555-017-9724-7, PMID: [DOI] [PubMed] [Google Scholar]
45. Cai SC, Li XP, Li X, Tang GY, Yi LM, Hu XS. Oleanolic acid inhibits neuronal pyroptosis in ischaemic stroke by inhibiting miR-186-5p expression. Exp Neurobiol. (2021) 30:401–14. doi: 10.5607/en21006, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Li Y, Nie J, Jiang P. Oleanolic acid mitigates interleukin-1β-induced chondrocyte dysfunction by regulating miR-148-3p-modulated FGF2 expression. J Gene Med. (2020) 22:e3169. doi: 10.1002/jgm.3169, PMID: [DOI] [PubMed] [Google Scholar]
47. Xu QF, Peng HP, Lu XR, Hu Y, Xu ZH, Xu JK. Oleanolic acid regulates the Treg/Th17 imbalance in gastric cancer by targeting IL-6 with miR-98-5p. Cytokine. (2021) 148:155656. doi: 10.1016/j.cyto.2021.155656, PMID: [DOI] [PubMed] [Google Scholar]
48. Tu X, Lin W, Zhai X, Liang S, Huang G, Wang J, et al. Oleanolic acid inhibits M2 macrophage polarization and potentiates anti-PD-1 therapy in hepatocellular carcinoma by targeting miR-130b-3p-PTEN-PI3K-Akt signaling and glycolysis. Phytomedicine. (2025) 141:156750. doi: 10.1016/j.phymed.2025.156750, PMID: [DOI] [PubMed] [Google Scholar]
49. He Y, Liu X, Huang M, Wei Z, Zhang M, He M, et al. Oleanolic acid inhibits the migration and invasion of hepatocellular carcinoma cells by promoting microRNA-122 expression. Pharmazie. (2021) 76:422–7. doi: 10.1691/ph.2021.1366, PMID: [DOI] [PubMed] [Google Scholar]
50. Zhao X, Liu M, Li D. Oleanolic acid suppresses the proliferation of lung carcinoma cells by miR-122/Cyclin G1/MEF2D axis. Mol Cell Biochem. (2015) 400:1–7. doi: 10.1007/s11010-014-2228-7, PMID: [DOI] [PubMed] [Google Scholar]
51. Gao Y, Yan Y, Tripathi S, Pentinmikko N, Amaral A, Päivinen P, et al. LKB1 represses ATOH1 via PDK4 and energy metabolism and regulates intestinal stem cell fate. Gastroenterology. (2020) 158:1389–1401.e10. doi: 10.1053/j.gastro.2019.12.033, PMID: [DOI] [PubMed] [Google Scholar]
52. Jiang YX, Siu MK, Wang JJ, Mo XT, Leung TH, Chan DW, et al. Ascites-derived ALDH+CD44+ tumour cell subsets endow stemness, metastasis and metabolic switch via PDK4-mediated STAT3/AKT/NF-κB/IL-8 signalling in ovarian cancer. Br J Cancer. (2020) 123:275–87. doi: 10.1038/s41416-020-0865-z, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Zhao Z, Ji M, Wang Q, He N, Li Y. miR-16-5p/PDK4-mediated metabolic reprogramming is involved in chemoresistance of cervical cancer. Mol Ther Oncolytics. (2020) 17:509–17. doi: 10.1016/j.omto.2020.05.008, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Amara S, Zheng M, Tiriveedhi V. Oleanolic acid inhibits high salt-induced exaggeration of warburg-like metabolism in breast cancer cells. Cell Biochem Biophys. (2016) 74:427–34. doi: 10.1007/s12013-016-0736-7, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Wan L, Su Z, Li F, Gao P, Zhang X. MiR-122-5p suppresses neuropathic pain development by targeting PDK4. Neurochem Res. (2021) 46:957–63. doi: 10.1007/s11064-020-03213-w, PMID: [DOI] [PubMed] [Google Scholar]
56. Martell E, Kuzmychova H, Senthil H, Kaul E, Chokshi CR, Venugopal C, et al. Compensatory cross-talk between autophagy and glycolysis regulates senescence and stemness in heterogeneous glioblastoma tumor subpopulations. Acta Neuropathol Commun. (2023) 11:110. doi: 10.1186/s40478-023-01604-y, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Sun W, Jia M, Feng Y, Cheng X. Lactate is a bridge linking glycolysis and autophagy through lactylation. Autophagy. (2023) 19:3240–1. doi: 10.1080/15548627.2023.2246356, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Dong L, Cao X, Luo Y, Zhang G, Zhang D. A positive feedback loop of lncRNA DSCR8/miR-98-5p/STAT3/HIF-1α Plays a role in the progression of ovarian cancer. Front Oncol. (2020) 10:1713. doi: 10.3389/fonc.2020.01713, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Lu X, Li Y, Yang W, Tao M, Dai Y, Xu J, et al. Inhibition of NF-κB is required for oleanolic acid to downregulate PD-L1 by promoting DNA demethylation in gastric cancer cells. J Biochem Mol Toxicol. (2021) 35:e22621. doi: 10.1002/jbt.22621, PMID: [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

[B1] 1. Kuroki L, Guntupalli SR. Treatment of epithelial ovarian cancer. Bmj. (2020) 371:m3773. doi: 10.1136/bmj.m3773, PMID: [DOI] [PubMed] [Google Scholar]

[B2] 2. Webb PM, Jordan SJ. Global epidemiology of epithelial ovarian cancer. Nat Rev Clin Oncol. (2024) 21:389–400. doi: 10.1038/s41571-024-00881-3, PMID: [DOI] [PubMed] [Google Scholar]

[B3] 3. Zeng S, Wang XL, Yang H. Radiomics and radiogenomics: extracting more information from medical images for the diagnosis and prognostic prediction of ovarian cancer. Mil Med Res. (2024) 11:77. doi: 10.1186/s40779-024-00580-1, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Stewart C, Ralyea C, Lockwood S. Ovarian cancer: an integrated review. Semin Oncol Nurs. (2019) 35:151–6. doi: 10.1016/j.soncn.2019.02.001, PMID: [DOI] [PubMed] [Google Scholar]

[B5] 5. Liu S, Yao S, Yang H, Liu S, Wang Y. Autophagy: Regulator of cell death. Cell Death Dis. (2023) 14:648. doi: 10.1038/s41419-023-06154-8, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6. Park M, Choe S, Shin M, Kim A, Mo K, Kwon H, et al. Potential therapeutic targets in ovarian cancer: autophagy and metabolism. Front Biosci (Landmark Ed). (2023) 28:47. doi: 10.31083/j.fbl2803047, PMID: [DOI] [PubMed] [Google Scholar]

[B7] 7. Abbaszadeh Z, Çeşmeli S, Biray Avcı Ç. Crucial players in glycolysis: Cancer progress. Gene. (2020) 726:144158. doi: 10.1016/j.gene.2019.144158, PMID: [DOI] [PubMed] [Google Scholar]

[B8] 8. Ganapathy-Kanniappan S, Geschwind JF. Tumor glycolysis as a target for cancer therapy: progress and prospects. Mol Cancer. (2013) 12:152. doi: 10.1186/1476-4598-12-152, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Fan Q, Yang L, Zhang X, Ma Y, Li Y, Dong L, et al. Autophagy promotes metastasis and glycolysis by upregulating MCT1 expression and Wnt/β-catenin signaling pathway activation in hepatocellular carcinoma cells. J Exp Clin Cancer Res. (2018) 37:9. doi: 10.1186/s13046-018-0673-y, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Zhang M, Otsuki K, Li W. Molecular networking as a natural products discovery strategy. Acta Materia Medica. (2023) 2:126–41. doi: 10.15212/AMM-2023-0007 [DOI] [Google Scholar]

[B11] 11. Pollier J, Goossens A. Oleanolic acid. Phytochemistry. (2012) 77:5. doi: 10.1016/j.phytochem.2011.12.022, PMID: [DOI] [PubMed] [Google Scholar]

[B12] 12. Ayeleso TB, Matumba MG, Mukwevho E. Oleanolic acid and its derivatives: biological activities and therapeutic potential in chronic diseases. Molecules. (2017) 22:1915. doi: 10.3390/molecules22111915, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Castellano JM, Ramos-Romero S, Perona JS. Oleanolic acid: extraction, characterization and biological activity. Nutrients. (2022) 14:623. doi: 10.3390/nu14030623, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Lúcio KA, Rocha Gda G, Monção-Ribeiro LC, Fernandes J, Takiya CM, Gattass CR. Oleanolic acid initiates apoptosis in non-small cell lung cancer cell lines and reduces metastasis of a B16F10 melanoma model. vivo. PloS One. (2011) 6:e28596. doi: 10.1371/journal.pone.0028596, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Wang X, Bai H, Zhang X, Liu J, Cao P, Liao N, et al. Inhibitory effect of oleanolic acid on hepatocellular carcinoma via ERK-p53-mediated cell cycle arrest and mitochondrial-dependent apoptosis. Carcinogenesis. (2013) 34:1323–30. doi: 10.1093/carcin/bgt058, PMID: [DOI] [PubMed] [Google Scholar]

[B16] 16. Wei J, Liu H, Liu M, Wu N, Zhao J, Xiao L, et al. Oleanolic acid potentiates the antitumor activity of 5-fluorouracil in pancreatic cancer cells. Oncol Rep. (2012) 28:1339–45. doi: 10.3892/or.2012.1921, PMID: [DOI] [PubMed] [Google Scholar]

[B17] 17. Zeng Z, Yu J, Jiang Z, Zhao N. Oleanolic acid (OA) targeting UNC5B inhibits proliferation and EMT of ovarian cancer cell and increases chemotherapy sensitivity of niraparib. J Oncol. (2022) 2022:5887671. doi: 10.1155/2022/5887671, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18. Shopit A, Li X, Tang Z, Awsh M, Shobet L, Niu M, et al. miR-421 up-regulation by the oleanolic acid derivative K73 – 03 regulates epigenetically SPINK1 transcription in pancreatic cancer cells leading to metabolic changes and enhanced apoptosis. Pharmacol Res. (2020) 161:105130. doi: 10.1016/j.phrs.2020.105130, PMID: [DOI] [PubMed] [Google Scholar]

[B19] 19. Li Y, Xu Q, Yang W, Wu T, Lu X. Oleanolic acid reduces aerobic glycolysis-associated proliferation by inhibiting yes-associated protein in gastric cancer cells. Gene. (2019) 712:143956. doi: 10.1016/j.gene.2019.143956, PMID: [DOI] [PubMed] [Google Scholar]

[B20] 20. Liu J, Zheng L, Zhong J, Wu N, Liu G, Lin X. Oleanolic acid induces protective autophagy in cancer cells through the JNK and mTOR pathways. Oncol Rep. (2014) 32:567–72. doi: 10.3892/or.2014.3239, PMID: [DOI] [PubMed] [Google Scholar]

[B21] 21. Liu Y, Liu X, Wang H, Ding P, Wang C. Agrimonolide inhibits cancer progression and induces ferroptosis and apoptosis by targeting SCD1 in ovarian cancer cells. Phytomedicine. (2022) 101:154102. doi: 10.1016/j.phymed.2022.154102, PMID: [DOI] [PubMed] [Google Scholar]

[B22] 22. Wang H, Zhong W, Zhao J, Zhang H, Zhang Q, Liang Y, et al. Oleanolic acid inhibits epithelial-mesenchymal transition of hepatocellular carcinoma by promoting iNOS dimerization. Mol Cancer Ther. (2019) 18:62–74. doi: 10.1158/1535-7163.Mct-18-0448, PMID: [DOI] [PubMed] [Google Scholar]

[B23] 23. Weiss J, Pham NA, Pintilie M, Li M, Liu G, Shepherd FA, et al. Optimizing drug response study design in patient-derived tumor xenografts. Cancer Inform. (2022) 21:11769351221136056. doi: 10.1177/11769351221136056, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24. Huang X, Luo Y, Li X. Circ_0072995 promotes ovarian cancer progression through regulating miR-122-5p/SLC1A5 axis. Biochem Genet. (2022) 60:153–72. doi: 10.1007/s10528-021-10092-5, PMID: [DOI] [PubMed] [Google Scholar]

[B25] 25. Duan Y, Dong Y, Dang R, Hu Z, Yang Y, Hu Y, et al. MiR-122 inhibits epithelial mesenchymal transition by regulating P4HA1 in ovarian cancer cells. Cell Biol Int. (2018) 42:1564–74. doi: 10.1002/cbin.11052, PMID: [DOI] [PubMed] [Google Scholar]

[B26] 26. Wang J, Qian Y, Gao M. Overexpression of PDK4 is associated with cell proliferation, drug resistance and poor prognosis in ovarian cancer. Cancer Manag Res. (2019) 11:251–62. doi: 10.2147/cmar.S185015, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Wang ZS, Liu ZC, Qu J, Sun Y, Zhou WC. Role of natural products in tumor therapy from basic research and clinical perspectives. Acta Materia Medica. (2024) 3:163–206. doi: 10.15212/AMM-2023-0050 [DOI] [Google Scholar]

[B28] 28. Zuo JH, Gao X, Xiao JR, Cheng YY. Carrier-free supramolecular nanomedicines assembled by small-molecule therapeutics for cancer treatment. Chin Chem Lett. (2023) 34:107827. doi: 10.1016/j.cclet.2022.107827 [DOI] [Google Scholar]

[B29] 29. Guo Q, He J, Zhang H, Yao L, Li H. Oleanolic acid alleviates oxidative stress in Alzheimer’s disease by regulating stanniocalcin-1 and uncoupling protein-2 signalling. Clin Exp Pharmacol Physiol. (2020) 47:1263–71. doi: 10.1111/1440-1681.13292, PMID: [DOI] [PubMed] [Google Scholar]

[B30] 30. Sen A. Prophylactic and therapeutic roles of oleanolic acid and its derivatives in several diseases. World J Clin cases. (2020) 8:1767–92. doi: 10.12998/wjcc.v8.i10.1767, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Zheng Y, Li Z, Yang Y, Shi H, Chen H, Gao Y. A nanosensitizer self-assembled from oleanolic acid and chlorin e6 for synergistic chemo/sono-photodynamic cancer therapy. Phytomedicine. (2021) 93:153788. doi: 10.1016/j.phymed.2021.153788, PMID: [DOI] [PubMed] [Google Scholar]

[B32] 32. Bian M, Sun Y, Liu Y, Xu Z, Fan R, Liu Z, et al. A gold(I) complex containing an oleanolic acid derivative as a potential anti-ovarian-cancer agent by inhibiting trxR and activating ROS-mediated ERS. Chemistry. (2020) 26:7092–108. doi: 10.1002/chem.202000045, PMID: [DOI] [PubMed] [Google Scholar]

[B33] 33. Pan Y, Chen L, Shen J, Hong S, Guan X, Ma X, et al. GANT61 modulates autophagy and lipid metabolism in ovarian cancer. Cell Prolif. (2025) 58:e70051. doi: 10.1111/cpr.70051, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Icard P, Shulman S, Farhat D, Steyaert JM, Alifano M, Lincet H. How the Warburg effect supports aggressiveness and drug resistance of cancer cells? Drug Resist Update. (2018) 38:1–11. doi: 10.1016/j.drup.2018.03.001, PMID: [DOI] [PubMed] [Google Scholar]

[B35] 35. Chu Y, Chang Y, Lu W, Sheng X, Wang S, Xu H, et al. Regulation of autophagy by glycolysis in cancer. Cancer Manag Res. (2020) 12:13259–71. doi: 10.2147/cmar.S279672, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36. Lin PW, Chu ML, Liu HS. Autophagy and metabolism. Kaohsiung J Med Sci. (2021) 37:12–9. doi: 10.1002/kjm2.12299, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Potočnjak I, Šimić L, Vukelić I, Batičić L, Domitrović R. Oleanolic acid induces HCT116 colon cancer cell death through the p38/FOXO3a/Sirt6 pathway. Chem Biol Interact. (2022) 363:110010. doi: 10.1016/j.cbi.2022.110010, PMID: [DOI] [PubMed] [Google Scholar]

[B38] 38. Zhou W, Zeng X, Wu X. Effect of oleanolic acid on apoptosis and autophagy of SMMC-7721 hepatoma cells. Med Sci Monit. (2020) 26:e921606. doi: 10.12659/msm.921606, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Liu J, Wu N, Ma L, Liu M, Liu G, Zhang Y, et al. Oleanolic acid suppresses aerobic glycolysis in cancer cells by switching pyruvate kinase type M isoforms. PloS One. (2014) 9:e91606. doi: 10.1371/journal.pone.0091606, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Dang B, Gao Q, Zhang L, Zhang J, Cai H, Zhu Y, et al. The glycolysis/HIF-1α axis defines the inflammatory role of IL-4-primed macrophages. Cell Rep. (2023) 42:112471. doi: 10.1016/j.celrep.2023.112471, PMID: [DOI] [PubMed] [Google Scholar]

[B41] 41. Wang X, Du ZW, Xu TM, Wang XJ, Li W, Gao JL, et al. HIF-1α Is a rational target for future ovarian cancer therapies. Front Oncol. (2021) 11:785111. doi: 10.3389/fonc.2021.785111, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Rahman MA, Jalouli M, Bhajan SK, Al-Zharani M, Harrath AH. The role of hypoxia-inducible factor-1α (HIF-1α) in the progression of ovarian cancer: perspectives on female infertility. Cells. (2025) 14:437. doi: 10.3390/cells14060437, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Lv Q, Su T, Liu W, Wang L, Hu J, Cheng Y, et al. Low serum apolipoprotein A1 levels impair antitumor immunity of CD8+ T cells via the HIF-1α-glycolysis pathway. Cancer Immunol Res. (2024) 12:1058–73. doi: 10.1158/2326-6066.Cir-23-0506, PMID: [DOI] [PubMed] [Google Scholar]

[B44] 44. Bayraktar R, Van Roosbroeck K. miR-155 in cancer drug resistance and as target for miRNA-based therapeutics. Cancer Metastasis Rev. (2018) 37:33–44. doi: 10.1007/s10555-017-9724-7, PMID: [DOI] [PubMed] [Google Scholar]

[B45] 45. Cai SC, Li XP, Li X, Tang GY, Yi LM, Hu XS. Oleanolic acid inhibits neuronal pyroptosis in ischaemic stroke by inhibiting miR-186-5p expression. Exp Neurobiol. (2021) 30:401–14. doi: 10.5607/en21006, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46. Li Y, Nie J, Jiang P. Oleanolic acid mitigates interleukin-1β-induced chondrocyte dysfunction by regulating miR-148-3p-modulated FGF2 expression. J Gene Med. (2020) 22:e3169. doi: 10.1002/jgm.3169, PMID: [DOI] [PubMed] [Google Scholar]

[B47] 47. Xu QF, Peng HP, Lu XR, Hu Y, Xu ZH, Xu JK. Oleanolic acid regulates the Treg/Th17 imbalance in gastric cancer by targeting IL-6 with miR-98-5p. Cytokine. (2021) 148:155656. doi: 10.1016/j.cyto.2021.155656, PMID: [DOI] [PubMed] [Google Scholar]

[B48] 48. Tu X, Lin W, Zhai X, Liang S, Huang G, Wang J, et al. Oleanolic acid inhibits M2 macrophage polarization and potentiates anti-PD-1 therapy in hepatocellular carcinoma by targeting miR-130b-3p-PTEN-PI3K-Akt signaling and glycolysis. Phytomedicine. (2025) 141:156750. doi: 10.1016/j.phymed.2025.156750, PMID: [DOI] [PubMed] [Google Scholar]

[B49] 49. He Y, Liu X, Huang M, Wei Z, Zhang M, He M, et al. Oleanolic acid inhibits the migration and invasion of hepatocellular carcinoma cells by promoting microRNA-122 expression. Pharmazie. (2021) 76:422–7. doi: 10.1691/ph.2021.1366, PMID: [DOI] [PubMed] [Google Scholar]

[B50] 50. Zhao X, Liu M, Li D. Oleanolic acid suppresses the proliferation of lung carcinoma cells by miR-122/Cyclin G1/MEF2D axis. Mol Cell Biochem. (2015) 400:1–7. doi: 10.1007/s11010-014-2228-7, PMID: [DOI] [PubMed] [Google Scholar]

[B51] 51. Gao Y, Yan Y, Tripathi S, Pentinmikko N, Amaral A, Päivinen P, et al. LKB1 represses ATOH1 via PDK4 and energy metabolism and regulates intestinal stem cell fate. Gastroenterology. (2020) 158:1389–1401.e10. doi: 10.1053/j.gastro.2019.12.033, PMID: [DOI] [PubMed] [Google Scholar]

[B52] 52. Jiang YX, Siu MK, Wang JJ, Mo XT, Leung TH, Chan DW, et al. Ascites-derived ALDH+CD44+ tumour cell subsets endow stemness, metastasis and metabolic switch via PDK4-mediated STAT3/AKT/NF-κB/IL-8 signalling in ovarian cancer. Br J Cancer. (2020) 123:275–87. doi: 10.1038/s41416-020-0865-z, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53. Zhao Z, Ji M, Wang Q, He N, Li Y. miR-16-5p/PDK4-mediated metabolic reprogramming is involved in chemoresistance of cervical cancer. Mol Ther Oncolytics. (2020) 17:509–17. doi: 10.1016/j.omto.2020.05.008, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54. Amara S, Zheng M, Tiriveedhi V. Oleanolic acid inhibits high salt-induced exaggeration of warburg-like metabolism in breast cancer cells. Cell Biochem Biophys. (2016) 74:427–34. doi: 10.1007/s12013-016-0736-7, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55. Wan L, Su Z, Li F, Gao P, Zhang X. MiR-122-5p suppresses neuropathic pain development by targeting PDK4. Neurochem Res. (2021) 46:957–63. doi: 10.1007/s11064-020-03213-w, PMID: [DOI] [PubMed] [Google Scholar]

[B56] 56. Martell E, Kuzmychova H, Senthil H, Kaul E, Chokshi CR, Venugopal C, et al. Compensatory cross-talk between autophagy and glycolysis regulates senescence and stemness in heterogeneous glioblastoma tumor subpopulations. Acta Neuropathol Commun. (2023) 11:110. doi: 10.1186/s40478-023-01604-y, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57. Sun W, Jia M, Feng Y, Cheng X. Lactate is a bridge linking glycolysis and autophagy through lactylation. Autophagy. (2023) 19:3240–1. doi: 10.1080/15548627.2023.2246356, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58. Dong L, Cao X, Luo Y, Zhang G, Zhang D. A positive feedback loop of lncRNA DSCR8/miR-98-5p/STAT3/HIF-1α Plays a role in the progression of ovarian cancer. Front Oncol. (2020) 10:1713. doi: 10.3389/fonc.2020.01713, PMID: [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59. Lu X, Li Y, Yang W, Tao M, Dai Y, Xu J, et al. Inhibition of NF-κB is required for oleanolic acid to downregulate PD-L1 by promoting DNA demethylation in gastric cancer cells. J Biochem Mol Toxicol. (2021) 35:e22621. doi: 10.1002/jbt.22621, PMID: [DOI] [PubMed] [Google Scholar]

PERMALINK

Oleanolic acid alleviates ovarian cancer by regulating the miR-122/PDK4 axis to induce autophagy and inhibit glycolysis in vivo and in vitro

Zhen Zeng

Qing Lin

Jing Yu

Min Lin

Ningwei Zhao

Abstract

Background

Methods

Results

Conclusions

Highlights

Introduction

Materials and methods

Cell culture

Cell transfection

Cell experiment grouping

Cell counting kit-8 assay

Transwell assay

Glucose uptake and lactate production assays

Dual luciferase reporter analysis

Animals and establishing the xenograft model

Animal experiment grouping and tumor volume and weight assays

H&E staining

Immunohistochemical assay

Quantitative real-time PCR

Table 1.

Western blotting

Statistical analysis

Results

OA suppressed cell viability, migration, and invasion of SKOV-3 and CAOV3 cells

Figure 1.

OA induced autophagy and inhibited glycolysis of SKOV-3 and CAOV3 cells

Figure 2.

Knocking down MiR-122 reversed the effects of OA on the cell viability, migration, and invasion of SKOV-3 and CAOV3 cells

Figure 3.

Knocking down MiR-122 reversed the effects of OA on the autophagy and glycolysis of SKOV-3 and CAOV3 cells

Figure 4.

MiR-122 targeted and inhibited PDK4

Figure 5.

OA induced autophagy and inhibited glycolysis of SKOV-3 cells via regulating the MiR-122/PDK4 axis

Figure 6.

OA induced autophagy and inhibited glycolysis of OC via regulating the MiR-122/PDK4 axis in vivo

Figure 7.

Discussion

Figure 8.

Funding Statement

Data availability statement

Ethics statement

Author contributions

Conflict of interest

Generative AI statement

Publisher’s note

References

Associated Data

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases