Skip to main content
PLOS One logoLink to PLOS One
. 2025 Sep 18;20(9):e0332698. doi: 10.1371/journal.pone.0332698

CLIC1 down-regulates Nrf2/HO-1 signalling pathway promoting the apoptosis and pyroptosis in OGD/R-treated HT22 cells

Jingtong Xiong 1,2,#, Shuo Li 1,#, Honghai Chen 1, Chuanwen Yu 1, Yuhai Cao 1, Xiaofeng Qu 1, Jianlin Wu 2,3, Aodan Zhang 1,*, Chuang Sun 1,*
Editor: Mária A Deli4
PMCID: PMC12445528  PMID: 40966238

Abstract

Cerebral ischemia–reperfusion injury (CIRI) occurs during the treatment of ischemic stroke when the affected blood vessels are recanalized and the oxygen supply to the brain is restored. Chloride intracellular channel 1 (CLIC1) and the nuclear factor erythroid-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway have been implicated in many neurological disorders. However, the exact mechanism by which CLIC1 contributes to CIRI remains unclear, and its potential role in modulating the Nrf2/HO-1 signaling pathway in CIRI has yet to be explored. We investigated the potential roles of CLIC1 in CIRI using an oxygen and glucose deprivation/reoxygenation (OGD/R) model in HT22 cells. The findings of our study indicated that CLIC1 was high-expressed after OGD/R and had an inhibitory effect on the Nrf2/HO-1 signalling pathway. This process led to an exacerbation of apoptosis due to oxidative stress and an increase in the activity of the nucleotide-binding oligomeriation domain-like receptor protein 3 (NLRP3) inflammasome and pyroptosis in OGD/R-treated HT22 cells. These effects were reversed when CLIC1 was silenced. Together, the results of this study confirm our hypothesis that CLIC1 promotes CIRI by suppressing the Nrf2/HO-1 signalling pathway. CLIC1 emerges as a promising therapeutic target to prevent neuronal cell injury in CIRI.

Introduction

Cerebral ischemia–reperfusion injury (CIRI) is a biological cascade process that exacerbates brain damage and dysfunction [1]. CIRI occurs during the treatment of ischemic stroke when the blood vessels responsible are recanalized and the oxygen supply to the brain is restored. The no-reflow phenomenon results in persistent hypoperfusion in certain areas of the already damaged brain, while other regions, where microvascular blood flow is restored, become vulnerable to ischemia-reperfusion injury [2]. The pathophysiological mechanism of CIRI is complex, mainly involving mitochondrial dysfunction, increased reactive oxygen species (ROS) production, and neutrophil infiltration, promoting oxidative stress and inflammation [3,4]. Excessive ROS can oxidise lipids, proteins, and DNA, leading to oxidative injury and trigger apoptosis, which involves cell shrinkage, DNA fragmentation, and the formation of apoptotic bodies [5,6]. Caspases, activated by intrinsic or extrinsic cues of oxidative stress, initiate this non-inflammatory process [6]. Inflammatory responses also play a key role in CIRI [7]. Pyroptosis is a form of inflammation-mediated cell death, which results from the changes of membrane permeability, cell swelling, membrane rupture, and the release of pro-inflammatory cytokines [8]. In the canonical model of caspase-1-mediated pyroptosis, the recognition of inflammatory ligands triggers the activation of intracellular multiprotein signalling complexes called inflammasomes, while non-canonical inflammasomes have been shown to activate caspase-4/5/11 [9]. The nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) inflammasome activates caspase-1, promoting interleukin (IL)-1β and IL-18 secretion for immune defence [10]. Furthermore, caspase-1/4/5/11 targets gasdermin D (GSDMD), a member of the gasdermin family that drives programmed cell death and pyroptosis through its membrane pore-forming activity [6,9].

In CIRI, although distinct forms of programmed cell death, including apoptosis and pyroptosis, have different mechanisms and functions, they share some common features. Cell death is not always a consequence of inflammation, but sometimes acts as a trigger [11]. Some key initiator caspases in the apoptotic pathway also regulate to pyroptosis. For example, the apoptotic effector caspase-3 can cleave GSDME to trigger pyroptosis [9]. Currently, reperfusion therapies, such as intravenous thrombolysis and mechanical thrombectomy, are limited by a narrow therapeutic window, limited applicability, and high costs, which prevent these methods from benefiting the majority of stroke patients [1214]. Meanwhile, these invasive therapies pose a biphasic role. Rapid reperfusion by these operations is beneficial during the acute phase by restoring blood flow and oxygen supply, but it can become detrimental during the recovery phase, potentially leading to and exacerbating reperfusion injury [14]. Therefore, there is an urgent need for novel therapeutic approaches. Developing drugs targeting both apoptotic and pyroptotic pathways could offer a transformative strategy for mitigating neuronal damage.

Chloride intracellular channel 1 (CLIC1) is a multifunctional protein expressed in various organs, where it participates in redox regulation, immune and inflammatory processes via enzymatic activity [15,16]. It is an oxidative stress sensor in vascular endothelium cells [17]. In response to increased cytoplasmic oxidation or changes in pH, cytoplasmic soluble CLIC proteins integrate into cellular membranes, functioning as anion channels to counteract cationic fluctuations [18]. It is highly expressed in neurological disorders, and is indicative of a poor prognosis [19]. However, the precise mechanism of how CLIC1 promotes CIRI and the relative pathway remains largely unknown. A recent study [17] discovered that in umbilical vein endothelial cells, upregulation of CLIC1 impaired the ability of vascular cells to resist oxidative stress to speed up cellular senescence; in contrast, CLIC1 inhibition resulted in a protective effect, preventing cellular aging and disorder. This protection function was considered to be achieved via activation of the nuclear factor erythroid-related factor 2 (Nrf2)/heme oxygenase-1(HO-1) pathway. Nrf2 bind to antioxidant response element (ARE), a specific DNA sequence located in the promoter regions of genes that encode antioxidant and cytoprotective proteins, in response to oxidative or electrophilic stress, activating the expression of these genes and enhancing the cell’s defense mechanisms against damage [20]. Nrf2/HO-1 pathway is a key protector against oxidative stress-mediated apoptosis and related to inflammasome regulation and pyroptosis [2123].

Therefore, this study presents a novel insight into the regulatory role of CLIC1 in CIRI via Nrf2/HO-1 pathway using a cell model, emphasizing its critical involvement in oxidative stress and inflammation. We hypothesized that CLIC1 is highly expressed in OGD/R-treated HT22 cells and inhibits the Nrf2/HO-1 signalling pathway. These processes promote apoptosis and NLRP3-mediated pyroptosis. Fig 1 shows a diagram of the scientific hypothesis. These findings could unveil promising targets for the treatment of stroke and CIRI, ultimately improving outcomes and broadening the therapeutic options.

Fig 1. Schematic illustration of the hypothesis of CLIC1 mediates neuronal injury following oxygen and glucose deprivation/reoxygenation (OGD/R) in HT22 cells.

Fig 1

Mouse hippocampal neurons (HT22 cells) are subjected to OGD/R to mimic CIRI. OGD/R triggers upregulation of CLIC1, which leads to suppression of the Nrf2/HO-1 antioxidant signaling pathway. This results in increased ROS accumulation and disturbance of redox balance, promoting apoptosis by increased Bax and decreased Bcl-2 expression. Additionally, elevated CLIC1 activates the NLRP3 inflammasome and caspase-1 via inhibiting the Nrf2/HO-1 pathway, inducing pyroptosis via upregulation of pyroptosis markers, such as caspase-3, GSDMD, IL-1β, and IL-18. Collectively, these processes contribute to neuronal cell damage after CIRI. ARE, antioxidant response element; CIRI, cerebral ischemia-reperfusion injury; CLIC1, chloride intracellular channel 1; GSDMD, gasdermin D; HO-1, heme oxygenase 1; IL, interleukin; NLRP3, NOD-like receptor family pyrin domain containing 3; Nrf2, nuclear factor erythroid 2–related factor 2; OGD/R, oxygen-glucose deprivation/reoxygenation; ROS, reactive oxygen species.

Materials and methods

Cell culture

The mouse HT22 hippocampus neuronal cell line (HT22, iCell, China) was acquired and cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Servicebio, China) with 10% foetal bovine serum (FBS, Biobase, China) at 37°C in a 5% CO2 incubator. This study was carried out in strict accordance with the recommendations in the guideline for the ethical review of animal welfare of laboratory animals. The protocol was approved by the Committee on the Ethics of Animal Experiments of Dalian Medical University (approval No. AEE22014).

Model establishment and group treatments

The CIRI model was established in HT22 cells through the process of oxygen and glucose deprivation/reoxygenation (OGD/R). This study included the following groups: control, OGD/R, negative control (NC), CLIC1 silencing, OGD/R + NC, OGD/R+CLIC1 silencing, OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition, and OGD/R+CLIC1 silencing+NLRP3 activation. The HT22 cells in the control group were inoculated in 6-well culture plates and incubated overnight for cell processing. The cells were incubated in glucose-free Hank’s Balanced Salt Solution (HBSS) under 95% air and 5% CO2 at 37 °C for 6 h. To induce OGD/R, HT22 cells were seeded in 6-well culture plates and cultured overnight to ensure proper adherence. Hypoxia was induced by incubating the cells in glucose-free HBSS in an anoxic chamber maintained at 37°C under 95% N₂ and 5% CO₂ for 6 hours. Then in reperfusion phase following hypoxic treatment, the glucose-free HBSS was replaced with normal DMEM medium (supplemented with glucose and 10% FBS), and the cells were cultured under air conditions (37°C, 21% O₂, and 5% CO₂) for 24 hours. Cells were subsequently used for further experiments.

The control HT22 cells and OGD/R-induced cells were then infected with either the CLIC1 silencing-negative control virus (WL117218−2, Wanleibio, China) or CLIC1 silencing virus (WL117218−1, Wanleibio, China) to create the NC and CLIC1 silencing groups. The viral stock was thawed at 4°C. The virus solution was prepared by accurately measuring the required volume to achieve a multiplicity of infection (MOI) of 50 and mixing it with the culture medium. The existing cell medium was then replaced with the virus-containing medium. The cells were gently mixed to ensure even distribution and incubated at 37°C with 5% CO₂. After 48 h, the cells were transferred to glucose-free HBSS and underwent the OGD/R protocol described above. After the CLIC1 silencing virus infection, further experiments were performed 48 h later. The OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition and OGD/R+CLIC1 silencing+NLRP3 activation groups were pretreated with SnPPIX (50 μM, Macklin, China, for 3 h) or Nigericin (10 μg/mL, MCE, China, for 2 h), respectively. Following pretreatment, the cells were incubated in glucose-free HBSS under hypoxic conditions (37°C, 95% N2, and 5% CO2) for 4 h. Subsequently, the cells were returned to normal DMEM medium and incubated under air conditions (37°C, 21% O₂, and 5% CO₂) for 24 h before further experiments.

Real-time polymerase chain reaction (PCR)

Gene expression levels were quantified using real-time PCR analysis. TRIpure lysate (BioTeke, Beijing, China) was used to extract total RNA from the HT22 cells. The RNA purity in each sample was assessed using a NANO 2000 UV spectrophotometer (Thermo, USA). The RNA samples were subjected to reverse transcription using BeyoRT II M-MLV reverse transcriptase (Beyotime, Shanghai, China) to obtain complementary DNA (cDNA). The SYBR Green PCR MasterMix (Solarbio, Beijing, China) was used to perform real-time PCR, following the instructions provided by the manufacturer. Quantitative analysis of mRNA levels was performed by normalizing them using a threshold cycle (Ct) of 2-ΔΔCt. β-actin was used as an internal control. Table 1 shows the forward and reverse primers.

Table 1. Primer Sequences Applied in Real-Time PCR.

Primer Forward 5′-3′ Reverse 5′-3′
CLIC1 TGCCGTTCTTGCTCTATG GGTGTTGGACTCAGGGTT
Nrf2 GTGCTCCTATGCGTGAA GCGGCTTGAATGTTTGT
HO-1 ACAGATGGCGTCACTTCG TGAGGACCCACTGGAGGA
Bcl-2 TGTGCCACCTGTGGTCCATC CATCTCCCTGTTGACGCTCT
Bax GCTACAGGGTTTCATCCAGG GTCCACGTCAGCAATCATCC
NLRP3 GAGTTCTTCGCTGCTATGT ACCTTCACGTCTCGGTTC
Caspase-1 GGGACCACATACTCTAAT TAATGCCATCATCTTCA
Caspase-3 TGGGACTGATGAGGAGA ACTGGATGAACCACGAC
GSDMD GCTTTATGCTTGAAGGGTG AAGGTCCTCTGTTTCTCATCT
IL-1β CTCAACTGTGAAATGCCACC GAGTGATACTGCCTGCCTGA
IL-18 GGCTGCCATGTCAGAAGA CCGTATTACTGCGGTTGT
β-actin AATCGTGCGTGACATCAA AGAAGGAAGGCTGGAAAA

Western blot (WB)

Following protein extraction and subsequent separation using protein electrophoresis, the protein samples were deposited onto polyvinylidene fluoride (PVDF) membranes (IPVH00010, Millipore, USA). The membranes were immersed in a blocking solution and then treated with primary antibodies targeting CLIC1 (1:1000, 14545–1-AP, Proteintech, China), Nrf2 (1:500, WL02135, Wanleibio, China), HO-1 (1:500, WL02400, Wanleibio, China), B-cell lymphoma-2 (Bcl-2: 1:400, WL01556, Wanleibio, China), Bax (1:1000, WL01637, Wanleibio, China), caspase-3/cleaved caspase-3 (1:400, WL02117, Wanleibio, China), NLRP3 (1:500, WL02635, Wanleibio, China), pro caspase-1/ cleaved caspase-1 (1:500, WL03450,Wanleibio,China), IL-1β (1:1000, WL00891, Wanleibio, China), IL-18 (1:500, WL01127, Wanleibio, China), or GSDMD (1:500, AF4012, Affinity, China) overnight at 4°C. After undergoing several washes with Tris-buffered saline containing Tween (TBST), the membranes were then exposed to the secondary antibody of (goat anti-rabbit IgG-HRP, 1:5000, WLA023, Wanleibio, China), and incubated at 37°C for 45 min. The anti-rabbit β-actin antibody (1:1000, WL01372, Wanleibio, China) and histone H3 antibody (1:1000, WL0984a, Wanleibio, China) were used as reference antibodies for normalization. The films were scanned and the OD values of the target bands were assessed using Gel-Pro analyser software.

Flow cytometry

Flow cytometric analyses were used to quantify the rate of cell apoptosis and the quantity of ROS. Concisely, the cells were gathered and washed twice with phosphate-buffered saline (PBS). Then, the cells were treated with Annexin V-FITC and propidium iodide for 15 minutes under dark conditions at ambient temperature in order to evaluate apoptosis. Next, the cells were exposed to a 1:1000 dilution of DCFH-DA and kept in an incubator at a temperature of 37°C for 20 minutes. Ultimately, the samples underwent three rounds of washing with PBS prior to evaluating the ROS level. The experiment was performed following the manufacturer’s instructions provided by the cell apoptosis kit (WLA001, Wanleibio, China) or the reactive oxygen detection kit (WLA131, Wanleibio, China).

Assessment of IL-1β and IL-18 levels, GSH-Px, SOD, and CAT activity, and LDH leakage rate

The gene and protein expression levels of IL-1β and IL-18 were quantified using real-time PCR and WB, as described above. Additionally, the protein levels in solution were also detected using enzyme-linked immunosorbent assay (ELISA) kits, namely IL-1β (WLE03, Wanleibio, China) and IL-18 (EK218, Liankebio, China). And reagent kits were used to measure the activity of glutathione peroxidase (GSH-Px: WLA107, Wanleibio, China), superoxide dismutase (SOD: WLA110, Wanleibio, China), catalase (CAT: A007, Jianchengbio, China), and leakage rate of lactate dehydrogenase (LDH: WLA072, Wanleibio, China). All the assays were conducted in accordance with the manufacturer’s instructions.

Cell Counting Kit-8 (CCK-8)

HT22 cells were seeded into a 96-well plate with five replicates per group and incubated in standard conditions overnight. Subsequently, the cells were infected with a virus and underwent processing 48 hours later. The CCK-8 solution (10 μl, WLA074, Wanleibio, China) was added to each well for incubation for 1 h at 37°C in 5% CO2. Data analysis was performed on an enzyme marker (800Ts, BIOTEK, USA) by measuring the optical density (OD) value at 450 nm.

Statistical analysis

SPSS 26.0 software (IBM Corporation, NY, USA) was used for statistical analyses. Comparisons between the two groups were conducted using a two-tailed t test. Multiple group comparisons were conducted using a one-way analysis of variance (ANOVA). For multiple comparisons, the Bonferroni test was applied. Spearman correlation analysis was conducted among the expression levels of genes detected by real-time PCR. P < 0.05 was considered to be statistically significance.

Results

CLIC1 is highly expressed in OGD/R-treated HT22 cells

We assessed the gene and protein expression of CLIC1 by real-time PCR and WB, respectively. Following exposure to OGD/R, HT22 cells exhibited higher mRNA and protein levels of CLIC1 compared with control cells (P = 0.014 and P < 0.001, respectively). After viral silencing of CLIC1 in HT22 cells, we saw a reduction in the CLIC1 expression level (Fig 2a-c).

Fig 2. CLIC1 upregulates and promotes apoptosis and reactive oxygen species (ROS) accumulation in oxygen and glucose deprivation/reoxygenation (OGD/R)-treated HT22 cells.

Fig 2

(a) Real-time PCR analysis of CLIC1 gene expression showed significantly higher expression in the OGD/R group compared to the control group, with a marked reduction upon CLIC1 silencing. (b, c) Western blot analysis of CLIC1 protein levels demonstrated increased CLIC1 expression in the OGD/R group and its suppression following CLIC1 silencing. (d-f) Flow cytometry analysis shows that elevated CLIC1 expression in OGD/R-treated HT22 cells led to an increased apoptosis rate (d, e) and higher ROS mean fluorescence intensity (MFI) values (d, f). These effects were reversed by silencing CLIC1. *P< 0.05 versus control group; ^P< 0.05 versus OGD/R group.

Upregulation of CLIC1 promoted oxidative stress-induced apoptosis in OGD/R-treated HT22 cells

Flow cytometric analysis showed that the upregulation of CLIC1 in OGD/R-exposed HT22 cells led to an increased apoptosis rate and mean fluorescence intensity (MFI) value for ROS. These levels were reduced by CLIC1 silencing (Fig 2d-f). Furthermore, increased CLIC1 expression in OGD/R-exposed HT22 cells resulted in decreased levels of SOD, CAT, and GSH-Px activity as well as a lower CCK-8 OD value and a higher LDH level. These changes were reversed by silencing CLIC1 (Fig 3a-e). Additionally, the expression level of Bcl-2 was lower and that of Bax was higher after OGD/R (Fig 3f-h). Upon CLIC1 silencing, both of the two indicators exhibited an inverse trend. These results indicate that increased expression of CLIC1 results in a redox imbalance in OGD/R-treated HT22 cells, which then aggravates oxidative stress-induced apoptosis.

Fig 3. CLIC1 upregulation accelerates oxidative stress in oxygen and glucose deprivation/reoxygenation (OGD/R)-treated HT22 cells.

Fig 3

(a-c) The activities of SOD (a), CAT (b), and GSH-Px (c) were significantly reduced in OGD/R-treated HT22 cells compared to the control group, with the restoration of these antioxidant enzyme activities upon CLIC1 silencing. (d) The LDH level was elevated in the OGD/R group and decreased following CLIC1 silencing. (e) The CCK-8 OD value was reduced in the OGD/R group and increased with CLIC1 silencing. (f-h) Real-time PCR (f) and WB (g,h) analyses showed that OGD/R treatment decreased anti-apoptotic Bcl-2 expression and increased pro-apoptotic Bax expression, with these effects reversed by CLIC1 silencing. Data are presented as mean ± SEM, with n = 3 per group. *P< 0.05 versus control group; ^P< 0.05 versus OGD/R group.

CLIC1 upregulation promoted NLRP3-mediated pyroptosis in OGD/R-treated HT22 cells

OGD/R resulted in the elevation of CLIC1, leading to higher expression levels of NLRP3, caspase-1, caspase-3, GSDMD, IL-1β, and IL-18, according to real-time PCR, WB, and/or ELISA analyses. Conversely, when CLIC1 was silenced, the expression levels of the aforementioned markers were all reduced (Fig 4). We further activated NLRP3 after silencing CLIC1 to confirm that NLRP3-mediated pyroptosis occurs in the OGD/R-treated HT22 cells. With the activation of NLRP3, the levels of caspase-1, caspase-3, GSDMD, IL-1β, and IL-18 were all increased on real-time PCR, WB, and/or ELISA analyses in the OGD/R+CLIC1 silencing+NLRP3 activation group compared with the corresponding levels in the OGD/R+CLIC1 silencing group. These results indicate that pyroptosis can be promoted by activation of NLRP3 in OGD/R-exposed HT22 cells. Together, these findings suggest that upregulation of CLIC1 improves NLRP3-mediated pyroptosis in OGD/R-exposed HT22 cells.

Fig 4. CLIC1 promotes NLRP3-mediated pyroptosis by inhibiting the Nrf2/HO-1 signalling pathway in oxygen and glucose deprivation/reoxygenation (OGD/R)-treated HT22 cells.

Fig 4

Real-time PCR, WB, and/or ELISA analyses show that the expression levels of inflammation- and pyroptosis-related indicators were all upregulated after the increased expression of CLIC1 in OGD/R-treated HT22 cells, via inhibiting the Nrf2/HO-1 pathway. (a-c) Real-time PCR (a) and WB (b, c) analyses showed upregulation of NLRP3 and caspase-1 expression in OGD/R-treated HT22 cells, with significant downregulation upon CLIC1 silencing. Inhibition of Nrf2/HO-1 signalling or activation of NLRP3 partly reversed the effects of CLIC1 silencing. (d-f) Real-time PCR (d) and WB (e, f) analyses of caspase-3 and GSDMD protein expression showed similar trends with NLRP3 and caspase-1. (g-j) Real-time PCR (g), WB (h,i), and ELISA (j) analyses revealed elevated levels of IL-1β and IL-18 in OGD/R-treated HT22 cells, which were reduced upon CLIC1 silencing. These cytokines were further upregulated with Nrf2/HO-1 inhibition or NLRP3 activation after CLIC1 silencing. Quantitative data were presented as mean ± SEM with three replicate experiments. *P< 0.05 versus control group; ^P< 0.05 versus OGD/R group; +P< 0.05 vs OGD/R+CLIC1 silencing group.

CLIC1 inhibits the Nrf2/HO-1 signalling pathway to promote apoptosis

The expression levels of Nrf2 and HO-1 in HT22 cells were reduced after OGD/R. Upon CLIC1 silencing, their expression levels were increased; however, they did not fully return to normal levels in all groups after OGD/R. We then applied CLIC1 silencing and inhibition of Nrf2/HO-1 signalling to explore whether the latter is the pathway responsible for the apoptosis in OGD/R HT22 cells. After inhibition of the Nrf2/HO-1 pathway, Nrf2 and HO-1 expression levels were obviously lower in the OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition group than in the OGD/R+CLIC1 silencing group (Fig 5a-c). Subsequently, the apoptosis rate and ROS MFI value were both higher in the OGD/R+ CLIC1 silencing+ Nrf2/HO-1 inhibition group compared with those in the OGD/R+CLIC1 silencing group (Fig 6a-c). In addition, the levels of SOD, CAT, GSH-Px activity and CCK-8 OD value were all reduced while the LDH level was increased after silencing CLIC1 and inhibiting Nrf2/HO-1 expression, and these changes were greater than those observed after merely silencing CLIC1 after OGD/R (Fig 7a-e). Furthermore, inhibition of Nrf2/HO-1 signalling resulted in a decrease in Bcl-2 expression and an increase in Bax expression (Fig 7f-h). These findings indicate that the Nrf2/HO-1 signalling pathway is important in neuronal protection, which alleviates oxidative stress-induced apoptosis. These processes are regulated by CLIC1 expression in OGD/R-induced HT22 cells.

Fig 5. High CLIC1 expression inhibits the Nrf2/HO-1 signalling pathway in oxygen and glucose deprivation/reoxygenation (OGD/R)-treated HT22 cells.

Fig 5

(a-c) Real-time PCR (a) and WB (b, c) analyses showed that Nrf2 and HO-1 expression levels were significantly downregulated in OGD/R-treated HT22 cells compared to the control group. CLIC1 silencing partially restored Nrf2 and HO-1 expression levels, although normal levels were not fully achieved in any group following OGD/R treatment. Data are shown as mean ± SEM, with n = 3 per group. *P< 0.05 versus control group; ^P< 0.05 versus OGD/R group; +P< 0.05 vs OGD/R+CLIC1 silencing group.

Fig 6. CLIC1 exacerbates apoptosis and reactive oxygen species (ROS) accumulation in oxygen and glucose deprivation/reoxygenation (OGD/R)-treated HT22 cells by inhibiting the Nrf2/HO-1 signalling pathway.

Fig 6

Flow cytometry analysis shows that inhibition of the Nrf2/HO-1 signalling pathway increased both the apoptosis rate (a, b) and ROS mean fluorescence intensity (MFI) value (a, c) in OGD/R-treated HT22 cells. These levels were higher in the OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition group compared to the OGD/R+CLIC1 silencing group.

Fig 7. CLIC1 accelerates oxidative stress in oxygen and glucose deprivation/reoxygenation (OGD/R)-treated HT22 cells by inhibiting the Nrf2/HO-1 signalling pathway.

Fig 7

(a-c) Activity of oxidative stress markers of SOD (a), CAT (b), and GSH-Px (c) was reduced following inhibition of the Nrf2/HO-1 signalling pathway. These reductions were more pronounced in the OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition group compared to the OGD/R+CLIC1 silencing group. (d) CCK-8 OD values were decreased after Nrf2/HO-1 inhibition, with lower values observed in the OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition group than the OGD/R+CLIC1 silencing group. (e) The LDH levels were increased after Nrf2/HO-1 inhibition and were significantly higher in the OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition group compared to the OGD/R+CLIC1 silencing group. (f-h) Real-time PCR (f) and WB (g, h) analyses showed that Bcl-2 expression was downregulated, while Bax expression was upregulated following Nrf2/HO-1 inhibition. These effects were more pronounced in the OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition group than the OGD/R+CLIC1 silencing group. Data were presented as mean ± SEM, with n = 3 per group. *P< 0.05 versus control group; ^P< 0.05 versus OGD/R group; +P< 0.05 vs OGD/R+CLIC1 silencing group.

CLIC1 inhibits the Nrf2/HO-1 signalling pathway to accelerate pyroptosis

As explained above, the increased CLIC1 led to decreased Nrf2/HO-1 expression. We also found that the expression levels of inflammation- and pyroptosis-related indicators NLRP3, caspase-1, caspase-3, GSDMD, IL-1β, and IL-18 were all increased after inhibiting the Nrf2/HO-1 pathway in HT22 cells treated with OGD/R, and their levels were higher in the OGD/R+CLIC1 silencing+ Nrf2/HO-1 inhibition group than in the OGD/R+CLIC1 silencing group (Fig 4). Thus, NLRP3-mediated pyroptosis could be accelerated by inhibiting the Nrf2/HO-1 signalling pathway. Conversely, comparing the OGD/R+CLIC1 silencing+ NLRP3 activation group to the OGD/R+CLIC1 silencing group, the activation of NLRP3 led to increased apoptosis rates (Fig. 6a, b) and MFI value of ROS (Fig. 6a, c). Meanwhile, NLRP3 activation was also found to exacerbate oxidative stress by downregulating the level of oxidative stress–related indices of SOD, CAT, GSH-PX, CCK-8 and Bal-2, and upregulating the level of LDH and Bax (Fig. 7). All these findings imply that NLRP3-mediated pyroptosis can in turn amplify oxidative stress and apoptotic processes, indicating these events may occur in a sequential or partially overlapping manner rather than as mutually exclusive forms of cell death.

Correlation of CLIC1 expression with apoptosis and pyroptosis-related genes

Fig 8 displays the heat maps of gene expression obtained from real-time PCR and the Spearman correlation analysis. The Spearman correlation analysis revealed a negative relationship between the gene expression level of CLIC1 and HO-1 (r = −0.40, P= 0.015) as well as Bcl-2 (r= −0.59, P< 0.001), and CLIC1 was positively related with Bax (r = 0.63, P < 0.0001). Meanwhile, the expression level of CLIC1 showed a positive correlation with NLRP3, caspase-1, caspase-3, GSDMD, IL-1β, and IL-18 (r= 0.45, P = 0.006; r = 0.62, P< 0.0001; r= 0.44, P= 0.007; r= 0.63, P < 0.0001; r = 0.65, P < 0.0001; r= 0.53, P < 0.001, respectively). In combination with the results presented above, these findings further suggest that CLIC1 promotes neuronal oxidative stress-induced apoptosis and NLRP3-mediated pyroptosis by inhibiting the Nrf2/HO-1 signalling pathway in OGD/R-treated HT22 cells.

Fig 8. Heatmaps of gene expression obtained from real-time PCR and the Spearman correlation analysis.

Fig 8

(a) Gene expression heatmap illustrates the relative expression levels of key genes (detected by real-time PCR) across all the six groups [the control, oxygen and glucose deprivation/reoxygenation (OGD/R), OGD/R+ negative control (NC), OGD/R+CLIC1 silencing, OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition, and OGD/R+CLIC1 silencing+NLRP3 activation]. Each row represents a specific gene, and each column represents a sample. (b) Correlation heatmap showing the Spearman correlation coefficients among the genes detected by real-time PCR. Each cell represents the correlation between two genes, with the colour gradient indicating the strength and direction of the correlation. *P< 0.05; **P< 0.01; ***P< 0.001; ****P< 0.0001.

Discussion

Our study aimed to assess the role of CLIC1 in modulating cellular responses to oxidative stress and inflammation in HT22 cells under OGD/R conditions, mimicking CIRI. CLIC1 expression was significantly elevated in OGD/R-treated HT22 cells, suggesting its role as a stress-responsive protein in cellular metabolism. Notably, following the targeted silencing of CLIC1, its expression was effectively downregulated, demonstrating the modulation achievable through genetic interventions in CIRI. CLIC1 upregulation promoted pro-apoptotic effects increasing apoptosis rate, evidenced by the increased oxidative stress markers such as ROS and LDH, decreased antioxidant enzyme activity (SOD, CAT, GSH-Px), and reduced CCK-8 levels. Furthermore, our study demonstrated that CLIC1 facilitates NLRP3-mediated pyroptosis in OGD/R HT22 cells, with elevated CLIC1 correlating with increased inflammasome and pyroptosis markers, including NLRP3, caspase-1, caspase-3, GSDMD, IL-1β, and IL-18. Conversely, silencing CLIC1 reduced these factors, validating its role in regulating apoptosis and pyroptosis. Mechanistically, we demonstrated that CLIC1 acts as a negative regulator of the Nrf2/HO-1 signalling pathway, a critical antioxidant defence mechanism. By inhibiting Nrf2/HO-1, CLIC1 amplified redox imbalance, oxidative stress, apoptosis, and pyroptosis. Furthermore, silencing CLIC1 enhanced Nrf2/HO-1 activity, alleviating neuronal injury. These findings propose CLIC1 as a novel molecular target for mitigating oxidative stress-induced neuronal damage and the inflammatory response in CIRI.

CLIC1 is a metamorphic protein that exists in both soluble cytoplasmic and membrane-associated forms, with the latter functioning as a chloride-selective ion channel [24]. It plays a key role in physiological processes such as stabilizing membrane potential, regulating pH, cell proliferation, fluid secretion, and maintaining cell volume [25]. Previous research has reported elevated CLIC1 levels in various neurological disorders and central nervous system cancers, such as Alzheimer’s disease and stroke [26,27]. For example, CLIC1 upregulates in CD8 T cells and natural killer cells in atrial fibrillation thrombi, indicating its potential involvement in cytotoxic activity and tissue injury, thereby posing a risk of cardioembolic stroke [27]. During reperfusion, CLIC1 may be upregulated as part of the cellular defence mechanism to counteract oxidative damage and regulate intracellular chloride levels. However, the overexpression of CLIC1 disrupts redox homeostasis by promoting ROS generation and altering mitochondrial function. By interacting with specific proteins, CLIC1 was reported to promote mitochondrial fragmentation, increases membrane potential and ROS production, and induces a metabolic shift toward glycolysis in endothelial cells [28]. Whereas, inhibition of CLIC1 reduced oxidative stress-induced damage by lowering ROS levels, decreasing intercellular adhesion molecule 1 (ICAM1) and vascular cell adhesion molecule 1 (VCAM1), and enhancing the activity of antioxidant enzymes, including SOD [17]. Furthermore, we observed that CLIC1 regulated apoptotic markers, such as the pro-apoptotic Bax and anti-apoptotic Bcl-2, highlighting its role in apoptosis process in OGD/R-treated HT22 cells. Oxidative stress-induced apoptosis in CIRI can be alleviated via modulating the Bcl-2/Bax signalling pathway, which involves the downregulation of Bax and upregulation of Bcl-2 [29,30]. These findings suggest that CLIC1 may contribute to CIRI by fostering a redox imbalance and promoting apoptosis.

Concurrently, we found that CLIC1 upregulation promoted NLRP3-mediated pyroptosis in OGD/R-treated HT22 cells. CLIC1 has been reported to translocate to the plasma membrane upon cellular activation, where it modulates ion homeostasis and cell signaling, including the production and release of pro-inflammatory cytokines. A previous study [18] demonstrated that both CLIC1 and CLIC4 participate in regulating the NLRP3 inflammasome. And knocking down CLIC1 and CLIC4 impairs IL-1β transcription, apoptosis-associated speck-like protein containing a CARD (ASC) speck formation and mature IL-1 secretion. Furthermore, Carlini et al.[31] revealed that CLIC1 levels were significantly elevated in peripheral blood mononuclear cells during chronic central nervous system inflammation, suggesting its potential involvement in inflammatory processes and acting as a potential marker of neurodegenerative processes. The NLRP3 inflammasome is pivotal in the inflammatory response associated with CIRI, triggering pyroptosis—a highly inflammatory form of programmed cell death [32]. By activating caspase-1 and GSDMD, NLRP3 facilitates the release of pro-inflammatory cytokine and release mature IL-1β and IL-18 by forming membrane pores [3234], amplifying the inflammatory damage and leading to pyroptosis [23]. Additionally, NLRP3 inflammasomes can further worsen stoke or CIRI by compromising the integrity of the blood-brain barrier [7,35]. By inhibiting or blocking NLRP3 activation early, it may be possible to prevent CIRI by reducing inflammation of brain endothelial cells and stabilizing the blood-brain barrier [7]. Besides, ion homeostasis disruption upon reperfusion can lead to cellular swelling and damage. During cytoplasmic oxidation or pH changes, soluble CLIC proteins translocate to the cell membrane, functioning as anion channels to stabilize cation fluctuations [18,36]. These interconnected roles of NLRP3 inflammasome activation and CLIC1 regulation highlight the broader implications of inflammatory and ionic homeostasis pathways in CIRI. Therapeutic interventions targeting these mechanisms could provide multifaceted protection, curbing inflammation and stabilizing cellular environments, suggesting potential avenues for more effective treatment strategies in ischemic stroke management.

CLIC1 functions as an oxidative stress sensor and has been reported to regulate cellular senescence and function via the Nrf2/HO-1 pathway [17]. However, the precise initial downstream mechanisms remain unclear. Evidence suggests that CLIC1 inhibition increases intracellular Ca2⁺ via the L-type Ca2+ channel (LTCC) [37]. In response to stressful oxidation conditions, CLIC1 modulates Nrf2 signaling by altering Ca2+ homeostasis [38]. Besides, CLIC1 overexpression inhibits Nrf2 nuclear translocation and contributes to hydrogen peroxide-induced mitochondrial dysfunction and fission. As a key antioxidant transcription factor, Nrf2 also plays a significant role in reducing inflammation [39]. The overexpressed CLIC1 was found to supress Nrf2 nuclear translocation and Nrf2/HO-1 pathway [17]. HO-1 plays a critical role in breaking down heme into metabolites, which confers protection against oxidative injury and inflammation and resists to oxidative damage by mitigating cellular stress. Elevated HO-1 levels are widely acknowledged as protective, reducing ROS production, preventing neuronal apoptosis, and stabilizing cell membranes [40,41]. Importantly, activation of the Nrf2/HO-1 pathway has also been shown to suppress pyroptosis mediated by the NLRP3 inflammasome, caspase-1, and GSDMD, further underscoring its protective effects [4245]. Conversely, suppression of the Nrf2/HO-1 pathway exacerbates NLRP3 activation and oxidative damage in OGD/R conditions, as demonstrated in studies linking Nrf2 downregulation with heightened inflammasome activity [46,47]. We aimed to clarify the mechanistic relationship between CLIC1 and NLRP3 in OGD/R-induced injury by showing that re-activation of NLRP3 in CLIC1-silenced cells restores pyroptosis, supporting NLRP3 as the key downstream effector of CLIC1. However, since OGD/R alone activates NLRP3, silencing NLRP3 directly may have been a more definitive approach, and we will refine this aspect in future studies.

Although apoptosis is often described as a non-inflammatory form of cell death, it has the capacity to trigger mild inflammatory responses [48]. We found that NLRP3-driven pyroptosis can in turn amplify oxidative stress and apoptotic processes, by regulating oxidative stress–related indices, MFI value of ROS and apoptosis rates. Together, these cell death mechanisms play distinct yet overlapping roles in both eliminating damaged cells and activating immune responses to CIRI. Apoptosis aids in clearing infected cells by phagocytes through efferocytosis, whereas pyroptosis, driven by the inflammasome, facilitates the removal of intracellular pathogens and the activation of immune responses [48,49]. Notably, our experiments measure signals of cell cluster, and the apparent co-activation of both death pathways may reflect different subpopulations of cells—some undergoing apoptosis, others pyroptosis. The correlation of CLIC1 with markers of both processes further indicates its central role in creating the stress environment, rather than the simultaneous occurrence of both forms of death in all cells. Additionally, recent research has demonstrated the possibility of transition and crosstalk between pyroptosis and apoptosis mechanisms. For example, Yuan et al. [50] found that the saponin monomer 13 of dwarf lilyturf tuber (DT-13) inhibits methylglyoxal-induced pyroptosis and facilitates a shift toward apoptosis by specifically modulating Caspase3/gasdermin E pathway in human umbilical vein endothelial cells. This underscores the plasticity between the two kinds of cell death form. Cao et al. [51] demonstrated that under diabetic and high glucose conditions, unfolded protein response pathways, the NLRP3 inflammasome, and apoptosis are activated in podocytes. NLRP3 overexpression promoted both high glucose-induced pyroptosis and apoptosis, and thioredoxin-interacting protein serves as a key link that mediated the mutual transformation between these two forms of cell death. However, apoptosis and pyroptosis relative contributions in CIRI depend on variables such as the specific experimental model used, the severity and duration of ischemia, and the extent of reperfusion injury. Considering this complexity, therapeutic strategies that integrate both anti-inflammatory and antioxidant or transformation of cell death forms hold great potential for managing CIRI.

Currently, the primary long-term objective of CIRI therapy aims to restore blood flow, reduce secondary damage, and minimize stroke-related neuronal cell death, disability, and mortality [52]. The treatment strategies for CIRI mainly include pre-ischemic preconditioning, post-ischemic preconditioning, and pharmacological preconditioning. Various pharmacological and interventional therapies have been developed to mitigate CIRI. However, the complexity of CIRI and the intricate interplay among various signalling pathways present significant challenges, leading to a lack of consensus in existing research [53,54]. Antioxidant and anti-inflammatory agents have shown promising neuroprotective measures in preclinical CIRI models [55]. Although there are no specific studies directly focusing on CLIC1 inhibitors for CIRI, previous studies [25,27,56] have suggested CLIC1 as a potential therapeutic target for central nervous system diseases, such as neurodegenerative diseases and ischemic stroke. For example, inhibition of CLIC1 channels may effectively suppress microglial proliferation and mitigated the neurotoxicity induced by Aβ-treated microglial cells [25]. Furthermore, a recent study [56] elucidates the regulatory role of circAPP in Alzheimer’s disease via the miR-1906/CLIC1 axis during microglial polarisation. All these findings suggest that CLIC1 is a critical therapeutic target for central nervous system disorders and holds promising potential for treating CIRI. Furthermore, therapeutic regimens should aim to control CLIC1 temporally or spatially, adapting treatment to the disease stage or severity. The goal of targeted therapy is to inhibit its deleterious effects without completely abolishing its physiological function.

While our study primarily focuses on the mechanistic association between CLIC1 and Nrf2/HO-1 in regulating apoptosis and pyroptosis, additional oxidative stress-response pathways or regulatory networks, such as Wnt, nuclear factor kappa-B (NF-κB) and mitogen-activated protein kinase (MAPK) signalling [53,55,57], might also play a role in the observed phenomena. The activation of the canonical Wnt pathway during ischemic and reperfusion phases exerts organ-protective effects, whereas the activation of non-canonical Wnt pathway contributes to injury [53]. The suppression of NF-κB and MAPK signalling pathways was reported to inhibit the activation of microglia and reduce the production of inflammatory cytokines after OGD/R treatment, thereby protecting against neuronal injury [57]. These pathways and innovative approaches to treatment are critical contributors to cellular stress responses, inflammation, and apoptosis in CIRI. However, their potential crosstalk with CLIC1 remains to be fully understood. Further research is essential to develop and validate selective CLIC1 inhibitors to improve their clinical application. Moving forward, we hope to investigate CIRI treatment through molecular docking or macromolecular channel screening drugs.

Conclusions

The critical role of CLIC1 in mediating oxidative stress, inflammation, and neuronal damage highlights its potential as a therapeutic target through regulation of the Nrf2/HO-1 signalling pathway. This targeted strategy for CIRI may address the current treatment gaps and substantially advance ischemic stroke therapy.

Supporting information

S1 File. Original PCR data for CLIC1, Nrf2, HO-1, Bcl-2, Bax, Caspase 3, NLRP3, Caspase 1, IL-1β, IL-18, and GSDMD in the control, OGD/R, NC, CLIC1 silencing, OGD/R+NC, and OGD/R+CLIC1 silencing groups.

(XLS)

pone.0332698.s001.xls (75KB, xls)
S2 File. Original PCR data for CLIC1, Nrf2, HO-1, Bcl-2, Bax, Caspase 3, NLRP3, Caspase 1, IL-1β, IL-18, and GSDMD in the control, OGD/R, OGD/R+N, OGD/R+CLIC1 silencing, OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition, and OGD/R+CLIC1 silencing+NLRP3 activation groups.

(XLS)

pone.0332698.s002.xls (78.5KB, xls)
S3 File. Original Western blot data for CLIC1, Nrf2, HO-1, Bcl-2, Bax, Caspase 3, NLRP3, Caspase 1, IL-1β, IL-18, and GSDMD in each group.

(XLSX)

pone.0332698.s003.xlsx (42.3KB, xlsx)
S4 File. Original ELISA data for IL-1β and IL-18, as well as original SOD, CAT, GPX, and LDH data in each group.

(XLSX)

pone.0332698.s004.xlsx (46.6KB, xlsx)
S5 File. Original flow cytometry data (ROS and apoptosis) and CCK-8 data in each group.

(XLSX)

pone.0332698.s005.xlsx (14.6KB, xlsx)
S6 File. Original Western blot figures of each group.

(PDF)

pone.0332698.s006.pdf (1.1MB, pdf)

Acknowledgments

We thank Charlesworth for scientific editing of this manuscript.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This research was supported by the Liaoning Provincial Science and Technology Program (2022-MS-329), the General Program of National Natural Science Foundation of China (82071911), and the Science and Technology Innovation Fund of Dalian (2021JJ12SN38). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Long Y, Liu S, Wan J, Zhang Y, Li D, Yu S, et al. Brain targeted borneol-baicalin liposome improves blood-brain barrier integrity after cerebral ischemia-reperfusion injury via inhibiting HIF-1α/VEGF/eNOS/NO signal pathway. Biomed Pharmacother. 2023;160:114240. doi: 10.1016/j.biopha.2023.114240 [DOI] [PubMed] [Google Scholar]
  • 2.Premilovac D, Sutherland BA. Acute and long-term changes in blood flow after ischemic stroke: challenges and opportunities. Neural Regen Res. 2023;18(4):799–800. doi: 10.4103/1673-5374.350699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wang Z, Li Y, Ye Y, Zhu H, Zhang J, Wang H, et al. NLRP3 inflammasome deficiency attenuates cerebral ischemia-reperfusion injury by inhibiting ferroptosis. Brain Res Bull. 2023;193:37–46. doi: 10.1016/j.brainresbull.2022.11.016 [DOI] [PubMed] [Google Scholar]
  • 4.Liao S, Apaijai N, Chattipakorn N, Chattipakorn SC. The possible roles of necroptosis during cerebral ischemia and ischemia / reperfusion injury. Arch Biochem Biophys. 2020;695:108629. doi: 10.1016/j.abb.2020.108629 [DOI] [PubMed] [Google Scholar]
  • 5.Coimbra-Costa D, Alva N, Duran M, Carbonell T, Rama R. Oxidative stress and apoptosis after acute respiratory hypoxia and reoxygenation in rat brain. Redox Biol. 2017;12:216–25. doi: 10.1016/j.redox.2017.02.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shi J, Gao W, Shao F. Pyroptosis: Gasdermin-Mediated Programmed Necrotic Cell Death. Trends Biochem Sci. 2017;42(4):245–54. doi: 10.1016/j.tibs.2016.10.004 [DOI] [PubMed] [Google Scholar]
  • 7.Duan W-L, Wang X-J, Ma Y-P, Sheng Z-M, Dong H, Zhang L-Y, et al. Therapeutic strategies targeting the NLRP3‑mediated inflammatory response and pyroptosis in cerebral ischemia/reperfusion injury (Review). Mol Med Rep. 2024;29(3):46. doi: 10.3892/mmr.2024.13170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang J-Y, Zhou B, Sun R-Y, Ai Y-L, Cheng K, Li F-N, et al. The metabolite α-KG induces GSDMC-dependent pyroptosis through death receptor 6-activated caspase-8. Cell Res. 2021;31(9):980–97. doi: 10.1038/s41422-021-00506-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Frank D, Vince JE. Pyroptosis versus necroptosis: similarities, differences, and crosstalk. Cell Death Differ. 2019;26(1):99–114. doi: 10.1038/s41418-018-0212-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Heneka MT, McManus RM, Latz E. Inflammasome signalling in brain function and neurodegenerative disease. Nat Rev Neurosci. 2018;19(10):610–21. doi: 10.1038/s41583-018-0055-7 [DOI] [PubMed] [Google Scholar]
  • 11.Wallach D, Kang T-B, Dillon CP, Green DR. Programmed necrosis in inflammation: Toward identification of the effector molecules. Science. 2016;352(6281):aaf2154. doi: 10.1126/science.aaf2154 [DOI] [PubMed] [Google Scholar]
  • 12.Jiao-Yan Y, Qing-Qing L, Xi L, Mei Z, Ting S, Na H, et al. Oxymatrine improves blood-brain barrier integrity after cerebral ischemia-reperfusion injury by downregulating CAV1 and MMP9 expression. Phytomedicine. 2021;84:153505. doi: 10.1016/j.phymed.2021.153505 [DOI] [PubMed] [Google Scholar]
  • 13.Uivarosan D, Bungau S, Tit DM, Moisa C, Fratila O, Rus M, et al. Financial Burden of Stroke Reflected in a Pilot Center for the Implementation of Thrombolysis. Medicina (Kaunas). 2020;56(2):54. doi: 10.3390/medicina56020054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xu M-S, Yin L-M, Cheng A-F, Zhang Y-J, Zhang D, Tao M-M, et al. Cerebral Ischemia-Reperfusion Is Associated With Upregulation of Cofilin-1 in the Motor Cortex. Front Cell Dev Biol. 2021;9:634347. doi: 10.3389/fcell.2021.634347 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Salao K, Jiang L, Li H, Tsai VW-W, Husaini Y, Curmi PMG, et al. CLIC1 regulates dendritic cell antigen processing and presentation by modulating phagosome acidification and proteolysis. Biol Open. 2016;5(5):620–30. doi: 10.1242/bio.018119 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Al Khamici H, Brown LJ, Hossain KR, Hudson AL, Sinclair-Burton AA, Ng JPM, et al. Members of the chloride intracellular ion channel protein family demonstrate glutaredoxin-like enzymatic activity. PLoS One. 2015;10(1):e115699. doi: 10.1371/journal.pone.0115699 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lu D, Le Y, Ding J, Dou X, Mao W, Zhu J. CLIC1 Inhibition Protects Against Cellular Senescence and Endothelial Dysfunction Via the Nrf2/HO-1 Pathway. Cell Biochem Biophys. 2021;79(2):239–52. doi: 10.1007/s12013-020-00959-6 [DOI] [PubMed] [Google Scholar]
  • 18.Domingo-Fernández R, Coll RC, Kearney J, Breit S, O’Neill LAJ. The intracellular chloride channel proteins CLIC1 and CLIC4 induce IL-1β transcription and activate the NLRP3 inflammasome. J Biol Chem. 2017;292(29):12077–87. doi: 10.1074/jbc.M117.797126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Djuric U, Lam KHB, Kao J, Batruch I, Jevtic S, Papaioannou M-D, et al. Defining Protein Pattern Differences Among Molecular Subtypes of Diffuse Gliomas Using Mass Spectrometry. Mol Cell Proteomics. 2019;18(10):2029–43. doi: 10.1074/mcp.RA119.001521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chen G-H, Song C-C, Pantopoulos K, Wei X-L, Zheng H, Luo Z. Mitochondrial oxidative stress mediated Fe-induced ferroptosis via the NRF2-ARE pathway. Free Radic Biol Med. 2022;180:95–107. doi: 10.1016/j.freeradbiomed.2022.01.012 [DOI] [PubMed] [Google Scholar]
  • 21.Zhang Q, Wang J, Zhang H, Zeng T. Dihydromyricetin inhibits oxidative stress and apoptosis in oxygen and glucose deprivation/reoxygenation‑induced HT22 cells by activating the Nrf2/HO‑1 pathway. Molecular Medicine Reports. 2021;23(6).doi: 10.3892/mmr.2021.12036 [DOI] [PubMed] [Google Scholar]
  • 22.Wang L, Zhang X, Xiong X, Zhu H, Chen R, Zhang S, et al. Nrf2 Regulates Oxidative Stress and Its Role in Cerebral Ischemic Stroke. Antioxidants (Basel). 2022;11(12):2377. doi: 10.3390/antiox11122377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Swanson KV, Deng M, Ting JP-Y. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 2019;19(8):477–89. doi: 10.1038/s41577-019-0165-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Barbieri F, Verduci I, Carlini V, Zona G, Pagano A, Mazzanti M, et al. Repurposed Biguanide Drugs in Glioblastoma Exert Antiproliferative Effects via the Inhibition of Intracellular Chloride Channel 1 Activity. Front Oncol. 2019;9:135. doi: 10.3389/fonc.2019.00135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Luo L, Song S, Ezenwukwa CC, Jalali S, Sun B, Sun D. Ion channels and transporters in microglial function in physiology and brain diseases. Neurochem Int. 2021;142:104925. doi: 10.1016/j.neuint.2020.104925 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gururaja Rao S, Patel NJ, Singh H. Intracellular Chloride Channels: Novel Biomarkers in Diseases. Front Physiol. 2020;11:96. doi: 10.3389/fphys.2020.00096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Renedo D, Barak T, DeLong J, Acosta JN, Sujijantarat N, Koo A, et al. Characterizing Stroke Clots Using Single-Cell Sequencing. J Am Heart Assoc. 2025;14(17):eJAHA2025041738T. doi: 10.1161/JAHA.125.041738 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Alzaydi MM, Abdul-Salam VB, Whitwell HJ, Russomanno G, Glynos A, Capece D, et al. Intracellular Chloride Channels Regulate Endothelial Metabolic Reprogramming in Pulmonary Arterial Hypertension. Am J Respir Cell Mol Biol. 2023;68(1):103–15. doi: 10.1165/rcmb.2022-0111OC [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sun X, Cui X. Isorhapontigenin alleviates cerebral ischemia/reperfusion injuries in rats and modulated the PI3K/Akt signaling pathway. Naunyn Schmiedebergs Arch Pharmacol. 2020;393(9):1753–60. doi: 10.1007/s00210-019-01794-0 [DOI] [PubMed] [Google Scholar]
  • 30.Zhou S, Gao X, Chen C, Zhang J, Zhang Y, Zhang L, et al. Porcine cardiac blood - Salvia miltiorrhiza root alleviates cerebral ischemia reperfusion injury by inhibiting oxidative stress induced apoptosis through PI3K/AKT/Bcl-2/Bax signaling pathway. J Ethnopharmacol. 2023;316:116698. doi: 10.1016/j.jep.2023.116698 [DOI] [PubMed] [Google Scholar]
  • 31.Carlini V, Verduci I, Cianci F, Cannavale G, Fenoglio C, Galimberti D, et al. CLIC1 Protein Accumulates in Circulating Monocyte Membrane during Neurodegeneration. Int J Mol Sci. 2020;21(4):1484. doi: 10.3390/ijms21041484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Place DE, Kanneganti T-D. Recent advances in inflammasome biology. Curr Opin Immunol. 2018;50:32–8. doi: 10.1016/j.coi.2017.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Orekhov AN, Nikiforov NG, Omelchenko AV, Sinyov VV, Sobenin IA, Vinokurov AY, et al. The Role of Mitochondrial Mutations in Chronification of Inflammation: Hypothesis and Overview of Own Data. Life (Basel). 2022;12(8):1153. doi: 10.3390/life12081153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Coll RC, Schroder K, Pelegrín P. NLRP3 and pyroptosis blockers for treating inflammatory diseases. Trends Pharmacol Sci. 2022;43(8):653–68. doi: 10.1016/j.tips.2022.04.003 [DOI] [PubMed] [Google Scholar]
  • 35.Bellut M, Papp L, Bieber M, Kraft P, Stoll G, Schuhmann MK. NLPR3 inflammasome inhibition alleviates hypoxic endothelial cell death in vitro and protects blood-brain barrier integrity in murine stroke. Cell Death Dis. 2021;13(1):20. doi: 10.1038/s41419-021-04379-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chae BJ, Lee K-S, Hwang I, Yu J-W. Extracellular Acidification Augments NLRP3-Mediated Inflammasome Signaling in Macrophages. Immune Netw. 2023;23(3):e23. doi: 10.4110/in.2023.23.e23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lee J-R, Lee J-Y, Kim H-J, Hahn M-J, Kang J-S, Cho H. The inhibition of chloride intracellular channel 1 enhances Ca2+ and reactive oxygen species signaling in A549 human lung cancer cells. Exp Mol Med. 2019;51(7):1–11. doi: 10.1038/s12276-019-0279-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ko M, Jung H-Y, Lee D, Jeon J, Kim J, Baek S, et al. Inhibition of chloride intracellular channel protein 1 (CLIC1) ameliorates liver fibrosis phenotype by activating the Ca2+-dependent Nrf2 pathway. Biomed Pharmacother. 2023;168:115776. doi: 10.1016/j.biopha.2023.115776 [DOI] [PubMed] [Google Scholar]
  • 39.Luo J-F, Shen X-Y, Lio CK, Dai Y, Cheng C-S, Liu J-X, et al. Activation of Nrf2/HO-1 Pathway by Nardochinoid C Inhibits Inflammation and Oxidative Stress in Lipopolysaccharide-Stimulated Macrophages. Front Pharmacol. 2018;9:911. doi: 10.3389/fphar.2018.00911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wu Z, Uchi H, Morino-Koga S, Shi W, Furue M. Z-ligustilide ameliorated ultraviolet B-induced oxidative stress and inflammatory cytokine production in human keratinocytes through upregulation of Nrf2/HO-1 and suppression of NF-κB pathway. Exp Dermatol. 2015;24(9):703–8. doi: 10.1111/exd.12758 [DOI] [PubMed] [Google Scholar]
  • 41.Zeng Q, Lian W, Wang G, Qiu M, Lin L, Zeng R. Pterostilbene induces Nrf2/HO-1 and potentially regulates NF-κB and JNK-Akt/mTOR signaling in ischemic brain injury in neonatal rats. 3 Biotech. 2020;10(5):192. doi: 10.1007/s13205-020-02167-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pang Y, Zhang P-C, Lu R-R, Li H-L, Li J-C, Fu H-X, et al. Andrade-Oliveira Salvianolic Acid B Modulates Caspase-1-Mediated Pyroptosis in Renal Ischemia-Reperfusion Injury via Nrf2 Pathway. Front Pharmacol. 2020;11:541426. doi: 10.3389/fphar.2020.541426 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jia L, Gong Y, Jiang X, Fan X, Ji Z, Ma T, et al. Ginkgolide C inhibits ROS-mediated activation of NLRP3 inflammasome in chondrocytes to ameliorate osteoarthritis. J Ethnopharmacol. 2024;325:117887. doi: 10.1016/j.jep.2024.117887 [DOI] [PubMed] [Google Scholar]
  • 44.Yan Z, Qi W, Zhan J, Lin Z, Lin J, Xue X, et al. Activating Nrf2 signalling alleviates osteoarthritis development by inhibiting inflammasome activation. J Cell Mol Med. 2020;24(22):13046–57. doi: 10.1111/jcmm.15905 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Lv C, Cheng T, Zhang B, Sun K, Lu K. Triptolide protects against podocyte injury in diabetic nephropathy by activating the Nrf2/HO-1 pathway and inhibiting the NLRP3 inflammasome pathway. Ren Fail. 2023;45(1):2165103. doi: 10.1080/0886022X.2023.2165103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen Z, Zhong H, Wei J, Lin S, Zong Z, Gong F, et al. Inhibition of Nrf2/HO-1 signaling leads to increased activation of the NLRP3 inflammasome in osteoarthritis. Arthritis Res Ther. 2019;21(1):300. doi: 10.1186/s13075-019-2085-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Xu X, Zhang L, Ye X, Hao Q, Zhang T, Cui G, et al. Nrf2/ARE pathway inhibits ROS-induced NLRP3 inflammasome activation in BV2 cells after cerebral ischemia reperfusion. Inflamm Res. 2018;67(1):57–65. doi: 10.1007/s00011-017-1095-6 [DOI] [PubMed] [Google Scholar]
  • 48.Dejas L, Santoni K, Meunier E, Lamkanfi M. Regulated cell death in neutrophils: From apoptosis to NETosis and pyroptosis. Semin Immunol. 2023;70:101849. doi: 10.1016/j.smim.2023.101849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Li L, Dickinson MS, Coers J, Miao EA. Pyroptosis in defense against intracellular bacteria. Seminars in Immunology. 2023;69:101805. doi: 10.1016/j.smim.2023.101805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Yuan R, Xu H, Wang M, Guo L, Yao Y, Zhang X, et al. Promoting the transition from pyroptosis to apoptosis in endothelial cells: a novel approach to alleviate methylglyoxal-induced vascular damage. J Transl Med. 2025;23(1):170. doi: 10.1186/s12967-025-06195-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Cao Y, Hu L, Chen R, Chen Y, Liu H, Wei J. Unfolded protein response-activated NLRP3 inflammasome contributes to pyroptotic and apoptotic podocyte injury in diabetic kidney disease via the CHOP-TXNIP axis. Cell Signal. 2025;130:111702. doi: 10.1016/j.cellsig.2025.111702 [DOI] [PubMed] [Google Scholar]
  • 52.Li M, Tang H, Li Z, Tang W. Emerging Treatment Strategies for Cerebral Ischemia-Reperfusion Injury. Neuroscience. 2022;507:112–24. doi: 10.1016/j.neuroscience.2022.10.020 [DOI] [PubMed] [Google Scholar]
  • 53.Zhang M, Liu Q, Meng H, Duan H, Liu X, Wu J, et al. Ischemia-reperfusion injury: molecular mechanisms and therapeutic targets. Signal Transduct Target Ther. 2024;9(1):12. doi: 10.1038/s41392-023-01688-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Pell VR, Spiroski A-M, Mulvey J, Burger N, Costa ASH, Logan A, et al. Ischemic preconditioning protects against cardiac ischemia reperfusion injury without affecting succinate accumulation or oxidation. J Mol Cell Cardiol. 2018;123:88–91. doi: 10.1016/j.yjmcc.2018.08.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Xu Q, Cheung RTF. Melatonin at repeated doses alleviates hyperglycemia-exacerbated cerebral ischemia-reperfusion injury at 72 h via anti-inflammation and anti-apoptosis. IBRO Neurosci Rep. 2024;16:418–27. doi: 10.1016/j.ibneur.2024.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wu D-P, Wei Y-S, Hou L-X, Du Y-X, Yan Q-Q, Liu L-L, et al. Circular RNA APP contributes to Alzheimer’s disease pathogenesis by modulating microglial polarization via miR-1906/CLIC1 axis. Alzheimers Res Ther. 2025;17(1):44. doi: 10.1186/s13195-025-01698-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Zhao R, Zhou X, Zhao Z, Liu W, Lv M, Zhang Z, et al. Farrerol Alleviates Cerebral Ischemia-Reperfusion Injury by Promoting Neuronal Survival and Reducing Neuroinflammation. Mol Neurobiol. 2024;61(9):7239–55. doi: 10.1007/s12035-024-04031-9 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Songyun Zhao

1 Dec 2024

Dear Dr. Sun,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jan 15 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Songyun Zhao

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure: [This research was supported by the Liaoning Provincial Science and Technology Program (2022-MS-329), the General Program of National Natural Science Foundation of China�82071911�, and the Science and Technology Innovation Fund of Dalian�2021JJ12SN38�.]. Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. We note that your Data Availability Statement is currently as follows: [All relevant data are within the manuscript.] Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition). For example, authors should submit the following data: - The values behind the means, standard deviations and other measures reported; - The values used to build graphs; - The points extracted from images for analysis. Authors do not need to submit their entire data set if only a portion of the data was used in the reported study. If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories. If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access.

4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

5. Please include a caption for figure 8.

6. Please ensure that you refer to Figure 7 in your text as, if accepted, production will need this reference to link the reader to the figure.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: No

Reviewer #2: Yes

**********

Reviewer #1: This study examines the role of chloride intracellular channel 1 (CLIC1) in oxidative stress and inflammation during cerebral ischemia–reperfusion injury (CIRI) using an oxygen and glucose deprivation/reoxygenation (OGD/R) model in HT22 hippocampal neurons. The results show that CLIC1 is significantly upregulated under OGD/R conditions, leading to neuronal damage by suppressing the Nrf2/HO-1 signaling pathway. This suppression exacerbates oxidative stress, inducing apoptosis and NLRP3 inflammasome-mediated pyroptosis. Silencing CLIC1 alleviates these effects, reducing oxidative stress markers, inflammasome activity, and cell death. The findings highlight CLIC1's dual role in apoptosis and pyroptosis and suggest its potential as a therapeutic target to mitigate CIRI-induced neuronal injury by modulating the Nrf2/HO-1 pathway. I recommend publishing this manuscript with the inclusion of the following significant corrections, elaborated below, to further enhance its clarity, robustness, and scientific rigor.

1. Figures: Figures need higher resolution (300–600 dpi, per PLOS ONE guidelines) and more detailed, self-explanatory legends to improve clarity and interpretability.

2. Heatmaps: Gene expression and correlation heatmaps require better labeling for easier understanding.

3. Abbreviation Use: Abbreviations (e.g., NLRP3, GSDMD) should be defined at first mention and used consistently throughout the text.

4. Reference Formatting: The reference list does not fully adhere to journal guidelines. Full journal names (e.g., "Biomedicine & Pharmacotherapy" instead of "Biomed Pharmacother") and consistent DOI formatting are required.

5. Language and Grammar: Minor grammatical issues (e.g., “to promoted apoptosis” instead of “to promote apoptosis”) and wordiness reduce readability and need correction.

6. Novelty: The study needs to better emphasize its novel contribution, particularly the regulatory role of CLIC1 in the Nrf2/HO-1 pathway and its implications.

7. Mechanistic Clarity: While the study links CLIC1 to pyroptosis/apoptosis via Nrf2/HO-1, it does not explore alternative pathways or contributing factors, such as other stress-response mechanisms.

8. Experimental Design:

- Control Groups: Details on control groups, including sham-treated groups, are insufficient, raising concerns about baseline comparisons.

- Sample Size: With only three replicates per group, conclusions may lack statistical robustness. A power analysis is needed.

9. Pathway Validation: The evidence for Nrf2/HO-1 inhibition or silencing requires stronger validation, such as co-immunoprecipitation or experiments using pathway-specific inhibitors.

10. Methods: Experimental details, including validation of viral silencing and OGD/R treatment conditions, are inadequately described, which may hinder reproducibility.

Addressing these issues will significantly improve the manuscript’s clarity, scientific rigor, and alignment with journal guidelines.

Reviewer #2: In this manuscript, the authors use a well-established model (OGD/R-treated HT22 cells) and robust methodologies, including real-time PCR, western blotting, flow cytometry, and ELISA, to investigate apoptosis and pyroptosis. The study links CLIC1 overexpression with oxidative stress-induced apoptosis and NLRP3-mediated pyroptosis, providing mechanistic evidence via modulation of the Nrf2/HO-1 pathway. To enhance the study's rigor, several improvements could be made:

1. Lack of In Vivo Validation: While the cell model findings are significant, they may not fully translate to in vivo systems. Including animal studies would strengthen the conclusions. Please add in vivo experimental verification if conditions permit.

2. Some sentences are overly complex, leading to occasional ambiguity (e.g., in the introduction and discussion).

3. Several grammatical errors and awkward sentence structures are present. For example: "And this process led to an exacerbation of apoptosis..." → Avoid starting sentences with "And." "Upon CLIC1 silencing, all the mentioned indicators above exhibited an inverse trend..." → Simplify to: "Silencing CLIC1 reversed these effects." Repetition: The phrase "CLIC1 silencing" is overused. Vary terminology to improve readability.

4. In the discussion section, while the discussion highlights the importance of the findings, it occasionally reiterates results rather than expanding on their broader implications.

**********

what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 Sep 18;20(9):e0332698. doi: 10.1371/journal.pone.0332698.r002

Author response to Decision Letter 1


31 Jan 2025

Dear Editor and Reviewer

We would like to express our sincere appreciation to the editor for overseeing the peer review process and for providing us with the valuable opportunity to revise our manuscript. We are deeply grateful for your time, effort, and guidance, which have been invaluable in improving the quality and clarity of our work.

We extend our heartfelt thanks to the reviewers for their constructive and insightful comments, which have greatly contributed to enhancing the manuscript and the impact of our research.

In response to all the suggestions, we have carefully addressed each comment and revised the manuscript accordingly. We hope that the updated version meets the journal's publication requirements.

Please check the file of Response to reviewers.

Besides, due to the reviewer's request to increase the image resolution, we have re-uploaded the figures with a larger file size. We would be grateful for your understanding.

Thank you once again for your support and guidance throughout this process.Please do not hesitate to contact us if further revisions or additional steps are required.

Sincerely,

Chuang Sun

Attachment

Submitted filename: Response to reviewers.docx

pone.0332698.s008.docx (17MB, docx)

Decision Letter 1

Songyun Zhao

21 Feb 2025

Dear Dr. Sun,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 07 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Songyun Zhao

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions??>

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #2: Yes

**********

Reviewer #2:  The author have addressed my concerns properly.

However, some of the references in the article are dated. It is recommended to add recently published studies on related topics in the field.

Please add the following references

1. Zhao, S., Zhuang, H., Ji, W. et al. Identification of Disulfidptosis-Related Genes in Ischemic Stroke by Combining Single-Cell Sequencing, Machine Learning Algorithms, and In Vitro Experiments. Neuromol Med 26, 39 (2024). https://doi.org/10.1007/s12017-024-08804-2.

2. Qian, Y., Yang, L., Chen, J. et al. SRGN amplifies microglia-mediated neuroinflammation and exacerbates ischemic brain injury. J Neuroinflammation 21, 35 (2024). https://doi.org/10.1186/s12974-024-03026-6.

3. Zhuang H, Lei W, Wu Q, Zhao S, Zhao Y, Zhang S, Zhao N, Sun J, Liu Y. Overexpressed CD73 attenuates GSDMD-mediated astrocyte pyroptosis induced by cerebral ischemia-reperfusion injury through the A2B/NF-κB pathway. Exp Neurol. 2025 Jan 18;386:115152. doi: 10.1016/j.expneurol.2025.115152.

**********

what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org

PLoS One. 2025 Sep 18;20(9):e0332698. doi: 10.1371/journal.pone.0332698.r004

Author response to Decision Letter 2


19 Apr 2025

Dear Editor,

Thank you for providing us with the opportunity to revise our manuscript and for the valuable feedback from the reviewers.

We sincerely apologize for the oversight in updating our references and for not paying close attention to the status of cited literature during the long period of writing the article. This has been an important learning experience, and we will ensure greater diligence in future writing and reference management. We are grateful for your constructive guidance, which has benefited us greatly.

We have carefully reviewed each reference and made necessary adjustments. The added references have been incorporated into the revised manuscript.

We hope these revisions improve the scientific rigor and clarity of the manuscript. Should you require any further clarification or changes, please feel free to contact us.

Pleases check the file of Response to Reviewers.Thank you again for your time, support, and guidance.

Sincerely,

Chuang Sun

Attachment

Submitted filename: Response_to_Reviewers_auresp_2.docx

pone.0332698.s009.docx (44.2KB, docx)

Decision Letter 2

Mária Deli

12 Jun 2025

CLIC 1 down-regulates Nrf2/HO-1 signalling pathway promoting the apoptosis and pyroptosis in OGD/R-treated HT22 cells

PLOS ONE

Dear Dr. Sun,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses all the points raised during the review process.

Please submit your revised manuscript by Jul 26 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Mária A. Deli, M.D., Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments:

Unfortunately none of the original 2 reviewers were available for the re-review of the manuscript. A third independent reviewer was asked to evaluate the second revision, who very carefully and critically read the paper and suggested several improvements. While no further experiments are needed, many small corrections, explanations need to be done. Importantly, the text also needs English editing!

Comments from PLOS Editorial Office: We note that one or more reviewers has recommended that you cite specific previously published works in an earlier round of revision. As always, we recommend that you please review and evaluate the requested works to determine whether they are relevant and should be cited. It is not a requirement to cite these works and you may remove them before the manuscript proceeds to publication. We appreciate your attention to this request.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions??>

Reviewer #3: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #3: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #3: No

**********

Reviewer #3: This study demonstrates that manipulating the expression of CLIC1 may affect the development of inflammation and oxidative stress in an in vitro model of cerebral ischemia-reperfusion injury. However there are a few major gaps in the conclusions of this study.

1) How do the authors reconcile the fact that manipulating the same molecule CLIC1 may lead to two distinct cell death processes – apoptosis and pyroptosis that can not occur at the same time. Is there a preferential pathway to one or the other, or a state of the cell or a time window?

2) What is the rationale for the CLIC1 multiple roles in inflammation and oxidative stress in ischemic damage. Using the term “cellular adaptor“ (Discussion- line 5) will not do.

3) It is never disclosed what is the basis of the hypothesis that CLIC1 would suppress Nrf2/HO-1. In fact, it is not clearly disclosed what is the initial downstream pathway for the many CLIC1 effects.Only in Fig 1 “ARE“ is indicated without further mentioning or even explaining the abbreviation.

4) How do the authors reconcile their proposal of therapy by supressing CLIC1 and apoptosis/pyroptosis with their stating that CLIC1 has a cellular defensive mechanism (p. 16, 2pgph line 2-3) or that it stabilizes cation fluctuations during stress conditions and cytoplasmic oxidation (p17 last line, p18 lines 1-2) as well as with the sentence “Apoptosis aids in clearing infected cells, whereas pyroptosis facilitates the removal of intracellular pathogens and the activation of immune responses.“

In addition:

The experiment in Fig. 4 using activated NLRP3 after silencing CLIC1 to determine if NLRP3 mediates pyroptosis in OGD/R seems forced and superfluous since in the same Figure it was shown that NLRP3 is activated by OGD/R itself followed by pyroptosis markers. It is also merely strange to state in the same Fig legend (line 4-5) that activation of NLRP3 upregulates itself!

Page 4, 2nd pgph, line 5 : “CLIC1 ...removing excessive negative charge via anion channel“ However CLIC1 IS an anion channel

Legend to Fig. 1 is missing

First pgph on page 14 should belong to the part of text with Figure 4 .

There are a lot of typos and English is below acceptance level (eg “A recent study discovered that in umbilical vein endothelial cells, CLIC1 high-expressed and impaired the ability of vascular cells to resist oxidative stress to speed up cellular senescence, whose inhibition conversely perform a protective effect on preventing cellular aging and disorder“)

The authors claim that all relevant data are within the ms but this is not the case – jus the means and errors can be found.

Why do the authors disclose ethical review of animal welfare when they used no animals in their experiments? Only commercially available animal cell line was used

**********

what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 Sep 18;20(9):e0332698. doi: 10.1371/journal.pone.0332698.r006

Author response to Decision Letter 3


22 Jul 2025

Dear Editor and Reviewer,

We sincerely appreciate the time and effort you have dedicated to reviewing our manuscript. We are grateful for the rigorous, professional, and constructive feedback provided throughout the review process.

Our manuscript has undergone two rounds of revision—a major revision (PONE-D-24-49743_R1) and a minor revision (PONE-D-24-49743_R2)—prior to this submission. However, we noticed that the latest reviewer’s comments appear to be based on the original version of the manuscript (PONE-S-24-63293) rather than the most recently revised version.We have uploaded pdf files of the 3 previous versions of the manuscript in the attachment “others”, so that you can review them on demand.

Given that the previous reviewers and editor have already provided valuable suggestions to enhance the language, literature citations, readability, logical flow, and scientific rigor of the paper, we have made further refinements based on the latest revised version (PONE-D-24-49743_R2) rather than reverting to the original submission.

To facilitate your review, we have:

• Included a point-by-point response to all comments in file of Respond to Reviewers.

• Highlighted all new revisions in yellow in the revised manuscript.

We deeply value your expertise and the thoughtful critique, which has significantly strengthened our work. Should you have any additional questions or concerns, please do not hesitate to contact us.

Thank you once again for your time and consideration.

Best regards,

Chuang Sun

Attachment

Submitted filename: Response to Reviewers_2025.7.docx

pone.0332698.s010.docx (8.6MB, docx)

Decision Letter 3

Mária Deli

5 Aug 2025

Dear Dr. Sun,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 19 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Mária A. Deli, M.D., Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

If the reviewer comments include a recommendation to cite specific previously published works, please review and evaluate these publications to determine whether they are relevant and should be cited. There is no requirement to cite these works unless the editor has indicated otherwise. 

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions??>

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #3: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #3: Yes

**********

Reviewer #3: Comments are addressed thoroughly and successfully. Nevertheless, it would be more appropriate in the revised ms to use examples from CNS and not from cancer (Discussion Pgph 6) or vascular and bronchial tissues (Introduction pgph 3).

In addition, text in Duscussion pgph 2 5th line from the end should be changed to read "...highlighting its role in the apoptotic process..."

**********

what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #3: Yes:  Pavle Andjus

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org

PLoS One. 2025 Sep 18;20(9):e0332698. doi: 10.1371/journal.pone.0332698.r008

Author response to Decision Letter 4


1 Sep 2025

Dear Editor and Reviewer,

We would like to express our sincere gratitude for your time, effort, and constructive feedback throughout the review process. Your insightful comments and valuable suggestions have been instrumental in helping us improve the quality and clarity of our manuscript.

To facilitate your review, we have:

• Provided a detailed, point-by-point response to all comments in this letter.

• Highlighted all relevant modifications to the main text in yellow.

We deeply appreciate your careful evaluation and support, which have contributed significantly to strengthening our work. Thank you again for your guidance and for the opportunity to revise and resubmit our article.

Please do not hesitate to contact us if you have any further questions or concerns.

Best regards,

Chuang Sun

Attachment

Submitted filename: Response to Reviewers_2025.9.1.docx

pone.0332698.s011.docx (486KB, docx)

Decision Letter 4

Mária Deli

3 Sep 2025

CLIC 1 down-regulates Nrf2/HO-1 signalling pathway promoting the apoptosis and pyroptosis in OGD/R-treated HT22 cells

PONE-D-24-49743R4

Dear Dr. Sun,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager®  and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support .

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mária A. Deli, M.D., Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

I thank the authors to do the final round of amendments. Since the last reviewer already accepted the paper, no need for further rounds of review, I consider the manuscript scientifically acceptable for publishing.

Reviewers' comments:

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 File. Original PCR data for CLIC1, Nrf2, HO-1, Bcl-2, Bax, Caspase 3, NLRP3, Caspase 1, IL-1β, IL-18, and GSDMD in the control, OGD/R, NC, CLIC1 silencing, OGD/R+NC, and OGD/R+CLIC1 silencing groups.

    (XLS)

    pone.0332698.s001.xls (75KB, xls)
    S2 File. Original PCR data for CLIC1, Nrf2, HO-1, Bcl-2, Bax, Caspase 3, NLRP3, Caspase 1, IL-1β, IL-18, and GSDMD in the control, OGD/R, OGD/R+N, OGD/R+CLIC1 silencing, OGD/R+CLIC1 silencing+Nrf2/HO-1 inhibition, and OGD/R+CLIC1 silencing+NLRP3 activation groups.

    (XLS)

    pone.0332698.s002.xls (78.5KB, xls)
    S3 File. Original Western blot data for CLIC1, Nrf2, HO-1, Bcl-2, Bax, Caspase 3, NLRP3, Caspase 1, IL-1β, IL-18, and GSDMD in each group.

    (XLSX)

    pone.0332698.s003.xlsx (42.3KB, xlsx)
    S4 File. Original ELISA data for IL-1β and IL-18, as well as original SOD, CAT, GPX, and LDH data in each group.

    (XLSX)

    pone.0332698.s004.xlsx (46.6KB, xlsx)
    S5 File. Original flow cytometry data (ROS and apoptosis) and CCK-8 data in each group.

    (XLSX)

    pone.0332698.s005.xlsx (14.6KB, xlsx)
    S6 File. Original Western blot figures of each group.

    (PDF)

    pone.0332698.s006.pdf (1.1MB, pdf)
    Attachment

    Submitted filename: Response to reviewers.docx

    pone.0332698.s008.docx (17MB, docx)
    Attachment

    Submitted filename: Response_to_Reviewers_auresp_2.docx

    pone.0332698.s009.docx (44.2KB, docx)
    Attachment

    Submitted filename: Response to Reviewers_2025.7.docx

    pone.0332698.s010.docx (8.6MB, docx)
    Attachment

    Submitted filename: Response to Reviewers_2025.9.1.docx

    pone.0332698.s011.docx (486KB, docx)

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLOS One are provided here courtesy of PLOS

    RESOURCES