Abstract
Background
Glioblastoma is the most malignant brain tumor with the poorest prognosis, but there have been no significant therapeutic advances in the past 20 years. Intratumoral administration of invariant natural killer T (iNKT) cells for glioblastoma has recently been reported and is promising immunotherapy. However, the low presence of iNKT cells in peripheral blood made it difficult to use iNKT cells as adoptive immunotherapy. Therefore, we used induced pluripotent stem cell-derived NKT (iPS-NKT) cells and analyzed their anti-tumor effect.
Methods
Induced pluripotent stem cell-derived NKT cells were generated by the previously reported protocol. The anti-tumor effect of iPS-NKT cells was confirmed against several glioblastoma cell lines. We also analyzed the expression of natural killer cell receptors of iPS-NKT cells and ligands of glioblastoma cell lines to know which interactions are dominant. In vivo, using an orthotopic glioblastoma mouse model, we compared the survival and tumor volume in mice iPS-NKT cells administered intratumorally with those in mice of no treatment group.
Results
We demonstrated that iPS-NKT cells have anti-tumor effects even in glioma cell lines with low CD1d expression and that CD155/DNAM-1 interactions are associated with these anti-tumor effects. In the orthotopic low CD1d-expressing glioblastoma mouse model, iPS-NKT-treated mice showed markedly prolonged survival and suppressed tumor volume.
Conclusion
We confirmed the anti-tumor effects of iPS-NKT cells on glioblastoma cells in vitro and in vivo. The anti-tumor activity was suggested to be mainly due to the interaction between CD155 and DNAM-1. Intratumoral administration of iPS-NKT cells has potential anti-tumor effects on glioblastoma in the clinic.
Keywords: cancer immunotherapy, CD155, glioblastoma, iPS cells, NK cell receptor, NKT cells
Significance statement.
We demonstrated the cytotoxic potential of induced pluripotent stem cell-derived NKT (iPS-NKT) cells against glioblastoma cells. While invariant NKT cells are known to exhibit anti-tumor effects in a TCR–CD1d manner, iPS-NKT cells had sufficient cytotoxicity in glioblastoma cells with mild or low CD1d expression via CD155/DNAM-1 interaction. We also demonstrated the anti-tumor effects of iPS-NKT cells against low CD1d-expressing glioblastoma cells in vivo. Adaptive iPS-NKT cell therapy could be a new immunotherapy against glioblastoma.
Introduction
Glioblastoma is the most common primary brain malignant tumor and has the poorest prognosis; despite aggressive multidisciplinary standard treatment including maximal surgical resection and chemoradiation followed by 6 cycles of chemotherapy, the median overall survival is approximately 15 months, and the 5-year survival rate is less than 10%.1,2 Furthermore, the prognosis for glioblastoma has not improved much.3,4 Although the addition of intracranial administration of recombinant herpesviruses or alternating electric field therapy to standard treatment has extended overall survival by up to approximately 20 months, there are still many problems and challenges with both treatment methods, such as the high physical burden on patients.3,4 Hence, effective treatments for glioblastoma are eagerly awaited.
Cancer immunotherapy, such as anti-programmed cell death-1 (PD-1) antibodies and chimeric antigen receptor (CAR)-transduced T cells, has been developed against several cancer types in the last 20 years.5–7 However, randomized phase III trials using anti-PD-1 antibodies for recurrent glioblastoma have not improved survival outcomes.8 CAR-transduced T cells have revealed clinical efficacy and safety in several ongoing phase I clinical trials conducted in patients with glioblastoma, and further results are desired.9,10 Thus, administration of immune cells has potential therapeutic possibilities for glioblastoma.
Invariant natural killer T (iNKT) cells are a group of innate T cells that, after activation of the T cell receptor (TCR), can rapidly produce a variety of cytokines and form immune responses in diverse environments.11 Invariant natural killer T cells recognize glycolipid ligands presented on CD1d molecules and react with the synthetic glycolipid α-galactosylceramide (α-GalCer).12 Hara et al. reported that iNKT cells exerted cytotoxicity against glioblastoma by interacting with CD1d and their TCRs.13 Nevertheless, iNKT cells are generally few in number and vary widely in abundance from person to person, making them difficult to secure in large quantities.14 To overcome this difficulty, induced pluripotent stem cell-derived NKT cells (iPS-NKT cells) were developed.15,16 iPS-NKT cells express the TCRs found in iNKT cells. In addition, they have more natural killer (NK) cell receptors than iNKT cells.15,17 iPS-NKT cells could also have CD1d-independent cytotoxicity. Therefore, iPS-NKT cells can show cytotoxicity for tumor cells regardless of CD1d expression. However, the cytotoxicity of iPS-NKT cells for glioblastoma is unknown.
In this study, we confirmed the cytotoxicity of iPS-NKT cells against glioblastoma cells regardless of CD1d expression. Furthermore, we revealed that the interaction between CD155 expressed on tumor cells and DNAM-1 expressed on iPS-NKT cells was associated with their cytotoxicity.
Methods
Cell lines
Glioblastoma cell lines (U251 and T98G) and a leukemia cell line (Jurkat) were obtained from the American Type Culture Collection (Manassas, VA, USA). We introduced luciferase to U251 (U251+L).
Generation of iNKT cells
We generated iNKT cells based on a previous report.18 Briefly, venous blood was obtained from healthy adult volunteer donors with informed consent, and peripheral blood mononuclear cells (PBMCs) were separated by density gradient centrifugation using Ficoll-Paque (GE Healthcare, Chicago, Illinois, USA). Peripheral blood mononuclear cells were cultured in complete RPMI 1640 medium for 9–14 days in the presence of 100 U/mL recombinant human IL-2 (Shionogi, Osaka, Osaka, Japan) and 200 ng/mL α-GalCer. Then, iNKT cells were isolated with MACS MultiStand, MS Columns, and LS Columns (Miltenyi Biotec, Bergisch Gladbach, North Rhine-Westphalia, Germany) using fluorescein isothiocyanate (FITC)-labeled anti-Vα24 antibody and anti-FITC microbeads (Miltenyi Biotec). The purified iNKT cells were cultured in complete medium containing IL-2 until their use in experiments (within 3 days after isolation). The Institutional Review Board of Chiba University approved all studies.
Isolation of natural killer cells
Primary human natural killer (NK) cells were isolated from PBMCs according to the manufacturer’s instructions using the human NK cell isolation kit (Miltenyi Biotec) and MACS MultiStand, MS Columns, and LS Columns (Miltenyi Biotec) for negative selection of human NK cells and were used on the same day.
Generation of induced pluripotent stem cell-derived NKT cells differentiated from NKT-iPSCs
We used previously developed NKT-iPSCs.17 Induced pluripotent stem cell-derived NKT cells were generated from NKT-iPSCs using the OP9/OP9DLL1 stromal cell co-culture system, as previously described with slight modification.17 In brief, confluent NKT-iPSC colonies were mechanically removed from dishes and then plated on mitomycin C (Sigma–Aldrich, Burlington, Massachusetts, USA)-treated OP9 overconfluent 10-cm dishes filled with 10 mL OP9 medium; that is, α-MEM (Thermo Fisher Technologies, Waltham, Massachusetts, USA) with 20% fetal bovine serum and penicillin–streptomycin solution (Wako, Osaka, Osaka, Japan). On day 13, colonies were treated for 20 minutes with 5 mL Accumax (Innovative Cell Technologies, San Diego, California, USA) at 37 °C. To remove stromal cells and aggregated cells, cells were passed through an EASYstrainer (100 μm; Gleiner Bio-One, Kremsmünster, Austria). Cells were plated on mitomycin C-treated OP9/DLL1 semi-confluent dishes in OP9 medium containing 5 ng/mL hIL-7, 5 ng/mL hFlt-3L (PeproTech, Cranbury, New Jersey, USA), and 10 ng/mL hSCF (PeproTech). On days 16 and 23, semi-adherent cells were collected and passaged into a new dish layered with mitomycin C-treated OP9/DLL1 cells. On day 30, cells were collected and cultured with 5 ng/mL hIL-7 and 10 ng/mL hIL-15 for 9–14 days. All studies were approved by the Institutional Review Board of Chiba University.
Antibodies and flow cytometry
We used allophycocyanin (APC)-labeled anti-CD1d antibody and IgG2b isotype to detect CD1d expression on the tumor cells. Fluorescein isothiocyanate-labeled anti-Vα24, phycoerythrin (PE)-labeled anti-Vβ11, pacific blue (PB)-labeled anti-CD3, APC-labeled anti-CD45, PE-Cy7-labeled anti-CD56, PE-labeled anti-CD127, and phycoerythrin-Cyanine 7 (PE-Cy7)-labeled anti-CD45RA were used to identify phenotypes of iNKT cells and iPS-NKT cells. The other antibodies used in this study to identify ligands on tumor cells and NK cell receptors are listed in Table S1. Zombie aqua solution (Sigma–Aldrich) and 7-Amino-Actinomycin D (7-AAD; BD Biosciences, Franklin Lakes, New Jersey, USA) were used to identify dead cells. Flow cytometric data were acquired with a FACSVerse or LSRFortessa-X20 instrument (BD Biosciences) running BD FACSuite or FACSDiva, respectively, and analyzed using FlowJo software (FlowJo LLC, Ashland, Oregon, USA).
In vitro cytotoxicity assay
Target cells were labeled with CellTrace Violet (CTV; Invitrogen, Waltham, Massachusetts, USA) for identification according to the manufacturer’s protocol. CellTrace Violet-labeled target cells (4 × 104) and purified iNKT cells or iPS-NKT cells were co-incubated for 4 hours at 37 °C in complete medium at the indicated effector-to-target (E: T) cell ratio. After the incubation, APC-labeled Annexin V (BioLegend, San Diego, CA, USA) and 7-AAD in Annexin V Binding Buffer (BioLegend) were added to identify apoptotic cells according to the manufacturer’s protocol. Annexin V−/7-AAD− cells were counted as living cells. Cytotoxicity (%) was calculated as 100 × (1 – (living cells without effector cells – living cells with effector cells)/living cells without effector cells).
Cytokine measurement
3.2 × 105 purified iNKT cells or iPS-NKT cells were incubated for 24 hours at 37 °C in 200 µL complete medium with 4 × 104 target cells. After incubation, the supernatant was collected, and interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) were measured by cytometric bead array according to the manufacturer’s protocol. Data were acquired on a FACSVerse and analyzed using FCAP Array software (BD Biosciences).
Adjuvant effect of iPS-NKT cells
To evaluate the adjuvant effect of iPS-NKT cells, we analyzed CD69 expression on NK cells. CTV-labeled NK cells (1 × 105) and tumor cells (1 × 105) and/or iPS-NKT cells (1 × 105) were co-incubated for 48 hours at 37 °C in complete medium. After the incubation, PE-Cy7-labeled anti-CD56, FITC-labeled anti-CD3, and PE-labeled anti-CD69 were added to identify activated NK cells. Living 7-AAD– cells were gated in CD3–/CD56+ to identify NK cells, and CD69 expression of the NK cells was compared between groups. Furthermore, we analyzed the intracellular IFN-γ of NK cells. CellTrace Violet-labeled NK cells (1 × 105) and tumor cells (1 × 104) and/or iPS-NKT cells (1 × 105) were co-incubated for 18 hours at 37 °C in complete medium. After the incubation, Zombie Violet (BioLegend) was added to detect dead cells. We evaluated intracellular IFN-γ of NK cells using APC-labeled anti-IFN-γ antibody and BD Cytofix/Cytoperm Plus Fixation/Permeabilization Kit (BD Biosciences).
Blocking assay
To block CD155, ICAM-1, MICA/B, SLAMF-2, CD112, and CD1d expressed on tumor cells, the tumor cells were pre-incubated for 30 minutes with 10 µg/mL blocking antibodies at 37 °C. In addition, Fc receptors on iPS-NKT cells were blocked. The antibodies used for blocking are listed in Table S1. After this procedure, we conducted the in vitro cytotoxicity assay and cytokine measurement experiment described previously.
Generating CD155 (PVR)-knockout U251+L cells
Knockout of CD155 (PVR) in U251+L was performed using the CRISPR/Cas9 system. Two guide RNAs (CACGGAGTCGCCCAAGAAGC and CTACCTACAGGTGCCCAACA) were used. U251+L cells were transfected with Cas9 nuclease and gRNA using the Neon Electroporation system (Invitrogen) (Voltage = 1200 V, Pulse width = 30 ms, number of pulses = 1). We generated single-cell clones by limiting dilution and confirmed the knockout of CD155 by flow cytometry.
Evaluation of DNAM-1-induced downstream phosphorylation
To analyze downstream signals from DNAM-1, we evaluated SLP-76 phosphorylation at Y128 in iPS-NKT cells.19 CTV-labeled iPS-NKT cells (1 × 105) were incubated with CD155-knockout (KO) U251+L cells (1 × 105) or U251+L cells (1 × 105) for 15 minutes. After this incubation, we evaluated SLP-76 phosphorylation at Y128 by flow cytometry using Alexa Fluor 647-labeled anti-SLP-76 antibody and BD Cytofix Buffer and BD Phosflow Perm Buffer III (BD Biosciences).
RNA-sequencing
We incubated CTV-labeled iPS-NKT cells (1 × 106) with CD155-KO U251+L cells (1 × 106) or U251+L cells (1 × 106) for 4 hours. Using the FACSAria (BD Biosciences), we collected 1 × 105 iPS-NKT cells that were gated as CTV+/7-AAD– cells and extracted total RNA using the RNeasy Micro Kit (Qiagen, Hilden, Germany). Sequencing libraries were generated according to the NEBNext Single Cell/Low Input RNA library prep kit for Illumina (New England BioLabs, Ipswich, MA, USA). RNA libraries were sequenced using a NextSeq 500 sequencer (Illumina, San Diego, CA, USA) with the NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Illumina). The primary data were analyzed by bcl2fastq ver2.20 (Illumina) to make fastq files. The sequencing libraries were mapped against the transcriptome using STAR (2.7.9a). Read count data were analyzed using Integrated Differential Expression and Pathway Analysis (iDep) (https://bioinformatics.sdstate.edu/idep/).
Mice
Recipient hIL-7/hIL-15 knock-in (KI) NSG mice (NOD.Cg-PrkdcscidIL2rgtm1Wjl/SzJ) were used for maintaining human iPS-NKT cells in mice. The mice were provided by the Laboratory for Developmental Genetics, RIKEN Center for Integrative Medical Sciences.20 They were maintained under specific pathogen-free conditions and studied in compliance with institutional guidelines for the care and use of laboratory animals. The Chiba University Institutional Animal Care and Use Committee approved all animal procedures.
In vivo cytotoxicity assay
Female 8–10-week-old mice were anesthetized with isoflurane (Viatris, Canonsburg, Pennsylvania, USA) and immobilized in an SR-6M1-HT stereotactic apparatus (NARISHIGE, Tokyo, Japan) fitted for mice. U251+L cells or CD155-KO U251+L cells (5 × 104) were stereotactically injected into the mice in a volume of 2 µL using a Hamilton syringe (Hamilton, Reno, Nevada, USA) at the following coordinates: 1 mm anterior from bregma, 2 mm lateral, and 3 mm deep on day 0. After tumor implantation, 1 × 106 human iPS-NKT cells or iNKT cells in a volume of 3 µL were injected into the site where the tumor cells were implanted on day 1, 4, 7, 10, and 13. In the control group, the same volume of phosphate-buffered saline (PBS) was injected at the same site. To obtain sufficient numbers of iNKT cells for this assay, we used iNKT cells that were repeatedly expanded using α-GalCer-pulsed murine dendritic cells.15 Tumor volume and survival were monitored every week. Tumor volume was quantified by luciferase bioluminescence imaging using an IVIS (in vivo imaging system) Lumina II (PerkinElmer, Shelton, Connecticut, USA). They were euthanized when they showed predetermined signs of neurological deficits (weight loss >20% body mass and lethargy).
Isolation of iPS-NKT cells from mice
Resected mouse brains in the indicated schedule were mechanically cut and digested in RPMI 1640 medium with an enzyme mixture from a Tumor Dissociation Kit, human (Miltenyi Biotec) using a gentleMACS Dissociator (Miltenyi Biotec). The resultant cell suspension was washed in RPMI 1640 medium. The numbers of iPS-NKT cells were counted by gating lymphocytes, PE-Cy7-labeled anti-mCD45–/APC-labeled anti-(human) CD45+, zombie aqua–, and PB-labeled anti-CD3+/FITC-labeled anti-Vα24+. The rates of living iPS-NKT cells were calculated by the number of iPS-NKT cells divided by total brain cells.
Statistical analysis
We used an unpaired 2-sided Student’s t-test to compare data from different experimental conditions. The Kaplan–Meier method was applied to describe the distribution of survival curves, and the log-rank test was used to compare the curves. Statistical analyses were conducted with JMP software (version 16.1.0, SAS Institute, Cary, North Carolina, USA), GraphPad PRISM9 software (GraphPad Software, Boston, Massachusetts, USA), or Microsoft Excel (Microsoft, Redmond, Washington, USA).
Results
Cytotoxicity of induced pluripotent stem cell-derived NKT cells and iNKT cells
Induced pluripotent stem cell-derived NKT cells expressed Vα24Vβ11 TCR, the same as iNKT cells; conversely, they also expressed an NK cell marker, CD56, at higher levels than iNKT cells (Figure 1A). We generated approximately 2 × 108 iPS-NKT cells from 2 × 103 iPS cells in a culture series per dish (Figure S1A, see online supplementary material for a color version of this figure). Final products represent an effector phenotype (Figure S1B, see online supplementary material for a color version of this figure). Because their anti-tumor activity through NK cell receptors may be different, we compared the cytotoxicity between iPS-NKT and iNKT cells using 3 tumor cell lines. Jurkat strongly expressed CD1d, while T98G exhibited mild expression and U251+L had low expression (Figure 1B). Induced pluripotent stem cell-derived NKT cells and iNKT cells had higher cytotoxicity to CD1d-high Jurkat cells in the presence of α-GalCer (Figure 1C). Similarly, iNKT cells showed higher cytotoxicity to T98G and U251+L with low CD1d expression in the presence of α-GalCer (Figure 1D, E). However, α-GalCer did not increase the cytotoxicity of iPS-NKT cells to T98G and U251+L. Instead, iPS-NKT cells showed more potent cytotoxicity toward Jurkat, T98G, and U251+L cells than iNKT cells, regardless of CD1d expression levels in the absence of α-GalCer (Figure 1C-E). Therefore, we expected the other interaction between iPS-NKT cells and the tumor cells, except for the interaction between the TCR of Vα24/Vβ11 and CD1d.
Figure 1.
Comparison of cytotoxicity and cytokine secretion between iPS-NKT cells and iNKT cells. (A) Representative flow cytometry plots of iPS-NKT and iNKT cells used in this study. (B) CD1d expression of each tumor cell line used in cytotoxic assays. The Blue areas represent isotype staining. (C–E) Cytotoxicity of iPS-NKT cells and iNKT cells against tumor cell lines with or without α-GalCer. Expanded iPS-NKT or iNKT cells were co-cultured with CTV-labeled tumor cell lines for 4 hours at the indicated E:T ratio. Bars and error bars indicate the mean and SD of biological duplicates, respectively. The data are representative of the results from two independent experiments. We collected PBMCs from two healthy donors. Two-tailed unpaired t-test, ns, not significant, *P < .05, **P < .01, ***P < .001. iNKT cell; invariant natural killer T cell; iPS-NKT cell, iPS cell-derived iNKT cell; α-Gal, α-Galactosylceramide, PBMC; peripheral blood mononuclear cell.
Ligands expressed on U251+L and T98G and NK cell receptors expressed on iPS-NKT
Since NK cell receptors are known to induce cytotoxicity of iNKT cells, we focused on NK cell receptors expressed on the surface of iPS-NKT cells that could cause cytotoxicity in a non-CD1d–TCR manner.21 To identify receptors contributing to anti-tumor effects on iPS-NKT and iNKT cells, and ligands expressed on U251+L and T98G cells bound to the receptors, we analyzed 7 NK cell receptors and 7 ligands on tumor cells (Figure 2A, B). Among the NK cell receptors of iPS-NKT cells, DNAM-1,22 CD11a, and NCR3 expression was high, NKG2D, CD244, and CD2 expression was moderate, and NCR2 expression was low. Among the NK cell receptors of iNKT cells, DNAM-1 and CD2 expression was high, CD11a expression was moderate, while NKG2D, CD244, NCR3, and NCR2 expression was low. Among the ligands of the glioblastoma tumors, CD155 and ICAM-1 expression was high, and the expression of the other ligands was low. Additionally, CD155 and ICAM-1, which bind to DNAM-1 and CD11a, respectively, were expressed on T98G and U251+L.23-25 Therefore, we expected CD155 and ICAM-1 to be related to the cytotoxicity of iPS-NKT cells against glioblastoma cells. To confirm the contribution of CD155/DNAM-1 or ICAM-1/CD11a to the cytotoxicity of iPS-NKT cells against U251+L and T98G, we performed a blocking assay using blocking antibodies for CD155, ICAM-1, MICA/B, SLAMF-2, CD112, and CD1d. (Figure 2C). Because no commercial blocking antibodies were available for NCR3L and NCR2L, these ligands could not be inhibited. The anti-CD155 blocking antibody significantly decreased the cytotoxicity. Additionally, we confirmed cytokine secretion of iPS-NKT cells with U251+L and T98G in the presence or absence of the anti-CD155 blocking antibody and the blocking antibodies (Figure 2D). Induced pluripotent stem cell-derived NKT cells exhibited significantly decreased secretion of both IFN-γ and TNF-α in the presence of anti-CD155 blocking antibody, but this was not significant in the presence of the other blocking antibodies.
Figure 2.
Expression of NK cell receptors on iPS-NKT cells that contributed to cytotoxicity against glioblastoma and ligands binding these receptors on U251+L and T98G, and changes in cytotoxicity and cytokine secretion with blocking of these ligands. (A) Expression of NK cell receptors analyzed by flow cytometry. DNAM-1, CD11a, NKG2D, CD244, CD2, NCR3, and NCR2 after gating iNKT cells by Vα24 and CD3. Blue areas represent isotype staining. Results are representative flow cytometry plots of at least two independent experiments. (B) Expression of ligands on the two tumor cells analyzed by flow cytometry. CD155, ICAM-1, MICA/B, SLAMF-2, CD112, NCR3L1, and NCR2L were analyzed. The Blue areas represent isotype staining. Results are representative flow cytometry plots of at least two independent experiments. (C) Cytotoxicity of iPS-NKT cells against U251+L or T98G cells after co-culture for 4 hours in the presence of indicated blocking antibody or each isotype at the ratios of 1:1. Bars and error bars indicate the mean and SD of biological triplicate, respectively. The data are representative of the results from two independent experiments. Two-tailed unpaired t-test; *P < .05, **P < .01. (D) Cytokine secretion patterns of iPS-NKT cells analyzed upon co-culture of U251+L or T98G cells for 24 hours in the presence of the indicated blocking antibody or each isotype at the ratios of 8:1. After co-culture, the supernatants were obtained, and cytokine secretion levels were analyzed by cytometric bead array according to the manufacturer’s protocol. Bars and error bars indicate the mean and SD of biological triplicate, respectively. The data are representative of the results from two independent experiments. Two-tailed unpaired t-test; *P < .05, ***P < .001. iPS-NKT cell, iPS cell-derived iNKT cell; iNKT cell, invariant natural killer T cell.
Contribution of CD155 to the cytotoxic function of iPS-NKT cells
Because we expected CD155 to be the significant ligand involved in the cytotoxicity between iPS-NKT cells and the glioblastoma cells, we generated CD155-KO U251+L using CRISPR/Cas9 (Figure 3A). The cytotoxicity of iPS-NKT cells decreased to that of CD155-KO U251+L (Figure 3B). SLP-76 phosphorylation at Y128, which results from DNAM-1 signaling,19 was decreased in iPS-NKT cells when co-cultured with CD155-KO U251+L compared with wild-type U251+L (Figure 3C, D). Additionally, RNA-seq of iPS-NKT cells in the presence of the indicated tumors showed different gene expression patterns (Figure 3E). Upregulated differentially expressed genes (DEGs) in iPS-NKT cells co-cultured with wild-type U251+L are listed in Table S2, and the pathway analysis results of the DEGs resulted in Table S3. Induced pluripotent stem cell-derived NKT cells co-cultured with wild-type U251+L were more activated than those co-cultured with CD155-KO U251+L (Figure 3F). Consequently, the expression of genes related to cytotoxic molecules and chemokines was significantly higher in the presence of CD155 on U251+L (Figure 3F). These results showed that CD155/DNAM-1 interactions were associated with iPS-NKT cell cytotoxicity to U251+L.
Figure 3.
Activity changes of iPS-NKT cells toward CD155-knock-out U251+L. (A) CD155 expression on CD155-KO U251+L. We knocked out CD155 (PVR) on U251+L using the CRISPR/Cas9 system. The blue area is the isotype control, the red area indicates U251+L, and the orange area, which overlaps the blue area, indicates CD155-KO U251+L. This result is representative of flow cytometry plots of at least two independent experiments. (B) Cytotoxicity assay of iPS-NKT cells toward U251+L compared with CD155-KO U251+L. Bars and error bars indicated the mean and SD of biological duplicates, respectively. The data are representative of the results from two independent experiments. (C) SLP-76 phosphorylation at Y128 (pSLP-76) in iPS-NKT cells. Histogram showing pSLP-76 in iPS-NKT cells. The blue area is the isotype control, the red area indicates co-culture with U251+L, and the orange area indicates co-culture with CD155-KO U251+L. (D) Comparison of pSLP-76 in iPS-NKT cells. The red is pSLP-76 in iPS-NKT cells interacting with U251+L and the orange is that in iPS-NKT cells interacting with CD155-KO U251+L. Bars and error bars indicate the mean and SD of biological triplicates, respectively. The data are representative of the results from two independent experiments. Two-tailed unpaired t-test; *P < .05. (E) Principal component analysis of the RNA sequences. We simulated RNA-seq data for the three indicated treatment groups with three biological replicates each. (F) Heatmap of genes with strong and recurrent enrichment patterns in the three groups of Figure 3E. T-tests were performed for the TPM of the two indicated groups. iPS-NKT cells, iPS cell-derived iNKT cells; CD155-KO U251+L, CD155-knock-out U251+L; TPM, transcripts per million.
Anti-tumor effects of intratumoral injection of iPS-NKT cells in an orthotopic glioblastoma mouse model
To determine whether intratumoral injection of iPS-NKT cells had an anti-tumor effect on glioblastoma cell lines expressing the CD155 ligands in vivo, we established an orthotopic hIL-7/hIL-15 KI NSG mouse model. U251+L cells were injected into the brains of hIL-7/hIL-15 KI NSG mice on day 0. Then, PBS or 1 × 106 iPS-NKT cells were injected intratumorally on day 1, 4, 7, 10, and 13 (Figure 4A). Weekly analysis of tumor growth and survival showed that the iPS-NKT cell therapy reduced tumor volume and significantly prolonged survival compared with the control group (Figure 4B-D). However, iPS-NKT cell therapy did not show significant in vivo cytotoxicity to CD155-KO U251+L (Figure 4E, F). Therefore, we concluded that CD155/DNAM-1 interactions were associated with the cytotoxicity of iPS-NKT cells against U251+L. iNKT cells did not show in vivo cytotoxicity in the absence of α-GalCer (Figure S2A-D, see online supplementary material for a color version of this figure).
Figure 4.
In vivo anti-tumor effects of human iPS-NKT cells in intracranial U251+L or CD155-KO U251+L NSG mouse models. (A) Experimental schedule. We inoculated 5 × 104 U251+L cells on day 0. We conducted intratumoral injections of PBS (PBS) or 1 × 106 iPS-NKT cells (iPS-NKT) at the same volume on day 1, 4, 7, 10, and 13. (B) Results of in vivo imaging system (IVIS) monitoring tumor growth. Images representative of three experiments are shown. The color bar ranged from 5 × 105 to 1 × 107 p/sec/cm2/sr. (C) Summary of total flux between the PBS group and the iPS-NKT cell group. They were significantly different on weeks 2 and 3. The values of total flux were put in log notation with a base of 10, and the test was performed. The box-whisker plot indicated the mean, and 10th or 90th percentile, respectively. Two-tailed unpaired t-test; *P < .05. (D) Kaplan–Meier survival curve of intracranial glioblastoma-bearing mice. Mice were treated with PBS (PBS group) or iPS-NKT cells (iPS-NKT group). Their survival intervals were significantly different. The result is representative of the results from three independent experiments. (E) Experimental schedule. We inoculated 5 × 104 CD155-KO U251+L cells on day 0. We conducted intratumoral injections of PBS (PBS) or 1 × 106 iPS-NKT cells (iPS-NKT) at the same volume on days 1, 4, 7, 10, and 13. (F) Kaplan–Meier survival curve of intracranial glioblastoma-bearing mice. Mice were treated with PBS (PBS group) or iPS-NKT cells (iPS-NKT group). Their survival intervals were not significantly different. iPS-NKT cell, iPS cell-derived iNKT cell; CD155-KO U251+L, CD155-knock-out U251+L; PBS, phosphate-buffered saline. Figure 4A, E was created with BioRender.
Kinetics and safety of intratumorally injected iPS-NKT cells in hIL-7/hIL-15 KI NSG mice
To determine the kinetics of intratumorally injected iPS-NKT cells, we analyzed the percentage and number of iPS-NKT cells injected intratumorally in the brains of hIL-7/hIL-15 KI NSG mice (Figure 5A). Induced pluripotent stem cell-derived NKT cells remained in the brain until at least day 38. The percentage and number of iPS-NKT cells in the brain decreased as the days passed (Figure 5B). To assess the safety of intracranial injection of iPS-NKT cells, we evaluated the clinical symptoms and weight changes of the mice (Figure 5C). Mouse growth was not affected (Figure 5D). Moreover, no mice exhibited abnormal behavior, tactile hyperesthesia, or paralysis (Figure 5E). Additionally, we evaluated the clinical symptoms and weight changes in orthotopic glioblastoma-bearing mice following five injections of iPS-NKT cells (Figure 5F). No growth inhibition was detected over the indicated term (Figure 5G).
Figure 5.
Kinetics and safety of intracranial administration of iPS-NKT cells. (A) Experimental schedule of kinetic analysis of iPS-NKT cells injected into mouse brains with glioblastoma cells. We inoculated 5 × 104 U251+L cells on day 0. We conducted intratumoral injections of PBS (PBS group) or 1 × 106 iPS-NKT cells (iPS-NKT cell group) at the same volume on day 1, 4, 7, 10, and 13. After these procedures, the mice were killed to harvest tumor-infiltrating iPS-NKT cells on days 16, 21, and 38. (B) Counts and rates of tumor-infiltrating iPS-NKT cells in mouse brains on days 16, 21, and 38 are shown. The cell counts were calculated as (total brain cells) × (FSC, SSC gating)/100 × (h-CD45+, m-CD45−)/100 × (Zombie aqua−)/100 × (CD3+, Vα24)/100. The rates were calculated as (FSC, SSC gating)/100 × (h-CD45+, m-CD45−)/100 × (Zombie aqua−)/100 × (CD3+, Vα24)/100. (C) Scheme of iPS-NKT cell safety test: iPS-NKT cells were injected into mouse brains at two-time shots (n = 5). In this two-time shot model, iPS-NKT cells were administered into the brains on day 0 and 3. (D) Weight changes of the mice in safety tests. We monitored body weights twice a week. (E) Evaluation of neurological defects. Abnormal behavior, tactile hyperesthesia, and paralysis in each mouse were monitored twice weekly and scored as 0 (no defect) or 1 (defect present). Individual scores therefore ranged from 0 to maximum of 3. Mice were identified by consecutive labels (m1 to m5). (F) Experimental schedule. We inoculated 5 × 104 U251+L cells on day 0. We conducted intratumoral injections of 1 × 106 iPS-NKT cells (iPS-NKT) on days 1, 4, 7, 10, and 13. (G) Weight changes of the mice in safety tests. We monitored body weights twice a week. iPS-NKT cell, iPS cell-derived iNKT cell; PBS, phosphate-buffered saline. Figure 5A, C, F was created with BioRender.
Discussion
We demonstrated that iPS-NKT cells can destroy glioblastoma cells in vitro (Figure 1D, E). Furthermore, we found that CD155/DNAM-1 interactions were associated with the anti-tumor effect of iPS-NKT cells; blocking CD155 ligands reduced the cytotoxicity of iPS-NKT cells to glioblastoma cells and significantly decreased cytokine secretion levels (Figure 2C, D).
The anti-tumor effects of iNKT cells against glioblastoma cells were reported by Hara et al.13 The effects of iNKT cells depended on the interaction between CD1d on tumors and TCR on iNKT cells. Our results reproduced the anti-tumor effects of iNKT cells toward CD1d-expressing tumor cells depending on α-GalCer (Figure 1C-E). Furthermore, we found that iPS-NKT cells had high cytotoxicity to the tumor cells in the presence and absence of α-GalCer (Figure 1C-E). The cytotoxicity without CD1d and α-GalCer indicated that iPS-NKT cells had interactions with proteins other than the invariant TCR and CD1d. On the basis of the expression of NK cell receptors and ligands on tumor cells, CD155/DNAM-1 and ICAM-1/CD11a interactions were suspected. The blocking assay results suggested that CD155 was the most involved. Invariant natural killer T cells also expressed DNAM-1, and blocking CD155 decreased cytotoxicity significantly, although the cytotoxicity was weak compared with iPS-NKT cells (Figure 2A and Figure S3A, see online supplementary material for a color version of this figure). Similar findings have been previously reported on the anti-tumor effects of γδ T cells in glioblastoma cells.26 In this report, there was a correlation between CD155 expression and the anti-tumor effect of γδ T cells in glioblastoma cells from 10 patients. Therefore, our iPS-NKT cells could be effective against glioblastoma cells in patients via the same mechanism.
CD155, also called poliovirus receptor, is a member of the nectin-like protein family and was initially known to be related to cellular adhesion.27 CD155 exerts immunomodulatory functions by binding to both DNAM-1 (activation) and TIGIT (suppression); binding to TIGIT on T cells allows tumor cells to escape immunity.28–30 CD155 is overexpressed on glioblastoma cells.31–33 Therefore, CD155 is a promising target for immunotherapy using iPS-NKT cells because iPS-NKT cells did not express TIGIT (Figure S4, see online supplementary material for a color version of this figure). Beyond the upregulation of cytotoxic molecules and chemokines, our RNA-seq analysis revealed that iPS-NKT cells co-cultured with wild-type U251+L cells exhibit broader immunomodulatory changes (Tables S2 and S3). Pathway analysis indicated activation of pro-inflammatory signaling (eg, TNF-α/NF-κB and IL2/STAT5). These findings suggest that iPS-NKT cells not only exert direct cytotoxic effects but also contribute to shaping the immune and tumor microenvironment through multiple functional pathways. In the clinical setting, patients with tumors that express high levels of TIGIT and PD-L1 have poorer survival.34 Furthermore, TIGIT inhibitors potentiated the anti-tumor effects of PD-1 inhibitors in a glioblastoma mouse model.34 These findings support that CD155 can be a target for cancer immunotherapy for glioblastoma.
Natural killer cells are also DNAM-1-expressing cytotoxic cells22; however, iPS-NKT cells exhibited significantly greater cytotoxicity than NK cells (Figure S5A, see online supplementary material for a color version of this figure). Although we do not know the precise mechanism of this, one possibility is that iPS-NKT cells do not express inhibitory NK cell receptors, including TIGIT (Figures S4 and S5B, see online supplementary material for a color version of this figure). Because glioblastoma tumor cells highly expressed classical class I HLA and HLA-E (Figure S5C, see online supplementary material for a color version of this figure), the cytotoxicity of NK cells may be inhibited. Besides, iPS-NKT cells had an adjuvant effect, which activated bystander NK cells (Figure S5D, E, see online supplementary material for a color version of this figure).15 Therefore, iPS-NKT cell therapy could show more potent anti-tumor effects than that in vivo in the presence of NK cells.
We confirmed the cytotoxicity of iPS-NKT cells in an in vivo assay. Overall survival was significantly longer in the iPS-NKT group than in the control group (Figure 4A, D). The results of IVIS demonstrated that the difference in tumor volume was significant on day 14 and 21 (Figure 4B, C). After day 21, some mice with high luminescence started to die. Two out of six mice survived until day 129 (Figure 4D). We supposed that tumor cells were eliminated because no luminescence was detected (data not shown).
Finally, we evaluated the safety of administrating iPS-NKT cells intracranially. There was no apparent decline in the body weight of the mice and no obvious neurological defects. Our results demonstrated the safety of intratumoral injection of iNKT cells (Figure 5C-G), as previously reported.13,35
This study has several limitations. We could not use patient-derived glioblastoma cells. However, Choi et al reported that in 9 of 10 patients, patient-derived glioblastoma cells expressed CD155 at the highest level among the 4 ligands expressed on tumor cells.26 Therefore, CD155 is still a promising target for effective immunotherapy using iPS-NKT cells. Additionally, toward T98G cells, other interactions except for CD155 or CD1d possibly exist because iNKT cells hardly had cytotoxicity in the absence of α-GalCer, while iPS-NKT cells did. Further research is needed to elucidate this.
Conclusion
We demonstrated the cytotoxicity of iPS-NKT cells against glioblastoma cells in vitro and in vivo. Additionally, we found that the interaction between CD155 and DNAM-1 was associated with this cytotoxicity. Therefore, CD155 may be a promising target for immunotherapy with iPS-NKT cells, and iPS-NKT cell therapy can be a therapeutic option for glioblastoma cells in the clinic.
Supplementary Material
Acknowledgments
We thank H. Nikki March, PhD, from Edanz (https://jp.edanz.com/ac) for editing a draft of this manuscript. Some figures were created using BioRender (https://www.biorender.com/) with written permission from the copyright owners to reproduce the material.
Contributor Information
Ko Ozaki, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; Department of Neurological Surgery, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Takahiro Aoki, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; Laboratory for Developmental Genetics, RIKEN Center for Integrative Medical Sciences, Yokohama 230-0045, Japan.
Masayoshi Kobayashi, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; Department of Neurological Surgery, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Mariko Takami, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Midori Kobayashi, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Toshihiro Ito, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Keita Ogawa, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; Department of Gastroenterology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Hidekazu Tanaka, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Kai Nishii, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Katsuhiro Nishimura, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Kiwamu Motoyoshi, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; Department of Neurological Surgery, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Iori Kojima, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; Department of Neurological Surgery, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Daisuke Katsumi, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Daiki Shimizu, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Hongxuan Wang, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Motoko Yagi Kimura, Department of Experimental Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Kiyoshi Hirahara, Department of Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Haruhiko Koseki, Laboratory for Developmental Genetics, RIKEN Center for Integrative Medical Sciences, Yokohama 230-0045, Japan.
Yoshinori Higuchi, Department of Neurological Surgery, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Shinichiro Motohashi, Department of Medical Immunology, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan.
Author contributions
Ko Ozaki: conception and design, collection and assembly of data, data analysis and interpretation, and manuscript writing. Takahiro Aoki: conception and design, administrative support, data analysis and interpretation, and manuscript writing. Masayoshi Kobayashi: conception and design, collection and assembly of data. Mariko Takami: collection and assembly of data. Midori Kobayashi: collection and assembly of data. Toshihiro Ito: collection and assembly of data. Keita Ogawa: collection and assembly of data. Hidekazu Tanaka: collection and assembly of data. Kai Nishii: collection and assembly of data and provision of study material. Katsuhiro Nishimura: collection and assembly of data. Kiwamu Motoyoshi: collection and assembly of data. Iori Kojima: conception and design, collection and assembly of data. Daisuke Katsumi: collection and assembly of data. Daiki Shimizu: collection and assembly of data. Hongxuan Wang: collection and assembly of data. Motoko Yagi Kimura: collection and assembly of data and data interpretation. Kiyoshi Hirahara: data analysis and interpretation. Haruhiko Koseki: provision of study material. Yoshinori Higuchi: conception and design. Shinichiro Motohashi: conception and design, financial support, administrative support, data analysis and interpretation, manuscript writing, and final approval of manuscript.
Supplementary material
Supplementary material is available at Stem Cells Translational Medicine online.
Funding
This work was supported by the Research Center Network for Realization of Regenerative Medicine from the Japan Agency for Medical Research and Development (AMED). This work was also supported by Japan Society for the Promotion of Science (JSPS) KAKENHI, grant numbers 20K17917, 22H03182, and 24K19541. Haruhiko Koseki is receiving a research funding support from BrightPath Biotherapeutics Co. Ltd.
Conflicts of interest
Haruhiko Koseki is receiving a research funding support from BrightPath Biotherapeutics Co. Ltd.
Submission statement
This manuscript is original and has not been submitted elsewhere in whole or in part.
Data availability
The data supporting this study’s findings are available from the corresponding author upon reasonable request.
References
- 1. Ostrom QT, Cioffi G, Waite K, Kruchko C, Barnholtz-Sloan JS. CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2014–2018. Neuro-Oncol. 2021;23:iii1-iii105. 10.1093/neuonc/noab200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Stupp R, Hegi ME, Mason WP, et al. National Cancer Institute of Canada Clinical Trials Group Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol. 2009;10:459-466. 10.1016/S1470-2045(09)70025-7 [DOI] [PubMed] [Google Scholar]
- 3. Todo T, Ito H, Ino Y, et al. Intratumoral oncolytic herpes virus G47Δ for residual or recurrent glioblastoma: a phase 2 trial. Nat Med. 2022;31:1365-1639. 10.1038/s41591-022-01897-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Toms SA, Kim CY, Nicholas G, Ram Z. Increased compliance with tumor treating fields therapy is prognostic for improved survival in the treatment of glioblastoma: a subgroup analysis of the EF-14 phase III trial. J Neurooncol. 2019;141:467-473. 10.1007/s11060-018-03057-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Brahmer JR, Tykodi SS, Chow LQM, et al. Safety and activity of anti–PD-L1 antibody in patients with advanced cancer. N Engl J Med. 2012;366:2455-2465. 10.1056/NEJMoa1200694 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Yarchoan M, Hopkins A, Jaffee EM. Tumor mutational burden and response rate to PD-1 inhibition. N Engl J Med. 2017;377:2500-2501. 10.1056/NEJMc1713444 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zhang H, Chen J. Current status and future directions of cancer immunotherapy. J Cancer. 2018;9:1773-1781. 10.7150/jca.24577 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Reardon DA, Brandes AA, Omuro A, et al. Effect of nivolumab vs bevacizumab in patients with recurrent glioblastoma: the CheckMate 143 phase 3 randomized clinical trial. JAMA Oncol. 2020;6:1003-1010. 10.1001/jamaoncol.2020.1024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Bagley SJ, Logun M, Fraietta JA, et al. Intrathecal bivalent CAR T cells targeting EGFR and IL13Rα2 in recurrent glioblastoma: phase 1 trial interim results. Nat Med. 2024;30:1320-1329. 10.1038/s41591-024-02893-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Brown CE, Hibbard JC, Alizadeh D, et al. Locoregional delivery of IL-13Rα2-targeting CAR-T cells in recurrent high-grade glioma: a phase 1 trial. Nat Med. 2024;30:1001-1012. 10.1038/s41591-024-02875-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Rossjohn J, Pellicci DG, Patel O, Gapin L, Godfrey DI. Recognition of CD1d-restricted antigens by natural killer T cells. Nat Rev Immunol. 2012;12:845-857. 10.1038/nri3328 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Godfrey DI, Le Nours J, Andrews DM, Uldrich AP, Rossjohn J. Unconventional T cell targets for cancer immunotherapy. Immunity. 2018;48:453-473. 10.1016/j.immuni.2018.03.009 [DOI] [PubMed] [Google Scholar]
- 13. Hara A, Koyama-Nasu R, Takami M, et al. CD1d expression in glioblastoma is a promising target for NKT cell-based cancer immunotherapy. Cancer Immunol Immunother. 2021;70:1239-1254. 10.1007/s00262-020-02742-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Godfrey DI, Uldrich AP, McCluskey J, Rossjohn J, Moody DB. The burgeoning family of unconventional T cells. Nat Immunol. 2015;16:1114-1123. 10.1038/ni.3298 [DOI] [PubMed] [Google Scholar]
- 15. Yamada D, Iyoda T, Vizcardo R, et al. Efficient regeneration of human Vα24+ invariant natural killer T cells and their anti-tumor activity in vivo. Stem Cells. 2016;34:2852-2860. 10.1002/stem.2465 [DOI] [PubMed] [Google Scholar]
- 16. Aoki T, Motohashi S, Koseki H. Regeneration of invariant natural killer T (iNKT) cells: application of iPSC technology for iNKT cell-targeted tumor immunotherapy. Inflamm Regen. 2023;43:27. 10.1186/s41232-023-00275-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kitayama S, Zhang R, Liu TY, et al. Cellular adjuvant properties, direct cytotoxicity of re-differentiated Vα24 invariant NKT-like cells from human induced pluripotent stem cells. Stem Cell Rep. 2016;6:213-227. 10.1016/j.stemcr.2016.01.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Mise N, Takami M, Suzuki A, et al. Antibody‐dependent cellular cytotoxicity toward neuroblastoma enhanced by activated invariant natural killer T cells. Cancer Sci. 2016;107:233-241. 10.1111/cas.12882 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Wu B, Zhong C, Lang Q, et al. Poliovirus receptor (PVR)-like protein cosignaling network: new opportunities for cancer immunotherapy. J Exp Clin Cancer Res. 2021;40:267. 10.1186/s13046-021-02068-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Matsuda M, Ono R, Iyoda T, et al. Human NK cell development in hIL-7 and hIL-15 knockin NOD/SCID/IL2rgKO mice. Life Sci Alliance. 2019;2:e201800195. 10.26508/lsa.201800195 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Aoki T, Takami M, Takatani T, et al. Activated invariant natural killer T cells directly recognize leukemia cells in a CD1d‐independent manner. Cancer Sci. 2020;111:2223-2233. 10.1111/cas.14428 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Shibuya A, Campbell D, Hannum C, et al. DNAM-1, a novel adhesion molecule involved in the cytolytic function of T lymphocytes. Immunity. 1996;4:573-581. 10.1016/S1074-7613(00)70060-4 [DOI] [PubMed] [Google Scholar]
- 23. Marlin SD, Springer TA. Purified intercellular adhesion molecule-1 (ICAM-1) is a ligand for lymphocyte function-associated antigen 1 (LFA-1). Cell. 1987;51:813-819. 10.1016/0092-8674(87)90104-8 [DOI] [PubMed] [Google Scholar]
- 24. Bottino C, Castriconi R, Pende D, et al. Identification of PVR (CD155) and nectin-2 (CD112) as cell surface ligands for the human DNAM-1 (CD226) activating molecule. J Exp Med. 2003;198:557-567. 10.1084/jem.20030788 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Tahara-Hanaoka S, Shibuya K, Onoda Y, et al. Functional characterization of DNAM-1 (CD226) interaction with its ligands PVR (CD155) and nectin-2 (PRR-2/CD112). Int Immunol. 2004;16:533-538. 10.1093/intimm/dxh059 [DOI] [PubMed] [Google Scholar]
- 26. Choi H, Lee Y, Park SA, et al. Human allogenic γδ T cells kill patient-derived glioblastoma cells expressing high levels of DNAM-1 ligands. OncoImmunology. 2022;11:2138152. 10.1080/2162402X.2022.2138152 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Mendelsohn CL, Wimmer E, Racaniello VR. Cellular receptor for poliovirus: molecular cloning, nucleotide sequence, and expression of a new member of the immunoglobulin superfamily. Cell. 1989;56:855-865. 10.1016/0092-8674(89)90690-9 [DOI] [PubMed] [Google Scholar]
- 28. Joller N, Hafler JP, Brynedal B, et al. Cutting edge: TIGIT has T Cell-intrinsic inhibitory functions. J Immunol. 2011;186:1338-1342. 10.4049/jimmunol.1003081 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Anderson AC, Joller N, Kuchroo VK. Lag-3, Tim-3, and TIGIT: co-inhibitory receptors with specialized functions in immune regulation. Immunity. 2016;44:989-1004. 10.1016/j.immuni.2016.05.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Kučan Brlić P, Lenac Roviš T, Cinamon G, Tsukerman P, Mandelboim O, Jonjić S. Targeting PVR (CD155) and its receptors in anti-tumor therapy. Cell Mol Immunol. 2019;16:40-52. 10.1038/s41423-018-0168-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Sloan KE, Stewart JK, Treloar AF, Matthews RT, Jay DG. CD155/PVR enhances glioma cell dispersal by regulating adhesion signaling and focal adhesion dynamics. Cancer Res. 2005;65:10930-10937. 10.1158/0008-5472.CAN-05-1890 [DOI] [PubMed] [Google Scholar]
- 32. Chandramohan V, Bryant JD, Piao H, et al. Validation of an immunohistochemistry assay for detection of CD155, the poliovirus receptor, in malignant gliomas. Arch Pathol Lab Med. 2017;141:1697-1704. 10.5858/arpa.2016-0580-OA [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Sloan KE, Eustace BK, Stewart JK, et al. CD155/PVR plays a key role in cell motility during tumor cell invasion and migration. BMC Cancer. 2004;4:73. 10.1186/1471-2407-4-73 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Hung AL, Maxwell R, Theodros D, et al. TIGIT and PD-1 dual checkpoint blockade enhances antitumor immunity and survival in GBM. OncoImmunology. Published online May 24, 2018;7:e1466769. 10.1080/2162402X.2018.1466769 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Liu D, Song L, Brawley VS, et al. Medulloblastoma expresses CD1d and can be targeted for immunotherapy with NKT cells. Clin Immunol. 2013;149:55-64. 10.1016/j.clim.2013.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data supporting this study’s findings are available from the corresponding author upon reasonable request.





