Summary
Transposable elements (TEs) contribute to genomic adaptation but are typically silenced to maintain genome integrity. In this study, we investigated TE activation in a Chlamydomonas reinhardtii mutant deficient in DE‐ETIOLATED1 (DET1). This mutant was originally identified for its enhanced high‐light tolerance due to constitutive nonphotochemical quenching (NPQ). While NPQ mitigates light‐induced stress, its persistent activation compromises growth under low light (LL).
Notably, the slow‐growing det1 cultures under LL conditions rapidly reverted to a fast‐growing phenotype. The recurrent emergence of fast‐growing suppressor mutants indicated a previously unrecognized role of DET1 in TE suppression. To explore this possibility, we performed phenotypic, molecular, and genomic analyses, including TE insertion mapping and gene expression studies in det1 and its suppressor mutants.
Our analysis uncovered that the phenotypic suppression resulted from the insertion of a specific TE, Bill, into the subunits for a transcription factor for the photoprotective genes LHCSR1/3, CrCO/NF‐Ys. These insertions disrupted NPQ, restored efficient light harvesting, and facilitated growth in LL.
These results suggest that DET1 integrates NPQ induction for photoprotection and TE mobilization for genomic plasticity, bridging short‐term responses with long‐term adaptation.
Keywords: green algae, NPQ, photosynthesis, stress response, transposable element, ubiquitin E3 ligase
Introduction
There are two types of transposable elements (TEs) classified based on their mechanism of transposition: retrotransposons (Class I), which use an RNA intermediate and perform copy‐and‐paste transposition, and DNA transposons (Class II), which do not involve an RNA intermediate and perform cut‐and‐paste transposition (Feschotte & Pritham, 2007). DNA transposons are the first TE discovered with the genetic characterization of the Ac/Ds family of autonomous and nonautonomous TEs in maize (McClintock, 1950). Over billions of years of evolution, TEs have struck a balance between detrimental effects on individuals and long‐term beneficial effects on species through increasing genomic variations (Kazazian Jr., 2004). The activation of TE occurs under specific conditions, such as stress, encompassing environmental, biological, and chemical factors (McClintock, 1984). Numerous studies have enhanced our understanding of how stress escalates transposon activity, primarily through alterations in epigenetic markers and modifications in chromatin structure (Slotkin & Martienssen, 2007; Zeh et al., 2009; Casacuberta & Gonzalez, 2013). Such an increase in transposon activity under stress conditions may contribute to an increase in genetic diversity within a population, potentially bolstering the species' adaptive capacity in response to new environmental challenges (McClintock, 1984; Feschotte & Pritham, 2007; Casacuberta & Gonzalez, 2013; Raingeval et al., 2024). Despite these insights, the underlying molecular mechanisms by which environmental stress leads to elevation of transposon activity remain largely elusive.
In this study, we investigated a mutant of the green unicellular alga Chlamydomonas reinhardtii lacking DE‐ETIOLATED 1 (det1). This mutant was previously isolated for its unique high‐light (HL)‐tolerant characteristics (Aihara et al., 2019). Photosynthetic organisms are in general susceptible to HL stress despite their ability to harness light energy because it promotes the production of reactive oxygen species. Their defense mechanism against such stress involves activating nonphotochemical quenching (NPQ), a process that thermally dissipates excess light energy (Minagawa, 2013). In C. reinhardtii, the expression of components necessary for NPQ is generally low under low‐light (LL) conditions. When exposed to light stress, such as HL/UV, the suppression of these components is relieved, leading to the induction of NPQ. Central to this process is the induction and activation of photoprotective proteins including LIGHT‐HARVESTING COMPLEX STRESS RELATED1 (LHCSR1) and LHCSR3 (Allorent & Petroutsos, 2017). Expression of these LHCSRs is triggered by blue light perception through the phototropin pathway (Petroutsos et al., 2016) and UV light perception through the UVR8 pathway (Allorent et al., 2016), respectively. Because the phototropin mutant, phot, is unable to induce LHCSR3, it is unable to grow under HL conditions (Petroutsos et al., 2016). The phot det1 mutant was identified as a suppressor of phot (Aihara et al., 2019). It displayed enhanced expression of LHCSRs, resulting in efficient growth under HL (NPQ > 4.0).
The transcription of LHCSRs is positively regulated by a transcription factor complex comprising CONSTANS (CO) and the NUCLEAR FACTOR‐Y (NF‐Y) B and C subunits, whose activity is inhibited by the ubiquitin E3 ligase complex CONSTITUTIVE PHOTOMORPHOGENIC1 (COP1)/SUPPRESSOR OF PHYA‐105 1 (SPA1) (Gabilly et al., 2019; Tokutsu et al., 2019a). The activity of COP1/SPA1 is, in turn, downregulated upon exposure to HL or UV (Gabilly et al., 2019; Tokutsu et al., 2019a). Additionally, DET1, a component of another ubiquitin E3 ligase, CULLIN 4 (CUL4)–UV‐DAMAGED DNA BINDING PROTEIN 1 (DDB1)DET1, has been suggested to enhance COP1/SPA1 (Lau & Deng, 2012; Aihara et al., 2019). Thus, when DET1 is inhibited upon exposure to HL, the transcription of LHCSRs is induced. A current model of the signal transduction pathways involved in NPQ induction in C. reinhardtii is presented in Supporting Information Fig. S1.
In the literature, DET1 was initially reported as a negative regulator of photomorphogenic development in Arabidopsis thaliana, in which the det1 mutant manifests a de‐etiolated phenotype in darkness (Pepper et al., 1994). The function of DET1 in land plants has been described as enhancing the activity of COP1/SPA1 ubiquitin E3 ligase (Lau & Deng, 2012), a role similarly observed in C. reinhardtii. Furthermore, DET1 is a highly conserved protein present in not only plants but also mammals. For example, in human embryonic kidney cells, DET1 promotes the ubiquitination and degradation of the proto‐oncogenic transcription factor c‐Jun (Wertz et al., 2004), suggesting that it is involved in diverse cellular processes, including oncogenic transformation (Shaulian & Karin, 2002; Wakabayashi et al., 2011).
Materials and Methods
Algal strains and growth conditions
Chlamydomonas reinhardtii Dangeard strain CC‐125 (137c mt+) was obtained from the Chlamydomonas Resource Center (https://www.chlamycollection.org/) and was used as wild‐type (WT) strain. The phot det1 mutant, derived from a cell‐wall‐less Dangeard strain (cw15), was isolated in a previous study (Aihara et al., 2019). The phot single mutant based on CC‐125 (Greiner et al., 2017) was generously provided by Prof. Peter Hegemann (Humboldt University of Berlin). The previously obtained CrCO, NFYB, and NFYC mutants (crco‐2, nfyb‐1, and nfyc) (Tokutsu et al., 2019b) were crossed with the det1 CRISPR‐Cas9 mutant (will be discussed later) to generate double mutants: det1 crco‐2, det1 nfyb‐1, and det1 nfyc, respectively. Cells were cultured mixotrophically at 25°C under 40–50 μmol photons m−2 s−1 in tris‐acetate‐phosphate (TAP) medium (Gorman & Levine, 1965) unless otherwise stated. For NPQ measurements and immunoblot analysis of LHCSR proteins, cells were precultured in TAP medium under 40–50 μmol photons m−2 s−1 until mid‐logarithmic phase (1–2 × 106 cells ml−1). Cells were then resuspended in Sueoka's high salt medium (Sueoka, 1960). After an incubation under LL conditions (10–15 μmol photons m−2 s−1) for c. 24 h with shaking, the cell concentration was adjusted to an OD680 at between 0.40 and 0.44. Subsequently, cells were exposed to either LL or HL (c. 400 μmol photons m−2 s−1) for 4 h. White fluorescent lamps were used as the LL source, while an LED panel, KR93SP (380–700 nm; Eco‐lamps Inc., Hong Kong, China), was used as the white HL source.
Generation of the det1 mutant via CRISPR‐Cas9
CRISPR‐Cas9 system was employed to target exon 5 of the DET1 gene to create det1 mutants using a guide RNA (5′—GGATGTCGTACAGTTCATGG—3′) following a previously established protocol (Tokutsu et al., 2019a). A double‐stranded tag‐V2 donor (ds‐tag‐V2) was used in place of a homology‐directed repair donor. Recombinant Streptococcus pyrogenes Cas9 (spCas9) protein, tracrRNA, and crRNA were purchased from Integrated DNA Technologies (Coralville, IA, USA). Cells of the phot mutant based on CC‐125 grown under synchronized light cycles were transformed with a ribonucleoprotein complex (spCas9, tracrRNA, and crRNA), ds‐tag‐V2, and PCR‐amplified AphVIII cassette (conferring paromomycin‐resistant), using the NEPA21 Super Electroporator (Nepa Gene Co., Ltd, Ichikawa, Japan). Transformed cells were selected on TAP plates containing 10 μg ml−1 paromomycin under dim light at 25°C. Paromomycin‐resistant colonies were screened for the insertion of the ‘FLAG’ sequence, situated in the middle of the tag‐V2, using whole‐genome PCR with primers DET1‐check‐F, DET1‐check‐R, FLAG ver2‐check‐F, and FLAG ver2‐check‐R. The sequences of tag‐V2 and PCR primers are listed in Table S1. The genomic region surrounding the CRISPR target site in the positive clone (E8) was PCR‐amplified using primers DET1‐check‐F and DET1‐check‐R and subjected to sequencing analysis to characterize the mutant structure. The det1 mutant was established after four rounds of backcrossing with the WT.
Growth phenotype analysis
Cells were suspended in TAP medium at 5 × 106 cells ml−1. Five microliters of droplets of fivefold serial dilutions of cell cultures was spotted onto TAP plates and incubated at 25°C.
Isolation of dos suppressor mutants
The phot det1 mutant was crossed with the WT. Among the 19 progeny retaining the det1 genotype, four exhibiting a faster growth rate under the light intensity at 40–50 μmol photons m−2 s−1 were isolated (7A: mt−, 8B: mt−, 7C: mt+, and 3H: mt+). Two independent single colonies from each isolated progeny were tested for NPQ to assess whether the faster growth rate under the light intensity at 40–50 μmol photons m−2 s−1 correlated with reduced NPQ relative to the WT. These suppressor mutations were named dos1 in 7A, dos2 in 8B, dos3 in 7C, and dos4 in 3H ( det one suppressor). Among newly derived det1 progeny generated by crossing the det1 single mutant with other related mutants, one line exhibiting a significantly faster growth rate than the original det1 single mutant was designated as dos5.
Immunoblot analysis
SDS‐PAGE and immunoblot analysis were performed as previously described (Takahashi et al., 2006). Briefly, total cellular proteins were solubilized in 2% SDS and 0.1 M dithiothreitol at 100°C for 3 min, separated by SDS‐PAGE using a resolving gel containing 6 M urea, and transferred onto a PVDF, or polyvinylidene fluoride, membrane. The membrane was then probed with an anti‐LHCSR antibody (Tokutsu et al., 2019b) and visualized using enhanced chemiluminescence.
Genetic linkage analysis of the mutants
The det1 dos mutants were crossed with each other. To assess whether the resultant progeny have a ‘dos phenotype’, they were subjected to NPQ measurement. Progeny that did not show high NPQ under LL conditions were considered to have a ‘dos phenotype’. Genetic linkage analysis revealed the existence of two linkage groups among the five dos mutations: one comprising dos1, dos2, and dos3, and another comprising dos4 and dos5. Similarly, genetic crosses between det1 dos1 and det1 nfyc, det1 dos1 and det1 crco, and det1 dos5 and det1 nfyb were conducted, and the resultant progeny were subjected to NPQ measurement. These results are summarized in Table S2.
Chl fluorescence quenching analysis
Chl fluorescence was measured essentially as previously described (Tokutsu et al., 2019a) using a FluorCam 800MF imaging fluorometer (Photon Systems Instruments, Drásov, Czech Republic). Cells were transferred to a 48‐well culture plate and adapted under far‐red light (< 5 μmol photons m−2 s−1) for 15 min before measurements. Actinic light irradiation was applied at 750 μmol photons m−2 s−1. NPQ values were calculated as NPQ = (Fm – Fm′)/Fm′.
Southern blot analysis
Genomic DNA (3 μg) was digested using restriction enzymes, subjected to electrophoresis on a 0.7% agarose gel, and transferred to a positively charged nylon membrane (cat no. 11209299001, Roche Diagnostics, Basel, Switzerland). A digoxigenin (DIG)‐labeled probe for detecting the Bill sequence was prepared as follows: A c. 1.3 kb DNA fragment containing the Bill insert was PCR‐amplified using primers CON1‐F2 and CON1‐R2, with whole‐genome DNA of the det1 dos3 mutant as the template. This PCR product was used as a template for a second round of PCR using primers BamHI‐Bill‐Fw and EcoRI‐Bill‐Rv. The resulting 576‐bp DNA fragment was digested with BamHI and EcoRI and cloned into the pBluescript II KS+ vector (Agilent Technologies, Inc., Santa Clara, CA, USA), generating pBSIIKS‐Bill plasmid. Following sequence confirmation of the Bill insert, the pBSIIKS‐Bill plasmid was used as a template to produce the DIG‐labeled probe. The 576‐bp fragment containing the Bill sequence was PCR‐amplified with primers BamHI‐Bill‐Fw and EcoRI‐Bill‐Rv using a random primer labeling kit (DIG‐High Prime DNA Labeling and Detection Starter Kit II, Roche). Electrophoresis, blotting, hybridization, and signal detection were performed according to the manufacturer's instructions.
Whole‐cell genomic PCR for genotyping
Genomic DNA was extracted as follows. Forty microliters of cell cultures grown in TAP medium to a late‐logarithmic phase, or a similar number of cells grown on a TAP plate, was collected by centrifugation and resuspended in 25 μl of a TE10:10 solution (10 mM Tris–HCl, 10 mM sodium EDTA, pH 8.0). The cell suspension was heated to 99°C for 8 min, immediately transferred to ice, and diluted with 100 μl of sterile water. This cell suspension was frozen in a freezer at −30°C or in liquid N2. The frozen sample was thawed and used as a PCR template. PCR was performed using KOD FX Neo polymerase (TOYOBO Co., Ltd, Osaka, Japan). The PCR primer sequences are provided in Table S1.
Examination of Bill insertion into the NFYB and CrCO genes
Cells were suspended in TAP medium at c. 2 × 106 cells ml−1 to establish the ‘Start culture’. The start culture was diluted 1 : 10 000 in two flasks, each containing 100 ml of TAP medium. Cells were cultured with shaking under 40–50 μmol photons m−2 s−1 light. Cultures that reached a concentration of 2–7 × 106 cells ml−1 were referred to as the first passage. The first passage was diluted 1 : 10 000 in the same manner, and the culture that again reached 2–7 × 106 cells ml−1 were referred to the second passage. The second passage was diluted 1 : 10 000 in the same manner, and the resultant culture that reached 2–7 × 106 cells ml−1 was referred to as the third passage. For WT strain, the third passage was further diluted 1 : 10 000 and the resultant culture that reached 2–7 × 106 cells ml−1 was referred to as the fourth passage. From each passage culture, 2 × 105 cells were collected for PCR tests in the same manner as described in ‘Whole‐cell genomic PCR for genotyping’ in the Materials and Methods section.
Results
det1 mutant exhibits growth defect under LL
In C. reinhardtii, although the suppressor mutant phot det1 exhibits remarkable tolerance to HL, its growth is compromised in LL due to the reduced photosynthetic quantum yield caused by its high NPQ capacity (Wilson et al., 2023). Intriguingly, the slow‐growing phot det1 cultures consistently transition into fast‐growing cultures after repeated subculturing in LL, propagating at rates similar to the WT. This implies that the det1 population employs an adaptation strategy to ensure the species survival, leveraging the inherent stress responses to HL. To investigate the molecular mechanism underlying this adaptation strategy, we generated a det1 single mutant by crossing the previously isolated phot det1 double mutant with WT. The initial approach was hindered by the cell‐wall‐less (cw15) characteristics of the original double mutant. As an alternative strategy, we employed the CRISPR‐Cas9 system to introduce a det1 insertion mutation into the cell‐walled phot mutant (Greiner et al., 2017). The resulting phot det1 double mutant was backcrossed with the WT four times (Fig. S2B). The single det1 mutant derived from the final backcross was used for the subsequent studies. The det1 single mutant exhibited slower growth rates under light intensities lower than 50 μmol photon m−2 s−1 (Fig. 1a), with c. 20% longer doubling time when compared to the WT (Fig. 1b). This mirrored the characteristics of the original phot det1 double mutant (Wilson et al., 2023). LHCSRs were expressed higher than the WT under both HL and LL conditions, supporting the high NPQ phenotype in the det1 mutant (Fig. 1c).
Fig. 1.

Slow growth of the Chlamydomonas reinhardtii DE‐ETIOLATED 1 (det1) mutant under low‐light (LL) conditions. (a) Growth comparison of det1 mutants (phot det1 and det1) with the wild‐type (WT). A complete progeny set from a single tetrad of the fourth backcross ((i)–(iv)), along with the parental WT, was incubated for 7 d under various light intensities, as indicated above each panel. The numbers below the panels represent the cell counts spotted on tris‐acetate‐phosphate (TAP) plates. (b) Doubling time of the det1 mutant under a light intensity of 50 μmol photons m−2 s−1. Cells were grown in TAP medium with shaking. Data represent the mean ± SEM (n = 3). Statistical significance was assessed using Welch's t‐test (***, P < 0.001). (c) Immunoblot analysis of LIGHT‐HARVESTING COMPLEX STRESS RELATED (LHCSR) proteins in the det1 mutant. Whole‐cell extracts containing 1 μg of Chl were prepared from cells exposed to LL (L; 10 μmol photons m−2 s−1) or high light (H; 400 μmol photons m−2 s−1) for 4 h, and loaded into each SDS‐PAGE lane. AtpB (beta subunit of ATP synthase) levels serve as a loading control.
Emergence of dos mutants as det1 suppressors
When the F2 det1 cells were backcrossed with WT, while the majority of the F3 det1 progeny showed the original det1 phenotype, characterized by slow growth under LL, some did not (Figs 2a, S3A). Even among the former slow‐growing progeny, some formed significantly larger colonies than the others (Fig. 2a). We encountered similar phenomena with the phot det1 mutant, leading us to suspect that it was due to the det1 mutation. Subsequently, we found that the fast‐growing det1 progeny did not show high NPQ when grown under LL (Fig. S3B), suggesting that their fast‐growing phenotype may have arisen due to additional genetic mutation(s) in the components for NPQ induction. We therefore independently isolated five det1 mutant clones that exhibited a fast‐growing phenotype and named the possible additional mutant alleles DET‐ONE SUPPRESSOR 1–5 (dos1–dos5). All of these det1 dos mutants exhibited faster growth (Fig. 2b), decreased expression of LHCSRs (Fig. 2c), and lower NPQ (Fig. S3C) under LL conditions compared with the parent det1 mutant.
Fig. 2.

Characterization of the det1 suppressor (dos) mutants in Chlamydomonas reinhardtii. (a) Growth of the DE‐ETIOLATED 1 (det1) F3 progenies. Five microliters of cell suspensions at 1 × 106 cells ml−1 was spotted on a tris‐acetate‐phosphate (TAP) plate and incubated for 17 d under 4 μmol photons m−2 s−1. The names of the clones are shown above their spots with genotype in parentheses. ‘p’, ‘d’, and ‘W’ denote phot, det1, and wild‐type (WT), respectively. Clones with relatively good growth (C3, A3) are marked with cyan circles, while poorly grown det1 clones (D5, D10) are marked with red circles. Enlarged photographs of the red‐marked clones show several larger colonies. (b) Growth comparison of the det1 dos mutants, det1 mutant, and WT. Cells were incubated for 4 d under 50 μmol photons m−2 s−1. Numbers below the panel represent the cell counts spotted on TAP plates. (c) Immunoblot analysis of LIGHT‐HARVESTING COMPLEX STRESS RELATED (LHCSR) proteins in the det1 dos mutants. Total cell extracts were prepared from cells exposed to low‐light (L) or high‐light (H) conditions for 4 h. AtpB levels serve as a loading control. (d) Schematic representation of Bill insertions in the CrCO and NFYB genes in the det1 dos mutants. (e) Genomic DNA sequences around the Bill insertion sites in the det1 dos mutants. The characteristic Bill sequences, including terminal inverted repeats and target site duplications, are depicted in red and blue, respectively.
The dos1–3 and dos4–5 are linked to crco and nfyb
To examine the genetic relationships among the dos mutations, genetic linkage analyses were conducted. The det1 dos1 mutant was crossed with the det1 dos2–dos5 mutants. Crosses between det1 dos1 and det1 dos3 failed to produce any viable progeny. None of the progeny from crosses between det1 dos1 and det1 dos2, nor between det1 dos2 and det1 dos3, exhibited high NPQ under the LL conditions, suggesting that dos1, dos2, and dos3 are genetically linked. Conversely, a substantial proportion of the progeny from crosses between det1 dos1 and either det1 dos4 or det1 dos5 displayed high NPQ without HL pretreatment, indicating that neither dos4 nor dos5 is allelic to dos1. Furthermore, none of the progeny from the det1 dos4 and det1 dos5 cross showed high NPQ, implying that dos4 and dos5 are also genetically linked. These genetic analyses revealed that the mutations can be classified into two linkage groups: one comprising dos1, dos2, and dos3 and another comprising dos4 and dos5 (Table S2).
Because CrCO/NF‐Ys transcription factor complex has been suggested to positively regulate LHCSR transcription (Tokutsu et al., 2019a), we first generated det1 crco, det1 nfyb, and det1 nfyc double mutants to examine whether this transcription factor complex is involved in the elevated LHCSR expression observed in the det1 mutant under LL conditions. The results indicated that all of these double mutants abolished the constitutive accumulation of LHCSR1 and LHCSR3 expression (Fig. S4A), which was accompanied by the rescue of the slow growth phenotype of det1 (Fig. S4B) with reduced NPQ (Fig. S4C). The induction of LHCSR3 under HL was still observed in the double mutants (Fig. S4A), suggesting that at least part of the HL‐induced LHCSR3 expression is regulated by a pathway distinct from CrCO/NF‐Ys, likely through the carbon concentration mechanism, as recently reported (Ruiz‐Sola et al., 2023).
Subsequently, since the phenotype of det1 was suppressed by dos mutations (Fig. 2b), the genetic linkages between the dos mutants and the crco, nfyb, and nfyc mutations were examined. In crosses between det1 dos1 and det1 nfyc, progeny displaying high NPQ were identified, indicating that dos1 and nfyc mutations are not allelic. Conversely, none of the progeny exhibited high NPQ from crosses between det1 dos1 and det1 crco, suggesting a genetic linkage between dos1 and crco mutations. Similarly, crosses between det1 dos5 and det1 nfyb yielded no progeny with high NPQ, indicating a genetic linkage between dos5 and nfyb. These results indicated that the dos1–3 mutations were linked to crco, and the dos4–5 mutations to nfyb, with no involvement of other mutations (Table S2). Further PCR analysis revealed that the amplified fragments of the CrCO gene in det1 dos1, det1 dos2, and det1 dos3 mutants were longer than that of the WT (Fig. S5A). Similarly, the amplified fragments of the NFYB gene in det1 dos4 and det1 dos5 mutants were longer than that of the WT (Fig. S5B). Taken together, the genetic linkage analysis revealed that dos1–dos3 mutants and dos4–dos5 mutants contain insertional mutations in CrCO and NFYB genes, respectively.
The dos loci carry a nonautonomous TE, Bill
To further investigate the mutations in the dos loci, multiple regions of the CrCO and NFYB genes were amplified and sequenced using gene‐specific primers. The results indicated that there were two identical 558‐bp insertions in opposite directions within the CrCO gene in det1 dos1 (Fig. 2d). Remarkably, the CrCO gene in the det1 dos3 mutant and the NFYB gene in the det1 dos4 and det1 dos5 mutants also had insertions of the nearly identical 558‐bp sequences (Fig. 2d). We found that those 558‐bp DNA fragments were highly similar to the sequence of a previously reported MITE in C. reinhardtii, designated as Bill in the literature (Craig et al., 2023). As in the reported sequence of Bill, all the 558‐bp sequences in CrCO and NFYB contained 17‐bp terminal inverted repeats at both ends and were flanked by 8‐bp target site duplications on both sides (Kim et al., 2006) (Fig. 2e). The amplified product of the det1 dos2 mutant was, however, somehow heterogeneous, and although the insertion site was identified within the first intron of CrCO, the sequence of the insertion could not be determined.
When the 5′ and 3′ regions of the NFYB gene in the det1 dos5 mutant, which harbor the dos5‐a and dos5‐b insertions, respectively (Fig. 3a), were PCR‐amplified using templates from 45 randomly selected mutant colonies, including A2, A3, and C2, long PCR products corresponding to the fragments with the Bill insertion were predominantly identified (PCR‐A; Fig. 3b). However, some colonies, such as A7 and C3, displayed short products corresponding to the fragments without the Bill insertion (Fig. 3b). Given that these det1 dos5 mutants underwent single‐colony isolation, it is probable that the cells displaying short PCR products initially carried the insertion but have since lost it. This hypothesis was further supported by similar observations using det1 dos1, in which some single colonies exhibited short PCR products without the Bill insert in the CrCO gene (Fig. S6A,B). Importantly, such clones lacking the Bill insert exhibited the same low NPQ phenotype as those retaining the Bill insert (Fig. 3c). This was confirmed by sequencing the regions in which Bill was excised (Fig. S7), revealing the footprints of extra nucleotides or extralong insertion (Fig. 3d). These results suggest that Bill transposition is ongoing in the cultures of det1 dos mutants.
Fig. 3.

Ongoing Bill transposition in the Chlamydomonas reinhardtii DE‐ETIOLATED 1 (det1) det1 suppressor5 (dos5) mutant. (a) Schematic of Bill insertions and target regions for PCR analysis in the NFYB gene of the det1 dos5 mutant. Primer locations for PCR amplification are indicated by cyan and magenta arrowheads for PCR‐A and PCR‐B, respectively. Expected sizes of PCR products from wild‐type (WT) genomic DNA are shown. Cyan and magenta bars represent the sequenced regions shown in (d). (b) PCR analysis of the NFYB gene in 45 single colonies of the det1 dos5 mutant after subculturing. Representative clones with (A2, A3, and C2 in PCR‐A; A2, A7, and C2 in PCR‐B; red‐arrowed position) and without (A7 and C3 in PCR‐A; A3 and C3 in PCR‐B; black‐arrowed position). The clones selected for nonphotochemical quenching (NPQ) (c) and sequence (d) analysis are marked with red stars. (c) NPQ analysis of clones that lost Bill insertions. NPQ values after exposure to low light (LL) or high light (HL) for 4 h are shown. Data represent mean ± SEM (n = 3). (d) Nucleotide sequences of selected clones with and without Bill insertions. Nucleotides corresponding to Bill's terminal inverted repeats, target site duplications, extra nucleotides, and the extralong insertion are shown in red, blue, green underlined, and magenta underlined, respectively.
Bill transposition is enhanced in the det1
As mentioned previously, Bill was integrated into the CrCO and NFYB genes in det1 dos1–dos3 and det1 dos4–dos5 mutants, respectively. Once integrated, Bill transposed from its original position to other locations. This led us to a hypothesis that the transposition activity of Bill is enhanced in the det1 background. To test this hypothesis, the transposition frequency of Bill in the det1 mutant was compared with that in the WT. Both the det1 mutant and the WT were inoculated in liquid media in duplicates. When the cell concentration reached 2–7 × 106 cells ml−1, portions of the cultures were recovered and diluted into fresh media, repeating this process at least three times (Fig. 4a). Genomic PCR was then performed using primers specific to the Bill internal sequence and the NFYB flanking sequences (Fig. 4b). In the WT, no PCR fragments were detected in the NFYB gene up to the fourth passage (approximately after 51–53 divisions) (Fig. 4c). In det1, however, the PCR products were detected as early as the second passage (approximately after 24–27 divisions) in both duplicates (flask A and B), demonstrating that more frequent Bill insertions occur in the NFYB (Fig. 4c). Similar results were obtained for the CrCO gene, in which Bill insertions were identified as early as the second passage (Fig. S8B). Finally, Southern blot analysis compared the copy number of Bill in the det1 and the WT genomes using the Bill sequence as a probe. Thirteen bands were detected in the WT genome when digested with BamHI and XhoI, as well as with HindIII (Fig. 4d). By contrast, the band pattern in the det1 mutant was markedly complex, with an increased number of bands, supporting the conclusion that Bill transposes more frequently in the det1 background than in the WT.
Fig. 4.

Enhanced Bill transposition in the DE‐ETIOLATED 1 (det1) mutant in Chlamydomonas reinhardtii. (a) Workflow for sampling the det1 genome from passaged cultures. Cells were suspended in tris‐acetate‐phosphate (TAP) medium at c. 2 × 106 cells ml−1, referred to as the ‘Start culture’. This culture was inoculated into two flasks (A and B) containing TAP medium at a 1 : 10 000 dilution. Cells were cultured with shaking under 40–50 μmol photons m−2 s−1 light. Once the culture reached 2–7 × 106 cells ml−1, samples were collected for genomic PCR, and the culture was diluted again at 1 : 10 000 to continue growth. This process was repeated to obtain 1st, 2nd, and 3rd passage samples for genomic PCR, while for wild‐type (WT), samples were collected up to the 4th passage. (b) Schematic representation of the NFYB gene showing Bill insertions and primer locations for PCR analysis (left). A table listing the PCR product names and their corresponding primers (right). (c) Genomic PCR analysis of Bill insertions in the NFYB gene from 1st to 4th passage samples. PCR product names are indicated on the left side of the gels. Amplification of the NFYB gene (NFYB‐C) serves as a control to verify that equal amounts of template were loaded. (d) Southern blot analysis of det1 mutant and WT. Total genomic DNA was digested with HindIII (right) or a combination of BamHI and XhoI (left) and probed for Bill. Red dots mark the positions of the bands. A DIG‐labeled marker and a positive control (pBS‐Bill) are shown in the far‐right panel.
Discussion
Although numerous studies have effectively described the conditions under which TEs are mobilized, including changes in epigenetic markers and modifications in chromatin organization (Slotkin & Martienssen, 2007; Zeh et al., 2009), the molecular mechanisms both upstream and downstream of these changes remain largely unclear. The findings in the current study suggest that DET1, an E3 ubiquitin ligase component, plays a role in not only restricting the induction of LHCSR expression but also maintaining the repression of Bill transposition under nonstress conditions. This sophisticated mechanism potentially enables the photosynthetic organism to rapidly acclimate to short‐term environmental fluctuations, such as daily weather changes, while simultaneously enhancing its capacity for long‐term adaptation to sustained environmental shifts, such as climate change. The frequent insertions of Bill observed in NPQ‐regulating transcription factors in det1 suppressors (dos) underscore this dual role.
The involvement of DET1 in epigenetic modifications has been previously suggested in land plants. Benvenuto et al. (2002) reported that DET1 binds to nonacetylated N‐terminal tails of the core histone H2B in Arabidopsis. A subsequent study revealed that dark‐grown det1 mutant plants exhibited condensed heterochromatin in cotyledon cells, leading the researchers to propose that DET1 mediates light‐triggered heterochromatin reorganization, which potentially underlies the transcriptional reprogramming necessary for de‐etiolation (Bourbousse et al., 2015). Although Chlamydomonas and Arabidopsis are phylogenetically distant, the core regulatory mechanism may have arisen before their divergence and remained conserved. Indeed, key regulatory components involved in flowering in land plants and photoprotection in green algae, such as the COP1/SPA1 E3 ligase and the CO/NF‐Ys transcription factor, are shared between these species (Tokutsu et al., 2019a). Therefore, it is not surprising that DET1‐dependent transcriptional regulation, along with its associated epigenetic regulations, may also be conserved across species. Alternatively, TE mobilization might not be directly regulated by DET1 itself, but rather by its downstream factor(s). For example, in humans, DET1 targets the proto‐oncogenic transcription factor c‐Jun for ubiquitination and degradation in embryonic kidney cells (Wertz et al., 2004). Under specific conditions, such as in hippocampal progenitors differentiated from the induced pluripotent stem cells derived from Alzheimer's disease patients, TE mobilization was observed upon upregulation of c‐Jun (Scopa et al., 2023). This raises another possibility that, in Chlamydomonas, TE mobilization could similarly be driven by the upregulation of CrCO/NF‐Ys. This possibility warrants further investigation.
We propose the following sequence of events based on the observations in this study. Under LL conditions in C. reinhardtii WT cells, the CUL4‐DDB1DET1 and COP1/SPA1 E3 ubiquitin ligases negatively regulate the CrCO/NF‐Ys transcription factor complex, thereby suppressing both the expression of LHCSR genes and the mobilization of Bill (Fig. 5a). In the absence of DET1 (i.e. in the det1 mutant), these E3 ligases become inactive, allowing CrCO/NF‐Ys to remain active and to promote LHCSR gene expression. Concurrently, Bill is allowed to mobilize within the genome, potentially enhancing genomic plasticity (Fig. 5b). A previous study have shown that LHCSR expression is triggered by HL stress, specifically via blue light through the phototropin pathway (Petroutsos et al., 2016) and via UV light through the UVR8 pathway (Allorent et al., 2016). Since DET1 is involved in transducing HL stress signals that lead to LHCSR induction (Aihara et al., 2019), it may similarly regulate HL‐induced TE mobilization. Thus, as observed in the absence of DET1, HL stress likely promotes Bill mobilization in parallel with NPQ induction. A conceptual model illustrating this coordinated regulation of stress response and genome plasticity is presented in Fig. S9.
Fig. 5.

Schematic model for nonphotochemical quenching (NPQ) induction and transposable element (TE) activation via DE‐ETIOLATED 1 (DET1) in Chlamydomonas reinhardtii. (a) In wild‐type (WT) under low‐light (LL) conditions, CUL4‐DDB1DET1 and COP1/SPA1 E3 ligases suppress both the CrCO/NF‐Ys transcription factor complex and the transposition of Bill. (b) In the det1 mutant, the CUL4‐DDB1DET1 and COP1/SPA1 E3 ligases are inactive, resulting in the induction of LHCSR1/3 expression and the activation of Bill transposition. Arrows indicate positive regulations, while blunt‐ended arrows indicate negative regulations. Dashed arrows indicate interactions that are abolished. Red upward arrows signify an increase in the specified activity.
Future studies will have to determine whether DET1 specifically suppresses the activity of Bill or broadly regulates multiple TEs. Furthermore, deciphering the precise molecular mechanisms underlying TE regulation remains a critical objective – particularly how DET1 suppresses TE mobilization and how such suppression is alleviated in response to stress signals. These processes are likely mediated by shifts in epigenetic markers, as numerous studies have documented stress‐induced genomic modifications via epigenetic pathways (Slotkin & Martienssen, 2007; Zeh et al., 2009). Ultimately, further studies will be needed to translate the insights obtained from this green algal model into a more comprehensive understanding of the stress responses across diverse organisms. In this context, examining whether det1 mutant plants display elevated TE mobilization would be especially informative.
Competing interests
None declared.
Author contributions
KF‐K conducted the research and prepared the figures. Both KF‐K and JM conceived the research project, interpreted the results, as well as wrote and revised the manuscript.
Disclaimer
The New Phytologist Foundation remains neutral with regard to jurisdictional claims in maps and in any institutional affiliations.
Supporting information
Fig. S1 Signal transduction pathways involved in nonphotochemical quenching induction in Chlamydomonas reinhardtii.
Fig. S2 Construction of DE‐ETIOLATED1 mutant in the wild‐type background.
Fig. S3 Nonphotochemical quenching of F3 clones of the det1 mutant.
Fig. S4 Mutations in CrCO, NF‐YB, or NF‐YC genes counteract LIGHT‐HARVESTING COMPLEX STRESS RELATED1 protein accumulation in the det1 mutant.
Fig. S5 Genomic PCR analysis of the dos mutants.
Fig. S6 Insertions and excisions of Bill in the det1 dos1 mutant.
Fig. S7 PCR analysis of the NFYB gene in selected single‐colony clones of the det1 dos5 mutant.
Fig. S8 Bill insertions in the CrCO gene in the det1 mutant.
Fig. S9 Conceptual model for the coordinated regulation of stress responses (nonphotochemical quenching) and genome plasticity (transposable element activation) in Chlamydomonas reinhardtii.
Table S1 Primers used in this study.
Table S2 Ratio of high nonphotochemical quenching progeny resulting from genetic crosses among det1 and related mutants (dos1–dos5, crco, nfyb, and nfyc).
Please note: Wiley is not responsible for the content or functionality of any Supporting Information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.
Acknowledgements
We thank Dr Peter Hegemann for the phot mutant strain and advice on mutant production using the CRISPR‐Cas9 system. We are grateful to Dr Mikiko Siomi for valuable discussion. We also thank Mrs Tamaka Kadowaki and Harumi Yonezawa for their technical assistance in genetic crossing and algae cultivation. This work was supported by a Grant‐in‐Aid from the Japan Society for the Promotion of Science (21H05040 and 23H04960 to JM).
Data availability
All the data supporting the findings of this study are included within the paper.
References
- Aihara Y, Fujimura‐Kamada K, Yamasaki T, Minagawa J. 2019. Algal photoprotection is regulated by the E3 ligase CUL4‐DDB1DET1 . Nature Plants 5: 34–40. [DOI] [PubMed] [Google Scholar]
- Allorent G, Lefebvre‐Legendre L, Chappuis R, Kuntz M, Truong TB, Niyogi KK, Ulm R, Goldschmidt‐Clermont M. 2016. UV‐B photoreceptor‐mediated protection of the photosynthetic machinery in Chlamydomonas reinhardtii . Proceedings of the National Academy of Sciences, USA 113: 14864–14869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Allorent G, Petroutsos D. 2017. Photoreceptor‐dependent regulation of photoprotection. Current Opinion in Plant Biology 37: 102–108. [DOI] [PubMed] [Google Scholar]
- Benvenuto G, Formiggini F, Laflamme P, Malakhov M, Bowler C. 2002. The photomorphogenesis regulator DET1 binds the amino‐terminal tail of histone H2B in a nucleosome context. Current Biology 12: 1529–1534. [DOI] [PubMed] [Google Scholar]
- Bourbousse C, Mestiri I, Zabulon G, Bourge M, Formiggini F, Koini MA, Brown SC, Fransz P, Bowler C, Barneche F. 2015. Light signaling controls nuclear architecture reorganization during seedling establishment. Proceedings of the National Academy of Sciences, USA 112: E2836–E2844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Casacuberta E, Gonzalez J. 2013. The impact of transposable elements in environmental adaptation. Molecular Ecology 22: 1503–1517. [DOI] [PubMed] [Google Scholar]
- Craig RJ, Gallaher SD, Shu S, Salome PA, Jenkins JW, Blaby‐Haas CE, Purvine SO, O'Donnell S, Barry K, Grimwood J et al. 2023. The Chlamydomonas Genome Project, version 6: Reference assemblies for mating‐type plus and minus strains reveal extensive structural mutation in the laboratory. Plant Cell 35: 644–672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feschotte C, Pritham EJ. 2007. DNA transposons and the evolution of eukaryotic genomes. Annual Review of Genetics 41: 331–368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gabilly ST, Baker CR, Wakao S, Crisanto T, Guan K, Bi K, Guiet E, Guadagno CR, Niyogi KK. 2019. Regulation of photoprotection gene expression in Chlamydomonas by a putative E3 ubiquitin ligase complex and a homolog of CONSTANS. Proceedings of the National Academy of Sciences, USA 116: 17556–17562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gorman DS, Levine RP. 1965. Cytochrome f and plastocyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardi . Proceedings of the National Academy of Sciences, USA 54: 1665–1669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. 2017. Targeting of photoreceptor genes in Chlamydomonas reinhardtii via zinc‐finger nucleases and CRISPR/Cas9. Plant Cell 29: 2498–2518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kazazian HH Jr. 2004. Mobile elements: drivers of genome evolution. Science 303: 1626–1632. [DOI] [PubMed] [Google Scholar]
- Kim KS, Kustu S, Inwood W. 2006. Natural history of transposition in the green alga Chlamydomonas reinhardtii: use of the AMT4 locus as an experimental system. Genetics 173: 2005–2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lau OS, Deng XW. 2012. The photomorphogenic repressors COP1 and DET1: 20 years later. Trends in Plant Science 17: 584–593. [DOI] [PubMed] [Google Scholar]
- McClintock B. 1950. The origin and behavior of mutable loci in maize. Proceedings of the National Academy of Sciences, USA 36: 344–355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McClintock B. 1984. The significance of responses of the genome to challenge. Science 226: 792–801. [DOI] [PubMed] [Google Scholar]
- Minagawa J. 2013. Dynamic reorganization of photosynthetic supercomplexes during environmental acclimation. Frontiers in Plant Science 4: 513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pepper A, Delaney T, Washburn T, Poole D, Chory J. 1994. DET1, a negative regulator of light‐mediated development and gene expression in Arabidopsis, encodes a novel nuclear‐localized protein. Cell 78: 109–116. [DOI] [PubMed] [Google Scholar]
- Petroutsos D, Tokutsu R, Maruyama S, Flori S, Greiner A, Magneschi L, Cusant L, Kottke T, Mittag M, Hegemann P et al. 2016. A blue‐light photoreceptor mediates the feedback regulation of photosynthesis. Nature 537: 563–566. [DOI] [PubMed] [Google Scholar]
- Raingeval M, Leduque B, Baduel P, Edera A, Roux F, Colot V, Quadrana L. 2024. Retrotransposon‐driven environmental regulation of FLC leads to adaptive response to herbicide. Nature Plants 10: 1672–1681. [DOI] [PubMed] [Google Scholar]
- Ruiz‐Sola MA, Flori S, Yuan Y, Villain G, Sanz‐Luque E, Redekop P, Tokutsu R, Kuken A, Tsichla A, Kepesidis G et al. 2023. Light‐independent regulation of algal photoprotection by CO2 availability. Nature Communications 14: 1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Scopa C, Barnada SM, Cicardi ME, Singer M, Trotti D, Trizzino M. 2023. JUN upregulation drives aberrant transposable element mobilization, associated innate immune response, and impaired neurogenesis in Alzheimer's disease. Nature Communications 14: 8021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shaulian E, Karin M. 2002. AP‐1 as a regulator of cell life and death. Nature Cell Biology 4: E131–E136. [DOI] [PubMed] [Google Scholar]
- Slotkin RK, Martienssen R. 2007. Transposable elements and the epigenetic regulation of the genome. Nature Reviews Genetics 8: 272–285. [DOI] [PubMed] [Google Scholar]
- Sueoka N. 1960. Mitotic replication of deoxyribonucleic acid in Chlamydomonas reinhardti . Proceedings of the National Academy of Sciences, USA 46: 83–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takahashi H, Iwai M, Takahashi Y, Minagawa J. 2006. Identification of the mobile light‐harvesting complex II polypeptides for state transitions in Chlamydomonas reinhardtii . Proceedings of the National Academy of Sciences, USA 103: 477–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tokutsu R, Fujimura‐Kamada K, Matsuo T, Yamasaki T, Minagawa J. 2019a. The CONSTANS flowering complex controls the protective response of photosynthesis in the green alga Chlamydomonas . Nature Communications 10: 4099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tokutsu R, Fujimura‐Kamada K, Yamasaki T, Matsuo T, Minagawa J. 2019b. Isolation of photoprotective signal transduction mutants by systematic bioluminescence screening in Chlamydomonas reinhardtii . Scientific Reports 9: 2820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wakabayashi K, Misawa Y, Mochiji S, Kamiya R. 2011. Reduction‐oxidation poise regulates the sign of phototaxis in Chlamydomonas reinhardtii . Proceedings of the National Academy of Sciences, USA 108: 11280–11284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wertz IE, O'Rourke KM, Zhang Z, Dornan D, Arnott D, Deshaies RJ, Dixit VM. 2004. Human De‐etiolated‐1 regulates c‐Jun by assembling a CUL4A ubiquitin ligase. Science 303: 1371–1374. [DOI] [PubMed] [Google Scholar]
- Wilson S, Kim E, Ishii A, Ruban AV, Minagawa J. 2023. Overexpression of LHCSR and PsbS enhance light tolerance in Chlamydomonas reinhardtii . Journal of Photochemistry and Photobiology B 244: 112718. [DOI] [PubMed] [Google Scholar]
- Zeh DW, Zeh JA, Ishida Y. 2009. Transposable elements and an epigenetic basis for punctuated equilibria. BioEssays 31: 715–726. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 Signal transduction pathways involved in nonphotochemical quenching induction in Chlamydomonas reinhardtii.
Fig. S2 Construction of DE‐ETIOLATED1 mutant in the wild‐type background.
Fig. S3 Nonphotochemical quenching of F3 clones of the det1 mutant.
Fig. S4 Mutations in CrCO, NF‐YB, or NF‐YC genes counteract LIGHT‐HARVESTING COMPLEX STRESS RELATED1 protein accumulation in the det1 mutant.
Fig. S5 Genomic PCR analysis of the dos mutants.
Fig. S6 Insertions and excisions of Bill in the det1 dos1 mutant.
Fig. S7 PCR analysis of the NFYB gene in selected single‐colony clones of the det1 dos5 mutant.
Fig. S8 Bill insertions in the CrCO gene in the det1 mutant.
Fig. S9 Conceptual model for the coordinated regulation of stress responses (nonphotochemical quenching) and genome plasticity (transposable element activation) in Chlamydomonas reinhardtii.
Table S1 Primers used in this study.
Table S2 Ratio of high nonphotochemical quenching progeny resulting from genetic crosses among det1 and related mutants (dos1–dos5, crco, nfyb, and nfyc).
Please note: Wiley is not responsible for the content or functionality of any Supporting Information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.
Data Availability Statement
All the data supporting the findings of this study are included within the paper.
