Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Sep 19;124(9):107. doi: 10.1007/s00436-025-08556-3

The genetic diversity of tick species in selected areas of Qinghai Province

Xuelian Chen 1,#, Zhi Li 1,#, Xueyong Zhang 1, Hong Duo 1, Xiuying Shen 1, Yijun Ma 1, Yong Fu 1,✉, Zhihong Guo 1,✉
PMCID: PMC12449365  PMID: 40970977

Abstract

The purpose of this study was to evaluate the genetic diversity of ticks from free-ranging hosts in some areas of Qinghai Province and perform a phylogenetic analysis among different geographical populations, in order to establish a foundation for the prevention and control of ticks and tick-borne diseases in Qinghai Province. In March and April 2024, a total of 935 ticks were collected from goats, yaks, and horses in Jianzha and Haiyan counties. The tick species were identified by taxonomic key and 16S ribosomal RNA (16S rRNA) sequencing, and haplotype analysis, phylogenetic tree construction, and genetic differentiation index were performed using DNASP v.6, Popart, MEGA 11, and Arlequin v.3.5 software. The 935 collected tick samples belonged to three categories: Haemaphysalis spp., including H. qinghaiensis (n = 525) and H. danieli (n = 199); Dermacentor spp., containing D. nuttalli (n = 8) and D. silvarum (n = 201); and Hyalomma marginatum (n = 2), which was first identified in Qinghai Province. Haplotype and nucleotide polymorphism analyses indicated that there were 19 haplotypes in H. danieli, with haplotype H13 as the dominant haplotype (119/199); six haplotypes in D. nuttalli, with H3 and H4 haplotypes as the dominant haplotypes (4/8); and 20 haplotypes in D. silvarum, with H1 as the dominant haplotype (149/201). The genetic differentiation of D. silvarum, H. danieli, and D. nuttalli occurred both within and among populations. The phylogenetic analysis revealed that the tick species obtained from this study formed clades with the corresponding tick populations. These findings show that the tick species in Jianzha and Haiyan in Qinghai Province underwent population expansion and exhibited enhanced genetic diversity, providing a vital basis for understanding the distribution of ticks and tick-borne diseases in Qinghai Province.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00436-025-08556-3.

Keywords: Tick, Qinghai, 16S rRNA, Haplotype, Genetic diversity

Introduction

Studies on the population genetics and evolution of ticks and tick-borne pathogens are becoming more extensive because of the use of next-generation sequencing and big data models. Epidemiological data indicate that the regions with the highest recorded population of ticks in China are the Xinjiang Uygur Autonomous Region, Gansu Province, and Shaanxi Province (Luo et al. 2024). There are two families, six genera, and 31 species of ticks in Qinghai (Monakale et al. 2024). Haemaphysalis qinghaiensis and Dermacentor nuttalli are the dominant tick species in Qinghai Province and are widely distributed in most areas (Nadolny et al. 2024), and D. nuttalli is distributed mainly in the Qinghai Lake area (Ramadan et al. 2024). The main tick species in the Haibei area of Qinghai are D. everestianus, D. silvarum, H. qinghaiensis, and D. nuttalli (Jian et al. 2020). However, Hyalomma marginatum has been reported in only Gansu, Tibet, and Xinjiang to date (Yang et al. 2021).

Owing to its high altitude, cold climate, and reduced oxygen availability, Qinghai Province has a unique natural ecosystem composed of vast grasslands, with pastures accounting for approximately 56.2% of its total area. It is one of the five major pastoral areas in China, accounting for 15% of the national pastoral area (Han et al. 2018). This unique ecological environment creates a favorable environment for the survival of ticks and the transmission of tick-borne pathogens. The identification of tick species, abundance, and distribution in high-altitude areas is very important for understanding the epidemiology and control of tick and tick-borne diseases (TTBD) in Qinghai.

Most tick identification studies are based mainly on morphological characteristics. However, traditional morphological identification requires extensive experience and can be challenging when the specimens are packed together, in the immature stage (larval or nymphal stage), or when the ticks are physically damaged (Taheri et al. 2014; Nava et al. 2009). Previous studies have analyzed the population genetic diversity of H. longicornis in low-altitude areas using mitochondrial nad5 and COI genes and ribosomal 16S rRNA and ITS2 genes (Kim et al. 2021; Kelava et al. 2025). However, no reports on the haplotype diversity, population expansion, or genetic differentiation of ticks parasitizing domestic animals in the Jianzha and Haiyan areas of Qinghai are currently available. Therefore, in view of this current research status, this study explores the geographic distribution, haplotype diversity, population expansion, and genetic differentiation of 1156 ticks collected in the Jianzha and Haiyan areas of Qinghai to further understand the dynamics of the tick population in these areas.

Materials and methods

Sample collection and morphological identification of ticks

As shown in Fig. 1, the ticks were collected from free-ranging yaks, Tibetan sheep, and horses in Haiyan (36.9 N, 100.99 E) in Haibei Tibetan Autonomous Prefecture and in Jianzha (35.94 N, 102.04 E) in Qinghai from March 2024 to April 2024 using tweezers. The obtained tick samples were morphologically identified under a stereomicroscope according to a published taxonomic key (Deng and Jiang 1991; Chen et al. 2010).

Fig. 1.

Fig. 1

Open in a new tab

Distribution map of tick species in the Jianzha and Haiyan areas of Qinghai, generated using ArcGIS v10.8. Here, “0–1,” “2–30,” and “31–200,” and “1–2,” “3–198,” and “199–525” represent the range of the number of tick samples. Left, the distribution map of tick species in Haiyan. Right, the distribution map of tick species in Jianzha. The size of the circles represents the number of ticks

DNA extraction

The collected ticks were washed with phosphate-buffered saline (PBS) and 70% ethanol; then, the genomic DNA was extracted from individual ticks using a Blood & Tissue DNA Kit (QIAGEN, Germany, #69,506) according to the user manual.

Amplification and sequencing of the 16S rRNA gene

A 450-bp fragment of the 16S rRNA gene of ticks was amplified by PCR using the following primers: 16S rRNA F (5′- CTGCTCAATGATTTTTTAAATTGCTGTGG3′) and 16S rRNA R (5′CCGGTCTGAACTCAGATCAAGT3′) (Hao et al. 2025). Polymerase chain reaction (PCR) was performed in a final volume of 25 μL containing 12.5 μL of Premix Taq™ (TaKaRa, Dalian, China, # RR371A), 8.5 µL of RNase-free water (TaKaRa, Dalian, China, #9012), 2 μL of DNA template, and 1 μL each of 16S rRNA F and 16S rRNA R (10 μM/L). The 16S rRNA amplification was performed as follows: After initial denaturation for 1 min at 94 °C, 35 cycles of denaturation for 10 s at 98 °C, annealing for 15 s at 55 °C, and elongation for 45 s at 68 °C were performed, followed by a final extension step at 68 °C for 8 min. Each PCR amplicon was separated on a 1% agarose gel, which was prepared according to the manufacturer’s protocol using Gelstain (10,000×), and the DL2000 DNA marker at a voltage of 120 V, current of 500 A, and 40 min. Gel images were captured using a G-BOX device. The amplicons were subsequently sequenced by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China).

Molecular analysis of the tick 16S rRNA gene

The 16S rRNA sequences of the ticks were manually aligned using DNAMAN version 9 software after bidirectional sequencing. They were then compared with available GenBank data using the NCBI BLASTn program. The best-fitting DNA evolutionary model for phylogenetic inference was subsequently determined using MEGA 11 by MUSCLE. Hence, phylogenetic trees were constructed with 1000 bootstrap iterations using maximum likelihood (ML) methods with the Model-Finder model using PhyloSuite. Amblyomma aureolatum was used as the outgroup.

Genetic polymorphism analysis

The number of tick haplotypes (Np), haplotype diversity (Hd), and nucleotide diversity (Pi) were statistically analyzed using DNA SPv5.0. To evaluate the genetic diversity, a series of neutral tests (including Tajima’s and Fu’s Fs) were applied using DNA SP 5.10, with P < 0.05. The haplotype network diagram of the ticks was constructed using Popart v1.7 software. AMOVA and the genetic differentiation index-Fst of the sequences obtained from the ticks were analyzed using Arlequin v 3.5 software.

Results

Tick molecular identification

PCR revealed that the 16S rRNA gene fragments of the parasitic ticks were 480 bp in length, consistent with the expected size (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Representative 16S rRNA PCR results from tick samples. M, DNA 2000-bp marker; 1–3, H. qinghaiensis from Jianzha; 4–5, H. qinghaiensis from Haiyan; 6–8, H. danieli from Jianzha; 9–10, D. nuttalli from Haiyan; 11–12, D. silvarum from Haiyan; 13–14, Hy. marginatum from Jianzha; 15, negative control: ddH2O; 16, positive control: DNA from D. everestianus maintained in our laboratory

Alignment and analysis using the BLAST tool indicated that the similarities between all the obtained 16S rRNA gene sequences and the corresponding tick gene sequences published in GenBank ranged from 98% to 100%, confirming that the obtained sequences were the target gene sequences. This sequencing identified two Hy. marginatum (2/935, 0.21%), eight D. nuttalli (8/935, 0.86%), 199 H. danieli (199/935, 21.28%), 201 D. silvarum (201/935, 21.50%), and 525 H. qinghaiensis (525/935, 56.15%) samples (Fig. 1).

Analysis of population genetic evolution of the H. danieli 16S rRNA gene

We analyzed 199 16S rRNA gene sequences from parasitic ticks in Jianzha County and Haiyan County, Qinghai Province. A total of 19 haplotypes and 203 polymorphic sites (Table 1) were obtained in Jianzha. H1 accounted for 59.80% (119/199) of all sequences, the highest frequency (Fig. 3A).

Table 1.

The polymorphism statistics of the 16S rRNA gene for different tick species

Fst N S Hap Hd Pi Tajima’s D Fu’s Fs
D. nuttalli 0.88189 Jianzha 2 11 2 1 0.02421 0 3.2581
Haiyan 6 61 4 0.867 0.04229 −1.42313 (P < 0.1) 5.27106
D. silvarum 0.9369 Jianzha 1 - - - - - -
Haiyan 200 154 20 0.463 0.00657 −2.29129 9.06937
H.danieli 0.59813 Jianzha 198 203 19 0.620 0.13109 0.57948 −5.635
Haiyan 1 - - - - - -
Open in a new tab

N, number of sequences; S, number of polymorphic sites; Hap, number of haplotypes; Hd, haplotype diversity; Pi, nucleotide diversity; Tajima’s D, Fu’s Fs statistics

Fig. 3.

Fig. 3

Open in a new tab

The haplotype network of H. danieli (A), D. nuttalli (B), and D. silvarum (C)

The Hd and Pi in Jianzha were 0.620 and 0.13109, respectively (Table 1). Tajima’s neutral test value was 0.57948, and Fu’s Fs value was −5.635 (Table 1). The nucleotide mismatch map shows two single peaks (Fig. 4A). The Fst between the two regions revealed a moderate degree of genetic differentiation in the population (Fst = 0.59813). Moreover, the AMOVA results revealed that the degree of genetic differentiation between the populations was 59.81% (Table 1).

Fig. 4.

Fig. 4

Open in a new tab

Nucleotide mismatch mapping of H. danieli (A), D. nuttalli (B), and D. silvarum (C) based on 16S rRNA

Analysis of the population genetic evolution of D. nuttalli 16S rRNA

A study was conducted using 8 16S rRNA gene sequences of parasitic ticks in Jianzha County and Haiyan County. A total of six haplotypes and 225 polymorphic sites were obtained (Table 1). H3 and H4 accounted for 50% (4/8) of all sequences, with the highest frequency (Fig. 3B).

The Hd and Pi of D. nuttalli from Jianzha were 1 and 0.02421, respectively, and those of D. nuttalli from Haiyan were 0.867 and 0.04229, respectively. Tajima’s neutral test value was −1.42313 (P < 0.1), and Fu’s Fs values of the ticks from Jianzha and Haiyan were 3.2581 and 5.27106, respectively. The nucleotide mismatch map shows multiple obvious single peaks (Fig. 4B), indicating that the population has experienced balanced selection and bottleneck effects. The Fst between the two regions revealed that a large degree of genetic differentiation occurred in the population (Fst = 0.88189). Moreover, the AMOVA results indicated that genetic differentiation existed mainly between the populations (88.19%) (Table 1).

Analysis of population genetic evolution of D. silvarum 16S rRNA genes

A study was conducted using 201 16S rRNA gene sequences of parasitic ticks in Jianzha County and Haiyan County. A total of 18 haplotypes and 228 polymorphic sites (Table 1) were obtained. H1 accounted for 74.13% (149/201) of all sequences, with the highest frequency (Fig. 3C).

The Hd and Pi of D. silvarum were 0.463 and 0.00657, respectively (Table 1). Tajima’s neutral test value is 2.889996 (P < 0.001), and Fu’s Fs value is 65.091 (Table 1). The nucleotide mismatch map shows two single peaks (Fig. 4C). The Fst between the two regions revealed that a moderate degree of genetic differentiation occurred in the population (Fst = 0.59813). In addition, the AMOVA results revealed that the genetic differentiation between the populations was 59.81% (Table 1).

From the GenBank, 10 representative tick 16S rRNA genes were selected in this study to obtain accession numbers. Sequence data were deposited in GenBank under the following accession numbers: PV945981–PV945990. The black circles in Fig. 5 indicate 10 representative tick 16S rRNA genes. Using the Chiplot website, a phylogenetic tree of tick 16S rRNA genes was constructed. The results revealed that the tick species obtained in this study presented different clustering situations. Specifically, JZ-T-137 and JZ-T-2 formed separate branches with JZ-T-1 and JZ-T-117, respectively, whereas the remaining six strains were clustered on the same branch, which was far from the other strains (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Phylogenetic trees of tick species inferred from 17 representative tick 16S rRNA genes selected from GeneBank and the 10 tick 16S rRNA genes identified in this study. Amblyomma aureolatum was used as the outgroup

Discussion

Qinghai Province is a major province in terms of animal husbandry and one of the five major pastoral areas in China. The land use in this province is characterized mostly by semigrazing, which has promoted the ongoing expansion of ticks in livestock (Jimale et al. 2024). Although ticks are widely distributed in Qinghai Province and act as vectors of various human and animal pathogens (Adithya et al. 2024), little is known about the population genetic diversity of ticks in this province. The sequencing of mitochondrial genes and ribosomal genes, such as 16S rRNA, COI, and ITS-2, which are important molecular markers for tick species identification, revealed that the ticks distributed in Qinghai Province belonged to three genera and seven different species, including H. qinghaiensis, H. danieli, D. everestianus, D. abaensis, D. nuttalli, D. silvarum, and Ixodes crenulatus (Han 2018). The main prevalent tick species in the Haibei area of Qinghai are D. everestianus, D. silvarum, H. qinghaiensis, and D. nuttalli (Jian et al. 2020). We found that H. qinghaiensis and D. nuttalli are the dominant tick species in Qinghai Province, consistent with the results of a previous study (Han 2018). The dominant tick species in Jianzha in this study was H. qinghaiensis, and that in Haiyan was dominated mainly by Dermacentor ticks, with high diversity in the above regions. The main tick-borne diseases in Qinghai Province are anaplasmosis, piroplasmosis, rickettsiosis, and Lyme disease. H. qinghaiensis is considered the dominant vector of Anaplasma in goats (Zhang et al. 2024); thus, attention should be given to the prevention and control of anaplasmosis in Jianzha County, Qinghai Province. More importantly, this study is the first to report the presence of Hy. marginatum in Jianzha County, Qinghai Province, which is the known arthropod vector of Crimean–Congo hemorrhagic fever and West Nile, Thogoto, and Dhori viruses (Duscher et al. 2018).

With respect to the 16S rRNA gene, haplotypes H3 and H4 of D. nuttalli, H1 of D. silvarum, and H1 of H. danieli had the highest occurrence frequency. This could have been due to natural selection and environmental changes and if stably inherited haplotypes (Lui et al. 2019) were undergoing range expansion (Chilton et al. 2025). The distribution of these high-frequency haplotypes is linked to host and animal movements (Ferrari et al. 2013). In addition, the results of the analysis of the haplotype diversity of D. nuttalli and D. silvarum revealed that the haplotype diversity in the Haiyan area was greater than that in the Jianzha area, which may be largely related to the ecology and range of the hosts that ticks parasitize, as well as the frequency of local livestock trade (Li and Cheng. 2024; Zając et al. 2024). Populations with high nucleotide diversity and high haplotype diversity in the 16S rRNA gene have high overall genetic diversity. In the evolutionary tree constructed on the basis of the 16S rRNA gene sequence, D. nuttalli (JZ-T-137, JZ-T-2, and HY-T-20) and D. silvarum (HY-T-1) formed a clade with other Dermacentor ticks (Gui et al. 2021). Moreover, H. qinghaiensis (JZ-T-11, JZ-T-1) and H. danieli (JZ-T-117, HY-T-59) clustered with other Haemaphysalis ticks into a branch, consistent with the results of a previous study (Sado Yousseu et al. 2022). In addition, Hy. marginatum (JZ-T-97, JZ-T-272) formed a clade with other Hyalomma ticks, which was consistent with the results of previous studies (Guo et al. 2019). In conclusion, the tick species in Jianzha and Haiyan in Qinghai Province underwent population expansion and genetic diversity, providing insight into the underlying distribution of ticks and tick-borne diseases in Qinghai Province.

Supplementary Information

Below is the link to the electronic supplementary material.

ESM 1 (140.3KB, jpg)

(DOCX 140 JPG)

Author contributions

Conceptualization: X.L.C, Z.L Methodology: X.L.C Formal analysis and investigation: X.Y.Z, H.D, X.Y.S, Y.J.M Original draft preparation: X.L.C Review and editing: Z.L, Y.F, Z.H.G.

Funding

This research was financially supported by the Projects of Key R&D and Program in Qinghai Province (2022-HZ-801) and the Talent and Base Project of the Department of Science and Technology of the Tibet Autonomous Region (XZ202401JD0012).

Data availability

Available from the corresponding author on reasonable request. Sequence data of ticks were deposited in GenBank under accession numbers: PV945981-PV945990.

Ethics approval

This study is approved by the Animal Ethics Committee of Qinghai University (approval NO. PJ202501-102).

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xuelian Chen and Zhi Li contributed equally to this work.

Contributor Information

Yong Fu, Email: qhfuyong@163.com.

Zhihong Guo, Email: 859228082@qq.com.

References

  1. Adithya S, Megha A, Ajith Y, Athira KS, Ettel AM, Sangeetha SG, Jacob SS, Tresamol PV (2024) Characterizing tick diversity among caprine hosts of Kerala, India: a phylogenetic study. Mol Biol Rep 52(1):89. 10.1007/s11033-024-10191-7 [DOI] [PubMed] [Google Scholar]
  2. Chen Z, Yang X, Bu F, Yang X, Yang X, Liu J (2010) Ticks (Acari: Ixodoidea: Argasidae, Ixodidae) of China. Exp Appl Acarol 51(4):393–404. 10.1007/s10493-010-9335-2 [DOI] [PubMed] [Google Scholar]
  3. Chilton NB, Thampy PR, Wolbaum CR, Sterling EE, Thoroughgood JT, Berg ED, Halpin AS, Diyes CP, Yunik MEM, Díaz-Sánchez AA, Rochon K, Lysyk TJ, Dergousoff SJ (2025) Genetic diversity and phylogeographic relationships of Dermacentor variabilis (Acari: Ixodidae) within an established population in southern Manitoba (Canada), and the prevalence of Rickettsia montanensis and Francisella-like endosymbionts. J Med Entomol 62(4):840–850. 10.1093/jme/tjaf010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Deng GF, Jiang ZL (1991) Economic Insect Fauna of China, Fasc 39 Acari: Ixodiate. Science Press, Beijing [Google Scholar]
  5. Duscher GG, Hodžić A, Hufnagl P, Wille-Piazzai W, Schötta AM, Markowicz MA, Estrada-Peña A, Stanek G, Allerberger F (2018) Adult Hyalomma marginatum tick positive for Rickettsia aeschlimannii in Austria, October 2018. Euro Surveill 23(48):1800595. 10.2807/1560-7917.ES.2018.23.48.1800595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Ferrari FA, Goddard J, Caprio M, Paddock CD, Mixson-Hayden T, Varela-Stokes AS (2013) Population analyses of Amblyomma maculatum ticks and Rickettsia parkeri using single-strand conformation polymorphism. Ticks Tick Borne Dis 4(5):439–444. 10.1016/j.ttbdis.2013.04.010 [DOI] [PubMed] [Google Scholar]
  7. Gui Z, Wu L, Cai H, Mu L, Yu JF, Fu SY, Si XY (2021) Genetic diversity analysis of Dermacentor nuttalli within Inner Mongolia, China. Parasit Vectors 14(1):131. 10.1186/s13071-021-04625-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Guo WP, Wang YH, Lu Q, Xu G, Luo Y, Ni X, Zhou EM (2019) Molecular detection of spotted fever group Rickettsiae in hard ticks, Northern China. Transbound Emerg Dis 66(4):1587–1596. 10.1111/tbed.13184 [DOI] [PubMed] [Google Scholar]
  9. Han R (2018) Studies on species diversity of ticks and gene polymorphism of tick-borne pathogens in Qinghai Province. Chinese Academy of Agricultural Sciences, pp 36–38. (in Chinese)
  10. Han R, Yang J, Niu Q, Liu Z, Chen Z, Kan W, Hu G, Liu G, Luo J, Yin H (2018) Molecular prevalence of spotted fever group rickettsiae in ticks from Qinghai Province, Northwestern China. Infect Genet Evol 57:1–7. 10.1016/j.meegid.2017.10.025 [DOI] [PubMed] [Google Scholar]
  11. Hao L, Zhu L, Xiao C, Jike R, Zhou K, Li Y, Jise Q, Wang C, Deng L (2025) Molecular detection of SFGR in ticks collected from yaks in Jiulong County of Sichuan Province, China. Animals 15(7):975. 10.3390/ani15070975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jian Y, Zhang X, Li X et al (2020) Identification of ticks and tick-borne pathogens in different areas of Haibei of Qinghai Province. Chinese Qighai Journal of Animal and Veterinary Sciences 50:35–42 ((in Chinese)) [Google Scholar]
  13. Jimale KA, Zeni V, Ripamonti A, Canale A, Mele M, Benelli G, Otranto D (2024) Grazing system and Hyalomma marginatum tick infestation in cattle with high prevalence of SFG Rickettsia spp. Vet Parasitol Reg Stud Reports 49:100994. 10.1016/j.vprsr.2024.100994 [DOI] [PubMed] [Google Scholar]
  14. Kelava S, Nakao R, Mans BJ, Cho M, Mateo KBT, Apanaskevich DA, Shao R, Gofton AW, Teo EJM, Ito T, Barker D, Barker SC (2025) Are there 16 species of brown dog ticks? Phylogenies from 60 entire mitochondrial genomes and 162 cox1 sequences reveal 16 species-level clades in the Rhipicephalus (Rhipicephalus) sanguineus group. Int J Parasitol 29:S0020–7519(25)00090–6. 10.1016/j.ijpara.2025.04.016 [DOI] [PubMed] [Google Scholar]
  15. Kim YJ, Seo JY, Park JS, Kim SY, Aknazarov B, Atabekova N, Lee HI (2021) Molecular analysis of tick-borne bacterial pathogens from ticks infesting animal hosts in Kyrgyzstan, 2021. Microorganisms 12(6):1046. 10.3390/microorganisms12061046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li Z, Cheng T (2024) Haplotype diversity, genetic differentiation and population expansion of Haemaphysalis longicornis isolated from different districts. Chin Anim Husb Vet Med: 5405–5415. (in Chinese)
  17. Liu T, Feng X, Zhang Y, Liu J, Bao R (2019) Genetic diversity of Haemaphysalis longicornis from China and molecular detection of Rickettsia. Exp Appl Acarol 79(2):221–231. 10.1007/s10493-019-00423-y [DOI] [PubMed] [Google Scholar]
  18. Luo C, Song Y, Xia L, Liu M, Feng H, Xiao L, Xu M, Cai X, Cui J, Xiang R, Yang J, Kan W, Shen Y, Ma Y, Zeng Z, Liu B, Tao Y, Yu H, Sun Y, Wang X, Jiang J (2024) Molecular epidemiological study on tick-borne pathogens in Qinghai Province, Northwest China. Biosaf Health 6(6):361–368. 10.1016/j.bsheal.2024.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Monakale KS, Smith RM, Gaorekwe RM, Ledwaba MB, Malatji DP (2024) Phenotypic and genotypic characterization of ticks and tick-borne pathogens from cattle in selected villages of Greater Letaba Municipality in Limpopo Province, South Africa. Parasitol Res 123(8):292. 10.1007/s00436-024-08311-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Nadolny R, Jones J, Taylor BJ, Bowman L, Harkins K (2024) Effects of permethrin-treated uniforms on tick submissions to a military passive tick surveillance program. J Med Entomol 61(6):1524–1533. 10.1093/jme/tjae111 [DOI] [PubMed] [Google Scholar]
  21. Nava S, Guglielmone AA, Mangold AJ (2009) An overview of systematics and evolution of ticks. Front Biosci (Landmark Ed) 14(8):2857–2877. 10.2741/3418 [DOI] [PubMed] [Google Scholar]
  22. Ramadan RM, Taha NM, Auda HM, Elsamman EM, El-Bahy MM, Salem MA (2024) Molecular and immunological studies on Theileria equi and its vector in Egypt. Exp Appl Acarol. 10.1007/s10493-024-00933-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Sado Yousseu F, Simo Tchetgna H, Kamgang B, Djonabaye D, McCall PJ, Ndip RN, Wondji CS (2022) Infestation rates, seasonal distribution, and genetic diversity of ixodid ticks from livestock of various origins in two markets of Yaoundé, Cameroon. Med Vet Entomol 36(3):283–300. 10.1111/mve.12589 [DOI] [PubMed] [Google Scholar]
  24. Taheri M, Nabian S, Ranjbar M, Mazaheri Nezhad R, Gerami Sadeghian A, Sazmand A (2014) Study of vitellogenin in Boophilus annulatus tick larvae and its immunological aspects. Trop Biomed 31(3):398–405 [PubMed] [Google Scholar]
  25. Yang Y, Tong J, Ruan H, Yang M, Sang C, Liu G, Hazihan W, Xu B, Hornok S, Rizabek K, Gulzhan K, Liu Z, Wang Y (2021) Genetic diversity of hard ticks (Acari: Ixodidae) in the south and east regions of Kazakhstan and northwestern China. Korean J Parasitol 59(1):103–108. 10.3347/kjp.2021.59.1.103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Zając Z, Kulisz J, Woźniak A, Obregón D, Foucault-Simonin A, Bartosik K, Moutailler S, Cabezas-Cruz A (2024) Spatial distribution and pathogen profile of Dermacentor reticulatus ticks in southeastern Poland: a genetic and environmental analysis. Transbound Emerg Dis 24:5458278. 10.1155/2024/5458278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Zhang Y, Cheng TY, Liu GH, Liu L, Duan DY (2024) Metagenome reveals the midgut microbial community of Haemaphysalis qinghaiensis ticks collected from yaks and Tibetan sheep. Parasit Vectors 17(1):370. 10.1186/s13071-024-06442-y [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ESM 1 (140.3KB, jpg)

(DOCX 140 JPG)

Data Availability Statement

Available from the corresponding author on reasonable request. Sequence data of ticks were deposited in GenBank under accession numbers: PV945981-PV945990.

Articles from Parasitology Research are provided here courtesy of Springer

RESOURCES