First surveillance study of avian orthoavulavirus type 1 in wild birds in Morocco: Insights and implications for future monitoring

Abstract

Background:

Wild birds, particularly migratory species, can act as natural reservoirs and vectors of avian orthoavulavirus type 1 (AOAV-1) or Newcastle disease virus (NDV), contributing to its spread across regions and potentially threatening domestic poultry populations. AOAV-1, also known as NDV, is a major pathogen affecting avian species and poses a global threat to poultry production. It belongs to the Paramyxoviridae family and is an RNA virus encoding six key proteins, including the fusion (F) protein, which determines pathogenicity. AOAV-1 is classified into three pathotypes based on virulence: velogenic (highly pathogenic), mesogenic (moderately pathogenic), and lentogenic (mild or asymptomatic). In Morocco, AOAV-1 is endemic in poultry production systems, as evidenced by recent studies reporting a 52.1% seroprevalence and active viral RNA detection in backyard chickens in the Khemisset and Skhirat-Temara provinces; however, effective vaccination strategies have contributed to controlling the clinical signs and widespread dissemination of the virus.

Aim:

The main objective of this study was to investigate the presence of AOAV-1 in wild bird populations across Morocco, providing insights into possible transmission of infection affecting domestic poultry.

Methods:

From November 2016 to April 2022, a total of 1984 samples were collected from 840 individual birds, encompassing 79 species, 25 families, and 12 orders. The majority of the samples belonged to Charadriiformes, Anseriformes, Pelecaniformes, and Passeriformes. Sampling was conducted at 17 wetlands and six additional locations throughout Morocco. Viral detection was performed using real-time reverse transcriptase PCR (RT-qPCR) targeting Matrix (M) and RNA polymerase (L) genes to confirm the presence of AOAV-1.

Results:

Although the study spanned 6 years and included a large number of samples from bird orders considered primary AOAV-1 reservoirs, all samples tested negative for NDV RNA using both M and L gene targets.

Conclusion:

This study represents the first effort in Morocco to monitor wild birds for AOAV-1. The samples analyzed were initially collected for avian influenza surveillance, which shares epidemiological similarities with Newcastle’s disease. However, to improve future surveillance efforts, sample collection should be optimized to target scenarios with the highest probability of virus detection.

Introduction

Avian orthoavulavirus type 1 (AOAV-1), also known as Newcastle disease virus (NDV), is a globally significant avian pathogen that affects a broad spectrum of bird species (Paldurai et al., 2014). The virus poses a major threat to the health and productivity of poultry, with outbreaks causing severe economic losses in the poultry industry worldwide. Classified within the Paramyxoviridae family, AOAV-1 is an enveloped, negative-sense, single-stranded RNA virus with a genome encoding six structural proteins, among which the fusion (F) protein plays a critical role in determining virulence.

Although all NDV strains belong to a single serotype, they exhibit considerable genetic diversity. Based on the complete fusion (F) gene sequence, AOAV-1 is divided into two major classes: Class I and Class II, with the latter containing the majority of virulent strains. Over 20 genotypes have been identified within Class II, highlighting the ongoing evolution of the virus under surveillance pressure and host adaptation. AOAV-1 is highly contagious and has been reported in more than 250 avian species, including domestic and wild birds, as well as reptiles and humans (Ul-Rahman et al., 2022). Domestic poultry is the primary reservoir of virulent strains, whereas wild birds, including sparrows, crows, and waterfowl, are often carriers of variants. However, virus reassortment among wild birds poses a high risk to new avian host species and domestic poultry populations as some viruses pose a threat when introduced to new healthy geographic areas and host species (Bansal et al., 2022). Waterfowl, in particular, are considered natural reservoirs of avian paramyxovirus type 1, playing a central role in viral persistence and dissemination, aided by their migratory behavior and use of shared wetlands (Liu et al., 2009; Aziz-ul-Rahman and Shabbir, 2018; Goraichuk et al., 2023). Afro-tropical resident and migratory Eurasian waterbirds contribute to the high concentration of waterbirds residing in North African wetlands from March to May (Cappelle et al., 2015).

Newcastle disease continues to pose a serious threat to poultry farming in Morocco, where outbreaks caused by virulent strains of AOAV-1 have been recorded in both commercial operations and backyard flocks. These incidents have resulted in notable economic losses, primarily due to high mortality rates and decreased productivity (Fellahi et al., 2019). Considering the recurring nature of these outbreaks, it’s reasonable to explore the role that wild birds might play in the virus’s spread or persistence. Research from nearby regions and other parts of the world has shown that migratory birds can carry AOAV-1 over long distances, including strains with varying levels of virulence (Diel et al., 2012; Snoeck et al., 2013). Because Morocco lies along major migratory routes, this geographic factor adds weight to the idea that wild birds could be part of the transmission cycle, making them a relevant target for ongoing surveillance efforts.

The choice of study sites was based on their ecological and epidemiological relevance. These wetlands, many of which are internationally recognized under the RAMSAR Convention, serve as key gathering points for migratory and resident bird species. They are also located near areas of high poultry density, particularly in regions like Gharb, Doukkala, and Souss-Massa. Previous investigations have highlighted the persistent presence of the NDV in these zones. For instance, virulent NDV strains have been identified in poultry flocks from the Gharb and Doukkala regions (Harrak et al., 2013). More recently, Fagrach et al. (2023) reported high seroprevalence of NDV in backyard chickens from Khemisset and Skhirat-Temara. These findings suggest the potential involvement of wild birds in the local epidemiology of NDV and provide strong justification for surveillance efforts focused on wetland habitats near poultry operations.

This study represents the first extensive surveillance effort for AOAV-1 in wild birds in Morocco. By sampling a broad diversity of avian species, particularly waterfowl and shorebirds, and employing sensitive molecular detection techniques, we assessed the circulation of AOAV-1 and evaluated the potential role of wild birds in regional epidemiology.

Materials and Methods

Study overview

Between November 2016 and April 2022, we collected an extensive collection of wild birds from 17 wetland and ornithological sites across Morocco. This effort also included routine surveillance collections. Sampling sites were strategically selected near wetlands close to poultry farm clusters.

The study targeted bird orders known to serve as significant reservoirs for NDV, specifically migratory waterfowl and terrestrial birds, such as Anseriformes, Charadriiformes, Pelecaniformes, and Passeriformes (Table 1). Sampling was performed based on the relative abundances of these species within the chosen wetlands and the accessibility of each site. In other words, bird species observed at higher numbers were prioritized to maximize the likelihood of detecting AOAV-1, particularly in species recognized as potential reservoirs of the virus.

Table 1. Number of sampled birds by order and family.

Orders	Family	Numbers of sampled birds
Accipitriformes	Accipitridae 1 specie 1 bird	1
Anseriformes	Anatidae: 16 species, 165 birds	165
Charadriiformes	Charadriidae: 8 species and 18 birds	18
Charadriiformes	Haematopodidae: 2 species, 3 birds	3
Charadriiformes	Laridae: 16 species, 110 birds	110
Charadriiformes	Podicipedidae: 1 sp. 3 birds	3
Charadriiformes	Recurvirostridae: 5 species (48 birds)	48
Charadriiformes	Scolopacidae: 29 species (74 birds)	74
Ciconiiformes	Ciconiidae 1 specie 2 birds	2
Falconiformes	Falconidae 1 specie 37 Birds	37
Gruiformes	Rallidae: 7 Species 44 Birds	44
Passeriformes	Buphagidae 1 specie 4 birds	4
Passeriformes	Corvidae 2 species and 25 birds	25
Passeriformes	Laniidae 1 specie 1 bird	1
Passeriformes	Muscicapidae 2 species and 6 birds	6
Passeriformes	Passeridae 1 species 28 birds	28
Passeriformes	Phylloscopidae 2 species in 4 birds	4
Passeriformes	Sylviidae 1 specie 1 bird	1
Pelecaniformes	Ardeidae: 11 species, 174 birds	174
Pelecaniformes	Threskiornithidae: 5 species (25 birds)	25
Phoenicopteriformes	Phoenicopteridae 2	2
Podicipediformes	Podicipedidae 1 specie 1 bird	1
Suliformes	Phalacrocoracidae: 6 species and 27 birds	27
Suliformes	Phalacrocorax carbo 1 (Phalacrocorax)	1

Field sampling operations were managed in collaboration with the national forestry department (Department of Waters and Forestry), national veterinary services, and local ornithological teams. The majority of sample collection occurred during the cooler months (autumn to spring).

Specifically, between October and April of each year, coinciding with autumn and spring migratory periods when bird presence and diversity are at their highest. These partnerships ensured proper site access, bird identification, and adherence to ethical sampling protocols.

Study sites

Sampling sites were selected based on a combination of ecological importance and proximity to poultry farms. A total of 17 wetlands and six other sites were included in the study, chosen because they are major bird habitats, located close to intensive poultry production areas, and designated as RAMSAR wetlands, which underscore their conservation value (Fig. 1). Bird sampling took place between October and April, which coincided with the seasonal presence of migratory and overwintering species. The species that were sampled were those most commonly encountered at each site during fieldwork. Although certain known reservoir species such as pigeons and crows were not heavily represented, this was due to their low numbers at the selected locations rather than deliberate exclusion. This approach ensured that the study captured relevant ecological interactions while maintaining ethical and practical field standards.

Fig. 1. Fig. 1. Sampling sites.

Sample collection

We collected samples from 804 live birds captured using mist nets, using cloacal and tracheal swabs. Alongside the sampling of live birds, this study also included dead individuals to improve the chances of detecting AOAV-1, especially in cases in which infection may have played a role in mortality. These birds were not part of any captive group; rather, they were either discovered during field visits or brought to attention by local conservation staff working near the wetland sites. To ensure sample quality, only birds that were freshly dead and in suitable condition for testing were included. Tissue samples were collected from multiple organs, including the trachea, lungs, liver, spleen, heart, intestines, and brain, to increase the likelihood of identifying systemic infections. Although external signs and organ appearance were noted, full postmortem examinations and microscopic analysis were not conducted due to the practical constraints of working in the field.

Additionally, 54 fresh fecal samples were obtained from a resident cattle egret colony, a population in constant contact with migratory birds, located in proximity to poultry farms. Fecal samples were collected using sterile cotton swabs and individually placed into sterile bags to avoid cross-contamination, ensuring the integrity of each sample for downstream molecular analysis.

At the time of collection, bird carcasses, tracheal and cloacal swabs in transport medium from live birds and fecal samples were immediately sent to the laboratory at a temperature of 4°C–8°C for a maximum of 24 hours. The samples were transported under refrigerated conditions, and they were processed rapidly on arrival. Samples from dead birds included tracheal and cloacal swabs, along with organ tissues (trachea, lungs, liver, spleen, heart, intestines, and brain) following World Organization for Animal Health (WOAH) guidelines. (WOAH, 2021). In total, 1984 samples were analyzed, comprising 230 pooled organ samples from 480 wild birds, 54 fecal samples, 860 cloacal swabs, and 840 tracheal swabs.

Sample processing

Fecal and organ samples were mixed with 1 ml of phosphate-buffered saline (PBS; pH 7.4 ± 0.2) supplemented with 10,000 IU/ml penicillin, 10 mg/ml streptomycin, 0.25 mg/ml gentamycin, and 5,000 IU/ ml nystatin, followed by a 2-hour incubation (Yamazaki et al., 2019).To process the samples, they were placed in sterile tubes containing stainless steel beads and homogenized at 3,000 × g for 3 minutes using a Bead Blaster 24 Homogenizer (Benchmark Scientific, Sayreville, NJ, USA). The homogenized material and swab fluids were then centrifuged at 15,000 × g for 3 minutes to eliminate debris. The resulting supernatants were stored at –80°C until further analysis.

RNA extraction

RNA was isolated directly from the supernatants of individual and pooled organ samples using a NucleoSpin® RNA Virus Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. RT-qPCR

Two primer and probe designs were used to amplify AOAV-1 target genes: one targeting the M gene (Wise et al., 2004) and another targeting the L gene (Sutton et al., 2019). The complete nucleotide sequences of all primers and probes are presented in Table 2.

Table 2. Nucleotide sequence used for the investigation.

Gene	Nucleotide sequence (5’-3’)	Position (bp)
M-For	AGT-GAT-GTG-CTC-GGA-CCT-TC	121
M-Rev	CCT-GAG-GAG-AGG-CAT-TTG-CTA
M-Probe	[HEX]GGG-ACR-GCH-TGC-TAT-CC[BHQ3]
L-For	GAGCTAATGAACATTCTTTC	12,611–1,263
L-Rev	AATAGGCGGACCACATCTG	12,753–12,771
L-Probe	[FAM]CCAATCAACTTCCC[MGB]	12,641–12,654
L-Probe	[VIC]AATAGTGTATGACAACAC[MGB]	12,706–12,723

The M and L genes of AOAV-1 were screened using real-time RT-PCR. The reaction setup for M was performed using a Quantitect Multiplex Kit (Qiagen, Germany). In the total volume of 25 µl reactions, 5 µl of RNA template, 12.5 µl of 2 × RT-PCR buffer, 1 µl of each Primer (10 pmol), 0.8 µl of probe (10 pmol), 0.2 µl of 25 × Enzyme Mix and 4.5 µl of RNase-free water were added, where 2 first components were containing reaction buffers. Reverse transcription was performed at a temperature of 50°C during 20 minutes, initial denaturation was set at 95°C during 15 minutes. C-DNA was amplified during 45 cycles with the first stage at 94°C for 45 seconds and the second stage at 60°C for 45 seconds; data collection was done during the second stage. To amplify gene L, the same protocol using spectrophotometry and internal control genes to confirm RNA integrity and minimize the risk of false- negative results. as the one used by EURL for AI and ND was followed, using 25 µl as total volume with 5 µl of RNA template, 12.5 µl of 2 × Quantitect Multiplex RT-PCR buffer, 1 µl of both primers (12.5 µM), 1 µl of each probe (5 µM), and 0.25 µl of the Quantitect Multiplex RT-Mix. Reverse transcription was performed at 50°C for 20 minutes and 95°C for 15 minutes to initially denature cDNA. Collection data were recorded while cDNA underwent 40 cycles of amplification at 94°C for 45 seconds, and 50°C for 45 seconds. PCR assays were performed with the positive reference strains given by the Avian Influenza and Newcastle Disease reference WOAH laboratory Instituto Zooprofilattico Sperimentale delle Venezie (IZSVe), which is located at the Instituto Zooprofilattico Sperimentale delle Venezie, as well as negative controls to ensure proper amplification accuracy (Table 3). The accuracy of the RNA extraction process was also validated through spectrophotometry with the aid of internal control genes, which enabled RNA verification and removal of false negatives.

Table 3.

List of strains	Genotype/Serotype
KX881510 Moroccan strain	Genotype IV
APMV-1/chicken/ california/18-016505-1/2018	Genotype V
APMV-1/pigeon/ italy/19vir8321/2019	Genotype VI
APMV1/Bulgaria/1262-2/19	Genotype VII
APMV-1/pigeon/ cyprus/20VIR3543-9/2020	Genotype XXI
NDV/chicken/Rus/krasnodor/9.1/19	Genotype VII
LASOTA	Genotype I

To ensure the accuracy of amplification, PCR assays included positive reference strains provided by the IZSVe, an official WOAH reference laboratory for Avian Influenza and Newcastle Disease (Table 3). Negative controls were included in each run to verify specificity and prevent contamination. Additionally, RNA extraction quality was assessed

Results

Between November 2016 and April 2022, we collected 1,984 samples from 840 individual birds across 17 wetlands and six additional locations, belonging to the following orders:Anseriformes (22%), Charadriiformes (32%), Pelecaniformes (24%), Passeriformes (8%), Gruiformes (5%), Falconiformes (4.4%), Suliformes (3%), Phoenicopteriformes, Podicipediformes et Ciconiformes (0.2%), and 10 other unclassified bird species. The samples included 230 organ pools, including the trachea, lung, liver, spleen, heart, intestine, and brain; 54 fecal samples; 860 cloacal swabs840 tracheal swabs. Despite a 6-year surveillance period and a high number of samples, including key bird orders considered reservoirs, all samples tested negative for NDV RNA (M and L genes).

These six sites included Oued Massa, Dayet Aoua, Tantan, Laâyoune, Smir, and Kenitra, and have been represented in the updated map figure to illustrate geographic coverage. Pooled organ samples were created by grouping organs from the same bird to streamline processing while maintaining diagnostic reliability.

These birds were tested for Avian Influenza, and rRT- PCR assays detected the virus in 2 out of 374 cloacal swabs (0.5%), 6 out of 54 fecal samples (11.1%), and 10 out of 218 organ pools (4.6%) (El Mellouli et al., 2022).

Discussion

This study is the first national attempt in Morocco to investigate the presence of AOAV-1 in wild bird populations using molecular tools. Over 6 years, we collected and analyzed 1984 samples from 840 birds representing a wide range of habitats and bird groups. We also chose to include carcasses in our sampling to increase the likelihood of detecting the virus, particularly in species that may be more prone to clinical infection. Although none of the birds tested positive for AOAV-1 RNA, postmortem sampling remains valuable for detecting infections that might be missed in live birds. Examining tissues from recently deceased birds can reveal infections that might go undetected by swab testing alone. This approach has been effective in other regions: in Russia, researchers recovered both vaccine-derived and virulent strains from dead wild birds (Guseva et al., 2023); in Brazil, Pereira et al. (2022) detected virulent AOAV-1 in pigeons showing neurological signs. Similarly, a surveillance program in Nigeria identified AOAV-1 in a migratory bird during avian influenza monitoring (Meseko and Moses, 2012). Despite the inability to perform full necropsies due to field constraithe inclusion ofuding carcasses allowed for a comprehensive sample set. Sampling sites were chosen based on their ecological relevance and their closeness to poultry production areas, rather than confirmed outbreak records at each location. However, research shows that the regions we focused on, such as Doukkala, Gharb, Khemisset, and Skhirat-Temara, have reported cases of Newcastle disease in domestic flocks (Harrak et al., 2013; Fagrach et al., 2023). These findings reinforce the appropriateness of site selection. Access to more detailed outbreak data will help refine future surveillance strategies, and we recommend its inclusion in upcoming studies.

Despite comprehensive sampling, none of the samples tested positive for AOAV-1 RNA by RT-qPCR. This finding aligns with a similar surveillance study conducted in Switzerland, which also reported no detection of AOAV-1 RNA in wild bird populations (Camenisch et al., 2008). Both studies used RT-qPCR methods over extended periods and targeted ecologically similar taxa, particularly migratory waterfowl. Consistent results across different geographic regions suggest that the absence or low prevalence of AOAV-1 in seemingly healthy wild birds may be a widespread trend influenced by factors such as migratory behavior, host-pathogen dynamics, and biosecurity measures in poultry farming that reduce spillover risks.

Nevertheless, other studies have demonstrated that antibodies against NDV are present in a variety of wild bird species, indicating that previous exposure to the virus occurred through natural infection (Schelling et al., 1999; Pfitzer et al., 2000; Stenzel et al., 2008; Paștiu et al., 2016). Since our study did not include serological testing and found no molecular evidence, no conclusions can be drawn regarding AOAV-1 circulation in the sampled populations. The importance of this connection will be vital when comparing molecular results with future serological analyses.

The lack of AOAV-1 detection in wild birds across Morocco suggests that the virus was not present in the sampled individuals at the time of collection. However, this does not rule out the possibility of past or low-level infection, especially given potential sampling, timing, and detection sensitivity limitations. This finding is consistent with studies suggesting that certain wild bird orders, particularly Anseriformes and Charadriiformes, may serve as reservoirs for NDV (Ayala et al., 2016; Dimitrov et al., 2016). However, the presence of a virus, however, is determined by many factors, including, but not limited to, geographic area, seasonality, and weather conditions (Miller et al., 2015).

Although vaccination programs for Moroccan poultry farming have helped reduce the clinical severity of Newcastle disease outbreaks, the use of live attenuated vaccines raises important concerns regarding environmental shedding and virus transmission. While these vaccines are effective in preventing disease, they can still replicate in the host and be excreted into the environment, where they may come into contact with wild birds. Studies have shown that such spillback events are possible, with vaccine-derived strains being recovered from wild avian species. For instance, in southern China, multiple NDV strains isolated from wild birds were genetically similar to poultry vaccine strains, suggesting transmission from domestic to wild populations (Xiang et al., 2017). Similarly, Devlin et al. (2016) highlighted that attenuated vaccine strains, including those used for Newcastle disease, can spread to wild birds and potentially contribute to viral evolution and new disease dynamics (Devlin et al., 2016). Although our study did not detect AOAV-1 in any wild bird samples, including those from carcasses, the potential for spillback remains a concern. Without F gene sequencing, we cannot rule out undetected vaccine-like or low-virulence strains. This underscores the importance of incorporating full genomic characterization in future surveillance to better monitor potential transmission between domestic and wild avian hosts.

Furthermore, the sampling strategy in this study was primarily designed for avian influenza surveillance, and it typically emphasized Anseriformes, particularly dabbling ducks such as Anas platyrhynchos and Anas crecca. However, the host ecology of NDV differs from that of avian influenza viruses. NDV was more frequently detected in Columbiformes (e.g., Columba livia), cormorants (Phalacrocorax spp.), and some Galliformes, which may have been underrepresented in the current sampling effort. These species are often found near poultry operations or urban environments and have been implicated in NDV maintenance and transmission. A more targeted approach that includes these taxa could improve the sensitivity of NDV detection in future surveillance efforts (Douglas et al., 2007).

Future studies should incorporate targeted sampling efforts, including serological testing to detect past NDV exposure, and should prioritize regions with a history of NDV outbreaks. Additionally, AOAV-1- infected birds typically shed the virus for a limited period, generally 7–14 days post-infection depending on the viral strain and host species, which may explain the absence of detection in our samples. This relatively narrow diagnostic window poses a significant challenge for field surveillance using RT-qPCR, particularly when sampling is opportunistic or nonrepetitive. Given the sporadic nature of viral shedding, even actively infected birds may yield false-negative results if sampled outside this brief period. Combined with our study’s focus on apparently healthy individuals and the absence of longitudinal sampling, this limitation may partly explain the lack of virus detection.

Serological tests, such as ELISA or the hemagglutination inhibition (HI) assay, can detect prior exposure to viruses, even when they are no longer detectable. Studies have shown that wild birds often carry antibodies to the Newcastle disease virus without showing clinical signs, indicating silent circulation within these populations (Paştiu et al., 2016; Inuwa et al., 2023). However, incorporating serology into our study was not feasible due to practical constraints, such as the invasive nature of blood collection from wild birds, particularly smaller or protected species, and the lack of validation of commonly used serological tests for wild species. Despite these challenges, combining molecular and serological methods would be ideal for elucidating long-term exposure trends in wild bird populations.

The samples analyzed in this study came from various locations, many of which were initially collected as part of avian influenza surveillance efforts. Both viruses share ecological niches and can be transmitted via similar routes, especially in wild bird populations that interact with domestic poultry. Although no co-infections were detected in our dataset, previous studies, such as that by Musa et al. (2020), documented co-infections in both wild and domestic birds, highlighting the importance of a dual-pathogen surveillance approach. In regions like Morocco, where migratory flyways and poultry farming overlap, testing for both viruses is crucial. This methodology also provides a foundation for future studies exploring the interactions between avian viruses at the wildlife- livestock interface.

In addition, several authors have proposed that the passive surveillance systems currently in place for avian influenza should be extended to include NDV (Guberti and Newman, 2009; Günther et al., 2023). Throughout our research, we sampled the major wild bird orders known to play a role in virus transmission, including Anseriformes, Pelecaniformes, Charadriiformes, and Passeriformes (Guberti and Newman, 2009). Migratory birds cover large distances across continents and are often considered potential carriers of various avian viruses, includingAOAV-1. Their movements through regions with varying levels of virus circulation can influence both the introduction and spread of pathogens. In our study, although we did not track the migratory paths of individual birds, sampling was carried out in key wetland sites along Morocco’s Atlantic and Mediterranean coasts, which are well-known as resting and wintering habitats for a wide range of Palearctic species. Several investigations in other parts of the world have reported the presence of the Newcastle disease virus in migratory birds. For example, work conducted in India found both low- and intermediate- virulence NDV strains in wild and migratory birds (Bansal et al., 2022), whereas in Nigeria, virus isolation from wild birds during surveillance efforts confirmed their involvement in potential transmission routes (Meseko and Moses, 2012). Research from Siberia and Alaska has also shown that migratory waterfowl can carry virulent strains, highlighting their role in maintaining and possibly transporting the virus over long distances (Takakuwa et al., 1998). The lack of AOAV-1 detection in our samples could be due to the virus’s low prevalence in the birds’ regions of origin or its clearance prior to sampling. These factors highlight the importance of integrating ecological data on bird migration with pathogen surveillance to gain a clearer understanding of virus movements across borders.

Nevertheless, future monitoring should aim to target samples with the highest probability of virus detection to maximize effectiveness. In addition to species selection, other epidemiological factors should be taken into account when studying NDV in wild birds (Cappelle et al., 2015). These include age because higher prevalence has been observed in juvenile birds and the seasonality of sampling, with prevalence shown to decrease from September to December (Lindh et al., 2012). This study employed RT-qPCR assays targeting the M (matrix) and L (polymerase) genes to detect AOAV-1 in wild bird samples. These genes were selected due to their high sequence conservation across the AOAV-1 genotypes, making them suitable for broad-range detection, especially in surveillance settings where strain variability is unknown. The M gene, in particular, is commonly used for routine diagnostics and has been shown to offer strong sensitivity in both conventional and real-time PCR formats (Rahman et al., 2017), whereas the L gene adds robustness for confirmatory testing and molecular characterization. However, we acknowledge that the fusion (F) gene, especially the sequence at its cleavage site, is essential for determining virulence and pathotype, which is a limitation of the present study. F gene-based assays can differentiate between velogenic, mesogenic, and lentogenic strains, offering critical epidemiological insights (Nanthakumar et al., 2000); however, our focus was on general virus detection rather than strain typing. It remains possible that low-virulence strains or those with mutations affecting M or L gene primer binding may have gone undetected. Future studies should include F gene analysis to assess strain-specific risks and improve our understanding of AOAV-1 circulation patterns. Although the M and L gene primer sets were designed to detect a wide range of NDV genotypes and have been validated in wild bird samples, they were originally optimized for virus detection in chickens. Consequently, their ability to detect all NDV genotypes circulating in wildlife may be limited, and their sensitivity could vary across bird species (Kim et al., 2008; Ferreira and Suarez, 2019). Given these constraints and the expected low overall prevalence of the virus, negative results should be interpreted with caution. Nonetheless, this method remains a valuable tool for epidemiological surveillance due to its rapid processing, ease of sample collection, and suitability for large-scale screening.

Despite the limited data from North Africa, several studies conducted in West Africa, Egypt, and South Africa have reported the presence of both virulent and avirulent strains of NDV in wild birds. However, these studies did not confirm the involvement of wild birds in the transmission of virulent strains within the region (Snoeck et al., 2013; Megahed et al., 2020; Mohammed et al., 2020).

Worldwide, many studies have considered wild birds to be carriers of low-virulence NDV strains. However, experimental evidence has shown that a nonpathogenic NDV isolate from wild waterfowl can become highly pathogenic after several passages in chickens (Shengqing et al., 2002).

To strengthen NDV surveillance at the wild–domestic bird interface, environmental sampling of water and soil at wetlands frequented by wild birds could serve as a complementary approach to direct avian testing, particularly in regions with limited access to bird capture (Dimitrov et al., 2016).

This study represents one of the earliest attempts to monitor NDV in wild birds in Morocco using both active and passive surveillance techniques. Based on these findings, NDV monitoring programmes should be revised to improve the detection capacity. Future surveillance efforts should aim to clarify the circulation of the virus among wild birds through comprehensive serological studies. In addition, high-risk areas where NDV has been reported in poultry should be prioritized to better estimate potential transmission routes. Environmental monitoring, particularly analysis of water and soil samples from wetlands frequented by wild birds, can help identify sites of viral persistence. Furthermore, the identification and characterization of low-prevalence NDV strains in wildlife will benefit from next-generation sequencing methods. These enhancements will improve early virus detection, support risk assessment and strengthen control strategies to prevent NDV spillover into poultry farms.

Conclusion

This study represents the first effort in Morocco to monitor wild birds for AOAV-1. To improve future surveillance efforts, sample collection should be optimized to target scenarios with the highest probability of virus detection, including high-risk species, seasons, and sites where interaction between wild birds and poultry is most likely.

Supplementary Table 1. Number of sampled birds by order, family, and species, number of positive birds, date of sampling, and origin.

Ordre	Famille	Species	Date	Location
		Bécassine Gallinago stenura, 4	2021/1	SV Larache
			2022/3	SV Larache
		Chevalier gambette Tringa totanus, 3	2021/2	Sv/El Jadida
			2022/1	Sv/El Jadida
		Little stint (Calidris minuta), 3	2021/3	Oriental/2 , Eljadida/1,
		Gallinago stenura, 3	2022/3	Tanger
		Calidris alpina,3	2022/3	Eljadida
		Sandpiper (Calidris spp), 3	2021/3	Oriental/2, Kenitra/1
		Calidris alba, 2	2022/2	Eljadida
		Bécasseau variable Calidris alpina, 3	2022/3	Sv/El Jadida
		Tringa nebularia, 2	2017/2	Khmiss sahel-Marais du Bas Loukoss/1, Complexe de Sidi Moussa / Oualidia/1
		Common greenshank (Tringa nebularia), 2	2021/2	Larache
		Gallinago gallinago, 1	2017/1	Complexe de Sidi Moussa/Oualidia
		Actitis hypoleucos, 1	2017/1	Khmiss sahel-Marais du Bas Loukoss,
		Becasseau sanderling Calidris alba, 1	2022/1	Sv/El Jadida
		Tournepierre is a collier named Arenaria interpres.1	2021/1	Sv/El jadida
		Becasseau minute Calidris minuta,1	2021/1	Sv/El jadida
		philomachus pugnax, 1	2017/1	Complexe de Sidi Moussa/Oualidia
		Redshank (Tringa totanus), 1	2021/1	Eljadida
		Numenius phaeopus, 1	2017/1	Khmiss sahel-Marais du Bas Loukoss,
		Calidris pusilla, 1	2017/1	Khmiss sahel- Marais du Bas Loukoss,
		Ruddy Turnstone (Arenaria interpres), 1	2021/1	Eljadida
		Harlequin knight (Tringa erythropus), 1	2021/1	Eljadida
		Actitis macularius, 1	2017/1	Khmiss sahel- Marais du Bas Loukoss,
		Tringa nebularia, 2	2017/2	Khmiss sahel- Marais du Bas Loukoss/1, Complexe de Sidi Moussa / Oualidia/1
		Numenius arquata, 1	2017/1	Khmiss sahel- Marais du Bas Loukoss,
		Calidri alpina, 1	2022/1	Sv/El Jadida
	Recurvirostridae: 5	Echasse Blanche Himantopus himantopus, 20	2021/3	Sv/El jadida
	species (48 birds)
			2022/17	Agadir/3 , Sv/EL Jadida/14
		Himantopus himantopus, 11	2016/6	Barrage de Smir/2, Complexe de Sidi Moussa /
				Oualidia/2, Khmiss sahel- Marais du Bas Loukoss/2
			2017/5	Barrage de Smir/2, Complexe de Sidi Moussa /
				Oualidia/1, Khmiss sahel- Marais du Bas Loukoss/1,
				Merja Zerga/1
		Black-winged stilt (Himantopus himantopus), 11	2021/11	Agadir/1, Eljadida/5, Larache/1, Oriental/4
		Pied avocet (Recurvirostra avosetta), 4	2021/4	Oriental
		Recurvirostra avosetta, 2	2017/1	Merja Zerga
			2022/1	Eljadida
	Charadriidae: 8	Small Gravelot (Charadrius dubius), 6	2021/6	Oriental/5, Eljadida/1
	species and 18 birds	Pluvialis apricaria, 3	2017/3	Lagune de marchika: The song is based on a musical piece.
		Pluvialis squatarola, 4	2017/4	Khmiss sahel- Marais du Bas Loukoss/2, Merja
				Zerga/2
		Charadrius alexandrines, 1	2017/1	Merja Zerga
		Charadrius hiaticula, 1	2017/1	Complexe de Sidi Moussa/Oualidia
		Gray plover (Pluvialis squatarola), 1	2021/1	Eljadida
		Pluvialis apricaria, 1	2016/1	Lagune de marchika: The song is based on a musical
				piece.
		Vanellus vanellus, 1	2017/1	Merja Zerga
	Podicipedidae: 1	Podiceps nigricollis, 3	2017/3	Dayet Aoua and Amghass
	sp. 3 birds
	Haematopodidae:	Haematopus ostralegus, 2	2017/2	Khmiss sahel- Marais du Bas Loukoss,
2 species, 3 birds		Eurasian oystercatcher (Haematopus ostralegus), 1	2021/1	Larache
Pelecaniformes, 199	Ardeidae: 11 species, 174 birds	Bubulcus ibis, 126	2016/2	Khmiss sahel- Marais du Bas Loukoss/1, Lagune de marchika/1
			2017/49	Côte EL jadida/48, Lagune de marchika/1
			2018/57	Archipel et dunes Essaouira, 27°Côte EL jadida/30
			2019/17	Archipel et dunes Essaouira, the
			2022/1	Agadir
		Egretta garzetta, 16	2016/1	Khmiss sahel- Marais du Bas Loukoss,
2017/1	Merja Zerga
2022/14	Agadir/12, Eljadida/2
		Aigrette garzette Egretta garzetta, 15	2022/15	Agadir/13, Sv/El Jadida/2, and
		Ardea alba, 4	2022/4	Tanger
		Little egret (Egretta garzetta), 4	2021/4	Oriental
		Héron blanc Ardea alba, 4	2021/3	SV Larache
2022/1	SV Larache
Nycticorax spp, 1	2017/1	Khmiss sahel- Marais du Bas Loukoss,
		Ardea cinerea, 1	2017/1	Merja Zerga
		Gray heron (Ardea cinerea), 1	2021/1	Agadir
		Grande aigrette Ardea alba, 1	2022/1	SV Larache
		Aigrette garzette Egretta garzetta, 1	2022/1	Agadir
	Threskiornithidae: 5 species (25 birds)	Plegadis falcinellus, 7	2017/7	Lagune de Smir/4, Khmiss sahel- Marais du Bas Loukoss/2, Merja Zerga/1
		Spatule blanche Platalea leucorodia, 7	2022/7	Agadir
		Platalea leucorodia, 6	2022/6	Agadir
		Glossy ibis (Plegadis falcinellus), 3	2021/3	Kenitra
		White spatula (Platalea leucorodia), 2	2021/2	Agadir
Anseriformes 165	Anatidae: 16 species, 165 birds	Mallard (Anas platyrhynchos), 31	2021/31	Kenitra/10, Ifrane/8, Oriental/7, Eljadida/3, Agadir/3
		Canard Colvert Anas platyrhynchos, 30	2021/6	Sv/Kenitra/4, SV Mdiq Fnideq/2, and
2022/24	SV Mdiq Fnideq/9, Agadir/7, Sv/Kenitra/4, Sv/EL Jadida/3, Agadir/1.
		Spatula clypeata, 20	2016/5	Lac sidi Boughaba/3, Embochure Melouya/1, Merja Zerga/1
			2017/15	Lac sidi Boughaba/8, Dayet Aoua/Amghass/4,Barrage Mohamed V/1, Embochure Melouya/1, Khmiss sahel- Marais du Bas Loukoss/1
		Anas platyrhynchos, 58	2016/51	Khmiss sahel- Marais du Bas Loukoss,
			2017/7	Lagune de Smir/4, Dayet Aoua / Amghass/1, Khmiss sahel- Marais du Bas Loukoss/1, Merja Zerga/1
		Aythya ferina, 8	2016/1	Dayet Aoua and Amghass
			2017/7	Lac Sidi Boughaba/6, Dayet Aoua / Amghass/1
		Anas crecca, 3	2016/2	Merja Zerga
			2017/1	Barrage Mohamed V
		Northern shoveler (Spatula clypeata), 3	2021/3	Ifrane/1, Kenitra/1, Oriental/1
		Comman pochard (Aythya ferina), 2	2021/2	Agadir/1, Ifrane/1
		Tadorne de Belon, Tadorna tadorna, 2	2021/1	Sv/Kenitra
			2022/1	Sv/Kenitra
		Winter teal (Anas crecca), 2	2021/2	Eljadida/1, Oriental/1
		Northern pintail (Anas acuta), 1	2021/1	Eljadida
		Fuligula (Aythya spp), 1	2021/1	Eljadida
		Redhead nets (Netta rufina), 1	2021/1	Kenitra
		Aythya nyroca, 1	2017/1	Barrage Mohamed V
		Milouin Aythya ferina, 1	2022/1	Sv/Kenitra
		Mareca strepera, 1	2017/1	Sidi El Makhfi, “Sidi
Passeriformes 69	Passeridae 1	Passer domesticus, 28	2019/28	Merja Zerga/21, Oasis yassmina/7
	species 28 birds
	Corvidae 2 species	Pica Pica, 24	2019/24	Lac sidi Boughaba: a synonym for
	and 25 birds	Eurasian magpie (Pica pica), 1	2021/1	Agadir
	Muscicapidae 2	Ficedula hypoleuca, 4	2019/4	Oasis yassmina
	species and 6 birds	Luscinia megarhynchos, 2	2019/2	Oasis yassmina
	Phylloscopidae 2	Phylloscopus collybita, 2	2019/2	Oasis yassmina
	species in 4 birds	Phylloscopus bonelli, 2	2019/2	Oasis yassmina
	Buphagidae 1 specie 4 birds	Buphagus erythrorhynchus, 4	2016/4	Rabat
	Laniidae 1 specie 1 bird	Lanius senator, 1	2019/1	Oasis yassmina
	Sylviidae 1 specie 1 bird	Sylvia communis, 1	2019/1	Oasis yassmina
Gruiformes 44	Rallidae: 7 Species 44 Birds	Fulica atra, 18	2016/10	Dayet Aoua / Afnourir/6, Embochure Melouya/2, Lagune de Smir/1, Complexe de Sidi Moussa / Oualidia/1
			2017/8	Embochure Melouya/3, Lagune de Smir/3, Dayet Aoua / Afnourir/2
		Fulica cristata, 8	2017/1	Khmiss sahel- Marais du Bas Loukoss,
			2022/7	Tanger
		Foulque à crête Fulica cristata, 9	2021/3	SV Mdiq Fnideq:
			2022/6	SV Mdiq Fnideq:
		Fulica Spp, 4	2017/2	Lagune de Smir,
			2021/2	Oriental
		Moorhen (Gallinua chloropus), 3	2021/3	Agadir/1, Ifrane/1, Kenitra/1
		Eurasian coot (Fulica atra), 1	2021/1	Oriental
		Red-knobbed coot (Fulica cristata), 1	2021/1	Ifrane
Falconiformes, 37	Falconidae 1	Falco spp. 37	2016/22	Saidia/10, Casablanca/6, Rabat Salé/6
	specie 37 Birds		2017/10	Kenitra
			2022/5	Agadir
	Phalacrocorax	Cormoran de Socotra Phalacrocorax nigrogularis, 3	2021/1	Sv/Kenitra
carbo 1			2022/2	Sv/El Jadida/1 and Sv/Kenitra/1
	(Phalacrocorax)	Grand Cormoran Phalacrocorax carbo, 2	2022/2	Agadir/1, Sv/El Jadida/1
		Phalacrocorax nigrogularis, 1	2022/1	Eljadida
		Grand Cormoran Phalacrocorax carbo, 1	2022/1	Sv/EL Jadida
Phoenicopteriformes 2	Phoenicopteridae 2	Phoenicopterus roseus, 1	2016/1	Tantan
Ciconiiformes 2	Ciconiidae 1 specie 2 birds	White stork (Ciconia ciconia), 2	2021/2	Agadir
Accipitriformes 1	Accipitridae 1 specie 1 bird	Gyps fulvus 1.	2022/1	Agadir
Podicipediformes 1	Podicipedidae 1 specie 1 bird	The great crested grebe (Podiceps cristatus),1	2021/1	Kenitra

Acknowledgments

We acknowledge the Moroccan veterinary services, Department of Waters and Forestry, ornithologistteams, and hunting associations for collecting bird samples as well as the laboratory staff for processing the samples. Conflict of interest The authors declare no conflicts of interest.

Funding

This research received no external funding.

Authors’ contributions

Hasnae Zekhnini: Conceptualization, Methodology, Writing-original draft. Fatiha El Mellouli: Conceptualization, Methodology. Mohammed Rida Salam: Conceptualization, Methodology. Faiza Bennis: Conceptualization, Supervision. Fatima Chegdani: Conceptualization, Supervision.

Data availability

The primary data used to support the findings of this study are available from the corresponding author upon request.