Skip to main content
Food Chemistry: X logoLink to Food Chemistry: X
. 2025 Sep 6;30:103004. doi: 10.1016/j.fochx.2025.103004

Enhancement of polylactic acid-based electrospun films via sugarcane bagasse nanocellulose and paeonol for sustainable preservation of red grapes

JinTao He a, YingTing Liu a, SuXuan Xia a, Jing Deng a,⁎, Wen Li a,⁎, QinLu Lin a, FeiFei Zhong a,b, XiaoXi Zeng c
PMCID: PMC12452539  PMID: 40989096

Abstract

Petroleum-based plastics dominate the fruit packaging market, but the microplastics migration poses ecological and health risks. This study developed an active packaging by electrospun polylactic acid (PLA) with sugarcane bagasse-derived nanocellulose (NC) and natural antimicrobial agent paeonol (Pae), providing a sustainable solution for extending shelf life. The films were optimized and characterized by SEM, FTIR, WCA, TGA, DSC, and mechanical properties. The results showed that NC significantly improved the mechanical properties of films (The tensile strength was 2.77 ± 0.49 MPa, and the elongation at break was 171.81 ± 5.29 %). Pae exhibited release properties and showed antimicrobial effect against Escherichia coli and Staphylococcus aureus with MICs of 300 μg/mL and 500 μg/mL, also inhibited Penicillium spp., isolated from rotten red grapes. PLA/NC/Pae film effectively slowed decay and extended the shelf life of red grapes by 2–3 days. This work provided a green strategy for converting agricultural waste into high-performance food packaging.

Keywords: Sustainable packaging, Sugarcane bagasse nanocellulose, Paeonol, Electrospun, Antimicrobial film, Postharvest preservation

Highlights

  • •

    Electrospun PLA films reinforced by sugarcane bagasse nanocellulose.

  • •

    PLA/NC/Pae film exhibited antibacterial activity against key pathogens.

  • •

    PLA/NC/Pae film retained freshness better than commercial PE film.

  • •

    PLA/NC/Pae film extended the red grapes shelf life by 2–3 days.

1. Introduction

Food packaging is essential to maintain the quality and safety of food during storage, transportation, and distribution. Traditional packaging protects foods from mechanical damage, destructive light waves, and adverse gas reactions. However, traditional packaging has limited functionality and poses risks of environmental contamination and chemical migration (An et al., 2024). Food packaging systems need to evolve rapidly to meet consumer demands.

Fruits are rich in vitamins, dietary fiber, and antioxidants, and are vital parts of healthy diets. Nevertheless, fruits are highly susceptible to microbial infections, physiological changes, and metabolic activities after harvesting, which can lead to dehydration, shrinkage, softening, and mold (Qian et al., 2025). Global postharvest fruit losses average 30–40 %, corresponding to economic losses exceeding $ 300 billion per year (Pignères et al., 2025). Therefore, safe and effective preservation methods are crucial for fruit distribution and consumption.

Currently, petroleum-based plastics still dominate the market for fruit-sealing materials. The migration of harmful microplastics from plastic food packaging into food products would have created a serious ecological imbalance and human health risk (Zhuo et al., 2023). Agricultural waste-derived cellulose films offered a promising approach to sustainable material development, providing environmental benefits such as waste reduction and renewable resource utilization (Zhu et al., 2025). These films contribute to the principles of circular economy through waste reuse, while their biodegradability aligns with eco-friendly concepts (Sun et al., 2025). Converting these wastes into valuable cellulose films can reduce dependence on finite fossil resources, minimize the carbon footprint, and enhance overall environmental sustainability (Rana et al., 2025).

Sugarcane bagasse, a residue of the sugar industry, can be effectively valorized through nanocellulose (NC). NC derived from sugarcane bagasse has a diameter between 10 and 30 nm and crystallinity of up to 71.4 %, making it suitable as a reinforcing material (Zhang et al., 2023). NC possesses advantages including biodegradability, high mechanical properties, and renewability, making it a promising material for use in food packaging materials such as strength enhancers and antimicrobial biofilms (Freitas et al., 2022). Due to its excellent biocompatibility, NC can be effectively bound to various matrices, including starch-based, polysaccharide-based, polyvinyl alcohol (PVA), and polylactic acid (PLA). Its practical and widespread utilization significantly contributes to sustainable economic development (Thipchai et al., 2024).

Developing active packaging with functional properties by incorporating antimicrobial agents (e.g., essential oils, phenolic compounds, antimicrobial peptides, metals, and metal compounds, etc.) into materials can modulate the in-packaging microenvironment to inhibit microbial growth and prolong the storage period (Zhao et al., 2022). Paeonol (Pae) is a phenolic compound mainly extracted from the root bark of peony and mountain peony, exhibiting a wide range of pharmacological effects, including anti-aging, antioxidant, free radical scavenging, anti-inflammatory, antitumor, and antimicrobial activities (Yan et al., 2021). Compared to common plant essential oils or other phenolic compounds, Pae exhibits excellent broad-spectrum antimicrobial activity and has a significant inhibitory effect on common food spoilage microorganisms. Most plant essential oils are highly volatile, prone to evaporation, decomposition, and loss during film processing. Pae has a higher melting point and boiling point, indicating greater stability at polymer processing temperatures. This significantly reduces volatility, enabling more efficient loading into films. Once encapsulated within the film, the active ingredients are released more slowly and continuously, providing long-term protection throughout the shelf life. Furthermore, many essential oils have a strong, pungent odor, altering food flavor, while Pae has a mild, slightly sweet aroma. At effective antimicrobial concentrations, its negative effect on food flavor is negligible. As a traditional Chinese medicinal herb with a long history of use, Pae is considered highly safe and low-toxicity, aligning with consumer demand for “natural and safe” food additives (Qian et al., 2022). Ding et al. (Ding et al., 2025) prepared biodegradable nanocomposite films by dispersing Paeonol@ZIF-8 and Ag2CO3/Ag2O nano-heterojunctions in chitosan/kudzu-based solution by matrix mixing and solution casting, which significantly enhanced Pae utilization and were successfully applied in raspberry preservation.

Electrospun technology is a versatile, low-cost, and convenient method for preparing nano/micro fibers with large surface-to-volume ratios, controllable sizes, high loadings, light weight, outstanding tunability, and broad flexibility. The mild electrospun conditions do not deactivate sensitive active compounds, and the interfaces between fibers facilitate gas exchange and provide favorable conditions for food respiration (Huang et al., 2025). Electrospun technology enables the production of nanofibers from various natural biopolymers, which can be used to develop biodegradable and biocompatible films, significantly improving the sustainability and renewability of food packaging systems (Chang et al., 2025). PLA is an innovative renewable poly(α-ester) with biodegradability, low cost, good thermal stability, and mechanical properties. However, pure PLA films are inherently hard and brittle, leading to cracking, a lack of flexibility, and poor tolerance to deformation, limiting their processing performance and industrial applications. The formation of high-performance composites of PLA with biodegradable polymers such as NC constitutes a cost-effective solution to its properties. Furthermore, loading PLA films with natural antimicrobial substances such as Pae can effectively improve bioavailability, achieve long-lasting freshness preservation effects through antimicrobial packaging, and reduce the health hazards of synthetic preservatives (Shi et al., 2022).

In this study, PLA/NC/Pae films were prepared using PLA as substrate, NC as reinforcing filler, and Pae as a naturally antimicrobial agent by the electrospun technique for red grape preservation. This study provided a technological pathway for the high-value utilization of agricultural waste, offering innovative insights into the construction of environmentally friendly, efficient, and functional food packaging systems, as well as the practical application of perishable fruits and vegetables.

2. Materials and methods

2.1. Materials

Polylactic acid (MW = 110 kDa), Paeonol (99 %), Dichloromethane (AR, 99 %), sodium hydroxide (TG), Phenolphthalein, Acetic acid (AR, 99.5 %), O-methoxy-phenol (>99 %, GC), and Ascorbic acid were purchased from Shanghai Macklin Biochemical Co., Ltd. N, N-dimethylformamide (MW = 73.09 g/mol, BioReagent, ≥99.9 %), Trichloroacetic acid (AR, ≥99 %), Potassium hydrogen phthalate (99.8 %), 2-thiobarbituric acid (98 %), Sodium acetate (AR), Polyvinylpyrrolidone (MW = 40 kDa), Triton X-100 (MW = 250.380 g/mol, Biotech) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Sodium hypochlorite (AR), Yeast extract (FMB Grade), Peptone (FMB Grade), and Agar ((C12H18O9)n, AR) were purchased from Sangon Biotech (Shanghai) Co., Ltd. Sodium chloride (AR) was purchased from Sinopharm Chemical Reagent Co., Ltd. Ethanol (AR) was purchased from Hengxing Chemical Reagent Manufacturing Co., Ltd. Plate counting agar (BR) was purchased from Beijing Solarbio Science & Technology Co., Ltd.

2.2. Preparation of nanocellulose

Sugarcane bagasse was washed, dried, ground into powder, and then heated in 7.5 % (w/v) NaOH at 80 °C for 4 h (1 g/20 mL). After continuous washing with distilled water to neutrality, it was bleached with 5 % (v/v) NaClO at 60 °C for 1 h to obtain white fine fibers. Cellulose was obtained by drying it after washing again with distilled water until neutral (Ren et al., 2022). The prepared sugarcane bagasse cellulose was reacted with 55 % sulfuric acid at 50 °C for 70 min. The reaction was rapidly terminated by adding 10 times the volume of deionized water. The precipitate was obtained by centrifugation after standing for 12 h and washed with distilled water until the solution was neutral. The yellowish suspension was transferred to a dialysis bag and stored for 5–7 days until the pH reached 6–7. The powdered nanocellulose was obtained after freeze-drying (Li, et al., 2021).

2.3. Preparation of the films

PLA (0.75 g, 1.0 g, 1.25 g, 1.5 g, 1.75 g) was dissolved in 10 mL of a mixed solution of dichloromethane and N, N-dimethylformamide (3:1, v/v) and stirred for 2 h at room temperature. Pae (0 g, 0.2 g, 0.4 g, 0.6 g, 0.8 g) was added and dissolved completely, followed by the addition of nanocellulose (NC) (0 g, 0.01 g, 0.02 g, 0.03 g, 0.04 g) and mixing until homogeneous. The films with different compositions were prepared using an electrospun machine (JDF05, Changsha Nano Instruments Co., Ltd., China). The distance between the spinneret and the receiver was 10 cm, the voltage was set at 13 kV, and the flow rate was 1.5 mL/h. Experiments were conducted at room temperature (25 ± 2 °C) and 40–60 % relative humidity for 4 h. The film thickness was measured by a vernier caliper to ensure uniformity. The optimal component concentrations for the films were determined through single-factor and orthogonal experiments.

2.4. Characterization

2.4.1. Morphology observation

The prepared NC powder was dispersed and dripped onto a copper grid and dried naturally. Morphology was observed using a transmission electron microscope (TEM, JEM-F200, JEOL Ltd., Japan), and the NC particle size was counted by ImageJ. The surface micromorphology of films was observed using a scanning electron microscope (SEM, S-4800, Hitachi Ltd., Japan). The film samples were mounted on conductive adhesive and sprayed with gold under a vacuum, setting the accelerating voltage to 5 kV and the working distance to 11.5 mm. The diameters of 10 random fibers were measured using Nano Measure software.

2.4.2. Fourier-transform infrared spectroscopy

The chemical structures of cellulose, NC, and the films were determined using a Fourier-transform infrared spectroscopy (FT-IR, TENSOR II, Bruker Corporation, Germany). The ATR mode was used with a scan number of 50, a resolution of 4 cm−1, a wave number scanning range of 400 to 4000 cm−1, and three scans.

2.4.3. Mechanical properties

The films were cut into long strips of 20 mm × 70 mm. The distance between the top and bottom of the fixture was 10 mm, and it was measured by a universal tensile tester (HV-0350, Shanghai Hengyi Precision Instrument Co., Ltd., China). The tensile strength and elongation at break were recorded at a fixture spacing of 50 mm and a moving speed of 50 mm/min.

2.4.4. Water contact angle

The water contact angle (WCA) of the films was measured using a contact angle goniometer (JC2000D5H, Beijing Global Hengda Technology Co., Ltd., China). The films were cut into 20 mm × 20 mm pieces and placed flat on a slide. 5 μL of deionized water was slowly added dropwise to capture the WCA images and record the measured values.

2.4.5. Thermal stability

Thermogravimetric analysis (TGA) was carried out by a thermogravimetric analyzer (TGA/DSC1/1100SF, Mettler Toledo, Switzerland). Samples (2–3 mg) were heated from 25 °C to 600 °C at a rate of 10 °C/min under a N2 atmosphere, and the corresponding curves were recorded. The differential scanning calorimetry (DSC) curves were recorded with a differential scanning calorimeter (DSC25, TA Instruments, USA) from 25 °C to 200 °C at a rate of 10 °C/min under a nitrogen atmosphere.

2.5. In vitro release profile and release kinetic studies

The films were cut to appropriate sizes, immersed in 95 % ethanol, and placed at 37 °C at 100 rpm to release Pae. At predetermined intervals, 5 mL of solution was pipetted from the dissolution medium to be tested, while the same volume of solution was replenished. The OD value at 274 nm was determined by a UV spectrophotometer (T6, Beijing Purkinje General Instrument Co., Ltd.), and the amount released was calculated by a standard curve (y = 81.687× + 0.0095, R2 = 0.9993). The content of the released Pae was determined using the following calculation:

Accumulative release%=MtM0×100

where Mt was Pae released at time t, and M0 was the total amount of Pae incorporated in the film (Suhem et al., 2023).

To further understand the release profile, the experimental data were fitted to a mathematical kinetic model. There were four commonly used kinetic models, including the Zero-order model (Mt/M∞ = K0t), the First-order model (Mt/M∞ = 1-exp(K1t)), the Higuchi model (Mt/M∞ = KHt1/2), and the Ritger-Peppas model (Mt/M∞ = KRtn), where Mt and M∞ were the absolute accumulation of drug released at time t and infinite time, respectively, and K0, K1, KH, and KR were the corresponding release constants. n denoted the diffusion exponent, which indicated Fickian diffusion (n ≤ 0.45) or non-Fickian (0.45 < n < 1) release mechanism (Chen et al., 2020). The reliability of the model was judged by calculating the Coefficient of determination (R2), Root Mean Squared Error (RMSE), and Sum of squares due to error (SSE) of the fitting curve. The closer R2 is to 1, the higher the proportion of data variation that the model can explain. Smaller RMSE and SSE values indicate that the model’ predicted values are closer to the actual observed values.

2.6. Isolation and characterization of spoilage fungi from red grapes

Infected parts from naturally decayed red grapes were selected, placed on Potato Dextrose Agar (PDA) medium, and incubated at 28 °C for 3–5 days. Fungi growing on the plates were isolated based on morphology and transferred to fresh PDA medium. Isolate and purify spoilage fungi in culture dishes using morphological methods. Verification was carried out by refeeding purified spoilage fungi into homogeneous ripe red grapes. The mycelium of the isolated spoilage fungi was stained with Lactophenol Cotton Blue (LPCB) stain solution and placed under an optical microscope (CV31, Olympus Corporation, Japan) to observe the morphology. The genomic DNA of the isolated fungi was extracted and amplified by polymerase chain reaction (PCR) using universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). The reaction was performed by pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, denaturation at 72 °C for 1 min, 35 cycles, and extension at 72 °C for 7 min. 3 μL of PCR products was analyzed by 1 % agarose gel electrophoresis (Maneeboon, et al., 2023). The purified PCR products of each strain were subjected to DNA sequencing using an ABI3730-XL sequencer. The spliced sequence files were compared with the NCBI nucleic acid database(https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome), and the species with the greatest sequence similarity to the species to be tested was identified (Almiman, 2023).

2.7. Antimicrobial effect of paeonol and films

The minimum inhibitory concentration (MIC) of Pae against Escherichia coli and Staphylococcus aureus was determined by the Agar diffusion method. Different concentrations of ethanol solution of Pae were added to the LB solid medium, and then the bacteria were coated. The MIC was determined as the lowest concentration inhibiting visible bacterial growth after incubation. Untreated plates were used as negative controls. An equal amount of ethanol solution without Pae was added as a positive control to investigate the potential antibacterial effect of ethanol. The inhibitory properties of Pae against XX1 and XX2 were determined by using the agar well diffusion method. Spore suspensions were mixed with sterilized PDA, poured into plates, and allowed to solidify. Wells were punched and filled with different concentrations of Pae in ethanol. Plates were incubated at 28 °C for 3–5 days, and the diameter of the inhibition zone was measured. The antimicrobial properties of the films were evaluated using the Liquid culture method. The films were sterilized under UV irradiation for 1 h and then added to an LB liquid medium containing Escherichia coli and Staphylococcus aureus. Cultures were incubated at 37 °C and 180 rpm, and the optical density at 600 nm of the bacterial suspension was measured every 2 h to plot growth curves.

2.8. Application of films in red grapes

Red grapes are washed and picked, removing diseased, mechanically damaged, or unripe fruits. Single-layer package was applied using commercially available PE film, PLA film, and PLA/NC/Pae film, with an unpackaged control group included. Each group comprised 15 samples. Samples were stored at 25 °C for 12 days, and freshness indicators were measured every 2 days. Each treatment group has three parallel groups at each time point.

A panel of 10 professionally trained judges (5 women and 5 men, aged 18 to 25) conducted sensory assessments in a dedicated evaluation room. Panel members were required to demonstrate an interest in sensory evaluation, be in good health, and have no sensory impairments that could affect testing and training. Sensory competency testing included basic taste and smell recognition, texture perception, and descriptive ability assessments. The training covered theoretical knowledge and definitions of sensory attributes. Reference materials were provided before the formal assessment, accompanied by practical sample exercises and consistency training. Members scored samples according to Table S1, which included appearance and flavor. The weight loss rate = (m0-mt)/m0 * 100 %, where m0 was the initial mass and mt was the mass during storage. By observing whether there was microbial growth on the sample's surface and whether spoilage occurred, the mass of good fruits was weighed, and the ratio to the initial mass was the good fruit rate. The hardness was determined by a GY-3 durometer (Quzhou Aipu Measuring Instrument Co., Ltd., China). The total soluble solids (TSS) were determined by SN-HT-32 % Saccharometer (Shanghai Sunne Instrument Co., China). The titratable acid (TA) content was determined using the acid-base titration method. The ascorbic acid content was determined by the molybdenum blue colorimetric method. Malondialdehyde (MDA) content was determined using the thiobarbituric acid method. Peroxidase (POD) activity was determined using the guaiacol method.

2.9. Statistical analysis

All results are reported as the mean ± standard deviation of at least three determinations (n ≥ 3). SPSS 22 statistical software assessed statistical analyses by one-way ANOVA with Tukey's post-hoc tests. Duncan's multiple range test with 95 % confidence level (P < 0.05) was used to measure significant differences.

3. Results and discussion

3.1. Characterization of nanocellulose

The main components of sugarcane bagasse were cellulose (∼ 48.3 %), hemicellulose (∼ 28.6 %), lignin (∼ 23.5 %), and a small amount of sugar, lipids, pectin, and fat, etc., making it a suitable source for cellulose extraction (Waghmare & Khan, 2022). In alkaline solutions, the glycosidic and acetyl groups of hemicellulose and phenolic hydroxyl groups of lignin were hydrolyzed, leading to the dissolution of hemicellulose and lignin. In acidic solutions, HClO2 generated from NaClO was decomposed into HClO3 and HClO, further reaction to produce ClO2, resulted in oxidation and dissolution of lignin. During acid hydrolysis, hydronium hydride ions penetrated into the glycosidic bonds, causing bond cleavage and amorphous region dissolution, facilitating NC formation (Neenu et al., 2022).

FT-IR spectra of sugarcane bagasse, extracted cellulose, and NC are shown in Fig. 1a. The components of sugarcane bagasse fiber include alkanes, ketones, esters, alcohols, and aromatic hydrocarbons with different oxygenated groups. All the samples showed a broad band at 3500–3200 cm−1, indicating the stretching vibration of O—H in the cellulose molecule. The peak at 2890 cm−1 indicated the stretching vibration of C—H. The peak at 1051 cm−1 indicated the stretching vibration of C-O-C, and the peak at 893 cm−1 was the characteristic absorption peak of the β-glycosidic bond linkage in the cellulose molecule. These results indicated that the extract retained the cellulose chemical structure (Charoensopa et al., 2024). In the sugarcane bagasse spectra, the peak centered at 1730 cm−1 was attributed to the C Created by potrace 1.16, written by Peter Selinger 2001-2019 O stretching vibrations of ferulic acid and p-coumaric acid from hemicellulose or lignin. The absorption peak at 1513 cm−1 represented the C—C stretching vibration of the aromatic ring plane in lignin. The peak at 1250 cm−1 represented the C—O stretching vibration of the aromatic plane in lignin. However, these characteristic peaks were absent in the extracted cellulose and NC, indicating that the hemicellulose and lignin were successfully removed. No new functional groups appeared, indicating that no new bonds formed during acid hydrolysis (Pavalaydon et al., 2022).

Fig. 1.

Fig. 1

(a) FT-IR of sugarcane bagasse, sugarcane bagasse cellulose, and sugarcane bagasse nanocellulose; (b) TEM of sugarcane bagasse nanocellulose; (c) Particle size distribution of sugarcane bagasse nanocellulose; (d) SEM images of PLA film (I) and PLA/NC/Pae films (II-X corresponds to PLA/NC/Pae film (1–9)).

The TEM image and particle size distribution of NC are shown in Fig. 1b and c. The prepared NC had a spherical morphology, consistent with previous reports (de Araújo et al., 2024). The particle size analysis showed that the average particle size of the prepared NC was 25.8 nm, confirming that sulfuric acid treatment successfully hydrolyzed the cellulose molecular chains and effectively reduced the cellulose particle size.

3.2. Optimization of film preparation

Mechanical properties directly affect the ability of packaging film to protect during transportation, storage, and sales. WCA can indicate the material hydrophilicity: when the WCA of the material is >90 °can be described as hydrophobic, and vice versa for hydrophilic. WCA directly affects moisture management and microbial control in the environment (Li et al., 2025). Therefore, mechanical properties and WCA were used as indicators to optimize the concentrations of PLA, NC, and Pae in the electrospun films.

3.2.1. Single-factor experiment

In 10 mL of solvent, the amount of NC addition was fixed at 0.01 g, and Pae was fixed at 0.4 g. The PLA content was varied to explore the optimal ratio. Table 1 shows that with an increase in PLA content, the tensile strength and elongation at break of the films exhibit a trend of increasing and then decreasing. The maximum occurred at the PLA content of 1.5 g and 1.25 g, which were 2.51 ± 0.1 MPa and 134.04 ± 8.6 %, respectively. This may be because a moderate amount of PLA increased the viscosity of the spinning solution, the fiber was easier to stretch and uniformly distributed, and the intermolecular structure was more compact. While excessively high PLA content led to high viscosity, preventing rapid solvent evaporation, causing fiber entanglement, full chain stretching, and increased intermolecular forces (Xu et al., 2023). WCA showed no significant change with increasing PLA content (Fig. S1a), remaining hydrophobic, indicating PLA concentration did not alter hydrophilicity/hydrophobicity. PLA contents of 1.0 g, 1.25 g, and 1.5 g were selected for subsequent experiments.

Table 1.

Mechanical properties of films with different PLA, NC, and paeonol contents.

Content in 10 mL /g Tensile strength/MPa Elongation at break/%
PLA 0.75 0.91 ± 0.03 d 16.72 ± 3.86 d
1 2.08 ± 0.08 c 104.93 ± 2.69 b
1.25 2.31 ± 0.07 b 134.04 ± 8.6 a
1.5 2.51 ± 0.1 a 99.26 ± 14.35 b
1.75 1.97 ± 0.09 c 81.44 ± 10.94 c
NC 0 1.49 ± 0.09 c 59.18 ± 4.75 d
0.01 2.08 ± 0.08 a 104.93 ± 2.69 a
0.02 1.90 ± 0.24 b 94.13 ± 3.35 b
0.03 2.13 ± 0.28 a 86.62 ± 3.09 c
0.04 1.7 ± 0.17 bc 80.61 ± 3.54 c
Paeonol 0 1.72 ± 0.03 b 74.11 ± 0.89 b
0.2 2.00 ± 0.05 a 98.16 ± 5.19 a
0.4 2.08 ± 0.08 a 104.93 ± 2.69 a
0.6 1.85 ± 0.1 b 95.79 ± 9.41 a
0.8 1.27 ± 0.1 c 60.94 ± 6.74 c

Different letters in the same column indicate a significant difference at p < 0.05 by Duncan's multiple range test.

In 10 mL of solvent, the amount of PLA addition was fixed at 1 g, and Pae was fixed at 0.4 g. The NC content was varied to explore the optimal ratio. Table 1 showed that with the increase of NC content, the tensile strength and elongation at break of the films increased and then decreased, and the maximum values appeared at the content of 0.03 g and 0.01 g, which were 2.13 ± 0.28 MPa and 104.93 ± 2.69 %, respectively. The incorporation of appropriate concentrations of NC into films significantly enhanced the mechanical properties, primarily attributed to its high specific surface area, rigid structure, and strong interfacial interactions with the polymer matrix. The hydroxyl-rich NC surface formed a hydrogen bonding network with polar polymers, effectively transferring stress and inhibiting chain slip. The high-modulus rigid skeleton embedded in the matrix hindered crack propagation and dispersed external forces uniformly. In addition, uniformly dispersed NC formed a three-dimensional network, optimizing load transfer pathway, and enabling energy dissipation through dynamic hydrogen bond breaking/reforming during deformation, achieving synergistic strength and ductility enhancement (Li et al., 2024). However, excessive NC led to agglomeration due to high surface energy, reducing effective filler content and degrading performance (Patil et al., 2022). The increase in the content of NC led to an increase in the WCA, indicating that NC enhanced the hydrophobicity of the films (shown in Fig. S1b). This occurs because the nanoscale effect of NC was closely combined with PLA, altering the micro-nano structure of the film surface and reducing water molecule attachment points (Cheran et al., 2024). NC contents of 0.01 g, 0.02 g, and 0.03 g were selected for subsequent experiments.

In 10 mL of solvent, the amount of PLA addition was fixed at 1 g, and NC was fixed at 0.01 g. The Pae content was varied to explore the optimal ratio. Similarly, Table 1 showed that with the increase of Pae content, the tensile strength and elongation at break of the film showed a trend of increasing and then decreasing. The maximum occurred at the Pae content of 0.4 g, which was 2.08 ± 0.08 MPa and 104.93 ± 2.93 %, respectively. Moderate Pae increased fiber diameter and uniformity, resulting in a tighter structure and improved mechanics. High Pae hindered mobility within PLA and increased intermolecular interactions, reducing mechanical properties. As shown in Fig. S1c, Pae increased the WCA of the films, which were all above 120°. This was attributed to the structure of Pae contained a hydrophobic benzene ring and methoxy (Wang et al., 2023). Pae contents of 0.2 g, 0.4 g, and 0.6 g were selected for subsequent experiments.

3.2.2. Orthogonal experiment

Based on the single-factor experiment results, the orthogonal experiment was conducted with PLA, NC, and Pae additions as the test factors and the mechanical properties as indicators. A fuzzy comprehensive evaluation method incorporating membership functions yielded cumulative weighted membership values to determine the optimal composition for film performance (Chen et al., 2023). The factor levels of the orthogonal experiment are shown in Table S2, and the results are shown in Table S3. All three factors had significant effects on the test results, and the order of influence was PLA > Pae > NC. Based on multiple comparisons and extreme difference analysis, the optimal conditions for the preparation of PLA/NC/Pae film can be obtained as A2B3C1, i.e., 1.25 g of PLA, 0.03 g of NC, and 0.2 g of Pae in 10 mL of solvent. The verification test of the optimal ratio of the orthogonal experiment was carried out, and the tensile strength of A2B3C1 was obtained to be 2.77 ± 0.49 MPa, and the elongation at break was 171.81 ± 5.29 %, validating the accuracy and credibility of the optimization.

3.3. Characterization of the films

3.3.1. SEM

Fig. 1d shows the microscopic morphology of PLA film and PLA/NC/Pae films with different membership values (1–9). The results showed that the average diameter of the fibers increased with the spinning solution concentration, indicating that substances were successfully embedded into the fibers. PLA film exhibited a linear cross-type structure with large interfiber gaps and no mesh. With the increase of the spinning liquid concentration, the fiber structure gradually transitioned to the cross-linked mesh-type structure. The morphology of PLA/NC/Pae (1), PLA/NC/Pae (2), and PLA/NC/Pae (3) showed a linear type with a more uniform fiber distribution, and the voids between fibers were improved. PLA/NC/Pae (4), PLA/NC/Pae (5), and PLA/NC/Pae (6) displayed a reticulated cross-type structure with better fiber density and homogeneity. PLA/NC/Pae (7), PLA/NC/Pae (8), and PLA/NC/Pae (9) showed obvious reticulation structures, with poorer densification between fibers and uneven fiber distribution. This was because low solution concentrations allow better fiber stretchability, forming finer fibers, while high concentrations impede stretching, causing chain entanglement and resulting in poor uniformity or adhesion (Tagrida et al., 2022).

3.3.2. Ft-IR

The FT-IR of PLA film and PLA/NC/Pae films with different membership values are shown in Fig. S1d. By preparing uniform film samples, light scattering effects were minimized. FT-IR was performed on pure PLA film to exclude matrix effects. PLA exhibited peaks at 2995 cm−1 and 2943 cm−1, corresponding to the asymmetric and symmetric stretching vibrations of the saturated hydrocarbon CH3, respectively. The highly conjugated system C Created by potrace 1.16, written by Peter Selinger 2001-2019 O, which was generated by α‑hydrogen atoms and carbonyl groups in PLA molecules, formed tensile vibrations at 1754 cm−1. 1452 cm−1 was the absorption peak of C—H deformation vibration, 1185 cm−1 was the absorption peak of C-O-C tensile vibration, 1089 cm−1 was the absorption peak of C—O tensile vibration, and 868 cm−1 was the absorption peak of C—C tensile vibration (He, Bao, et al., 2025). Comparing PLA/NC/Pae films with PLA film can obtain the peak changes caused by NC and Pae after excluding the PLA matrix. After the addition of NC, no new characteristic peaks appeared, indicating that the addition of NC to the PLA was physically co-mingled, and no new structure was created. The peak at 1630 cm−1 corresponding to the C Created by potrace 1.16, written by Peter Selinger 2001-2019 O of Pae confirmed its successful loading into the film (Huang et al., 2022). The good additivity of the spectra indicated no significant interactions were detected between the substances. Therefore, in the qualitative analysis of this study, the matrix effect was considered negligible.

3.3.3. TGA and DSC

TGA, DTG, and DSC curves for PLA and PLA/NC/Pae films are shown in Figs. S1e, S1f, and S1g. The thermal degradation process of the films can be divided into three stages: the first stage was before 300 °C, where water evaporation dominated, including intermolecular hydrogen-bonded water and chemisorbed water. The second stage was at 300 °C–400 °C, where the mass loss of the films reached 98 %, and the polymer macromolecules were degraded due to thermal breakage of molecular chains and neighboring C—O bonds. The third stage was at 400 °C–600 °C, where the films were completely thermally degraded (Huang et al., 2024). The films with the addition of NC and Pae had similar thermogravimetric curves to PLA films, but mass loss between 300 and 400 °C was slightly higher, indicating a minor reduction in thermal degradation temperature.

Similar results were obtained by DSC, as shown in Fig. S1g. PLA was a semi-crystalline polymer containing amorphous and crystalline domains, and the temperatures corresponding to the exothermic crystallization peak as well as the absorptive melting peak of PLA were near 110 °C and 150 °C, respectively, which were also known as the crystallization temperature (Tc) and melting temperature (Tm). The overall flatness of the exothermic crystallization peak of PLA was due to the small area of the crystallization region, and the melting peak occurred near 150 °C as the crystals produced by the cold crystallization process eventually melted as the temperature was further increased. The appearance of a double melting peak near 150 °C for the material may indicate annealing during the DSC scanning process. The Tc of the PLA/NC/Pae film was in the range of 100 °C–105 °C, which was decreased compared to PLA film, suggesting that the addition of NC and Pae reduced the intermolecular forces, which made the molecular chains easy to move and facilitated the cold crystallization of the PLA chains at lower temperatures (Pan et al., 2019).

3.4. In vitro release profile and release kinetic studies

Fig. S2 shows the kinetic release model curves corresponding to different membership values of films, and Table 2 represents the kinetic equations. Rapid release in the initial phase was a common phenomenon in many release systems. The cumulative release rate of Pae reached more than 80 % in 0–2 h for all films, leveling off in the following 2–12 h. This was because Pae was incorporated in a blended form, allowing rapid release upon contact with the medium, achieving high initial release and stabilization within a short time (Laina et al., 2024).

Table 2.

Release kinetics fitting results for films with different membership values.

Samples Model Kinetic equations R2 RMSE SSE
PLA/NC/Pae (1) Zero-order model Mt/M∞ = 7.09 t + 35.62 0.3498 19.3643 2999.7968
First-order model Mt/M∞ = 89.04(1-exp(−6.79 t)) 0.9965 1.4127 15.9661
Higuchi model Mt/M∞ = 40.08 × 1/2 0.5439 15.2907 2104.2491
Ritger-Peppas model Mt/M∞ = 84.79 t0.0431 0.9995 0.5301 2.2478
PLA/NC/Pae (2) Zero-order model Mt/M∞ = 6.83 t + 36.06 0.4005 18.4942 2736.2738
First-order model Mt/M∞ = 90.63(1-exp(−4.60 t)) 0.9938 1.8811 28.3086
Higuchi model Mt/M∞ = 37.85 × 1/2 0.4431 16.8058 2541.92
Ritger-Peppas model Mt/M∞ = 79.33 t0.0799 0.9991 0.7037 3.9613
PLA/NC/Pae (3) Zero-order model Mt/M∞ = 6.86 t + 45.01 0.2083 21.6183 3738.80
First-order model Mt/M∞ = 87.07(1-exp(−8.39 t)) 0.9984 0.9590 7.3574
Higuchi model Mt/M∞ = 47.83 × 1/2 0.2166 20.2757 3699.94
Ritger-Peppas model Mt/M∞ = 84.85 t0.0314 0.9999 0.2684 0.5761
PLA/NC/Pae (4) Zero-order model Mt/M∞ = 6.38 t + 46.50 0.2282 24.4932 3695.65
First-order model Mt/M∞ = 88.97(1-exp(−4.94 t)) 0.9933 2.0062 32.1978
Higuchi model Mt/M∞ = 47.43 × 1/2 0.1966 20.6738 3846.67
Ritger-Peppas model Mt/M∞ = 82.11 t0.0747 0.9971 1.3194 13.9254
PLA/NC/Pae (5) Zero-order model Mt/M∞ = 5.46 t + 47.79 0.3083 22.0786 2899.7060
First-order model Mt/M∞ = 90.67(1-exp(−4.71 t)) 0.9950 1.8765 28.1688
Higuchi model Mt/M∞ = 39.19 × 1/2 0.2444 21.7572 4260.3789
Ritger-Peppas model Mt/M∞ = 81.96 t0.0694 0.9964 1.5896 20.2152
PLA/NC/Pae (6) Zero-order model Mt/M∞ = 6.47 t + 47.60 0.2423 22.0051 3873.7981
First-order model Mt/M∞ = 92.45(1-exp(−4.61 t)) 0.9983 1.0463 8.7574
Higuchi model Mt/M∞ = 46.65 × 1/2 0.1682 21.7374 4252.61
Ritger-Peppas model Mt/M∞ = 83.16 t0.0760 0.9921 2.2421 40.2149
PLA/NC/Pae (7) Zero-order model Mt/M∞ = 7.13 t + 42.82 0.4139 20.8358 3473.05
First-order model Mt/M∞ = 95.87(1-exp(−1.82 t)) 0.9967 1.5716 19.7582
Higuchi model Mt/M∞ = 48.77 × 1/2 0.2611 22.0563 4378.3200
Ritger-Peppas model Mt/M∞ = 63.28 t0.2371 0.9082 8.2890 549.6659
PLA/NC/Pae (8) Zero-order model Mt/M∞ = 5.51 t + 58.23 0.1895 23.0641 4255.6350
First-order model Mt/M∞ = 87.14(1-exp(−4.60 t)) 0.9938 2.0198 32.6352
Higuchi model Mt/M∞ = 57.04 × 1/2 −0.7646 32.0863 9265.7564
Ritger-Peppas model Mt/M∞ = 77.27 t0.0984 0.9909 2.4469 47.8971
PLA/NC/Pae (9) Zero-order model Mt/M∞ = 6.73 t + 49.59 0.2567 22.3672 4002.3285
First-order model Mt/M∞ = 93.79(1-exp(−2.43 t)) 0.9980 1.1726 10.9994
Higuchi model Mt/M∞ = 57.29 × 1/2 0.0077 24.3657 5343.1917
Ritger-Peppas model Mt/M∞ = 70.77 t0.1940 0.9106 7.7561 481.2523

The release models of different membership value films were matched according to the higher R2 and the smaller RMSE and SSE. PLA/NC/Pae (1), PLA/NC/Pae (2), PLA/NC/Pae (3), PLA/NC/Pae (4), and PLA/NC/Pae (5) were consistent with the Ritger-Peppas model. The n values of all films in the Ritger-Peppas model were less than 0.45, indicating a Fickian diffusion (He, Peng, et al., 2025). PLA/NC/Pae (6), PLA/NC/Pae (7), PLA/NC/Pae (8), and PLA/NC/Pae (9) were consistent with the first-order model. This may be because as the PLA concentration increased, the fiber diameter increased, the porosity decreased, and the film became denser, SEM images reveal larger fiber diameters and reduced porosity, resulting in denser films where diffusion becomes the predominant and faster release pathway. Pae can only diffuse slowly through existing or gradually forming micropores, relying on concentration gradients. This is consistent with the first-order model characteristics.

3.5. Characterization of spoilage fungi from red grapes

Red grapes are subject to fungal spoilage, such as Penicillium extensum and Aspergillus niger during harvest, transportation, and storage (Chen, Wang, et al., 2025). Two molds with different characteristics, named XX1 and XX2, were isolated from naturally rotten red grapes and confirmed by pathogenicity testing. XX1 colonies were green with short white edge mycelium and a thick velvety surface, maturing in ∼4 days. The mycelium was hyaline and branched, producing 1–4 rounds of symmetric or asymmetric peduncles, shaped like a broom. Conidia were rounded, mostly lime green. XX2 colonies were white, with a soft or fluffy morphology, grew rapidly, maturing in ∼4 days. The mycelium consisted of many elongated hyphae, with transverse septa between hyphae, branched, and with distinct root nodes (shown in Figs. S3a and S3b). ITS region PCR amplification and electrophoresis confirmed successful amplification (Fig. S3c). The purified PCR products were subjected to DNA sequence determination and database comparison, and the phylogenetic tree was constructed. The results showed that both XX1 and XX2 had the closest homology to Penicillium sp., with 99.3 % and 99.12 %, respectively. The phylogenetic trees of XX1 and XX2 are shown in Figs. S3d and S3e.

Blue mold decay caused by Penicillium spp. was one of the most common global and economically important postharvest grape rots. Injuries to the berries promoted the germination of Penicillium conidia, germ tube penetration, colonization, and blue mold formation. The fungi not only caused weight loss, color change, and softening of berries, and produced harmful mycotoxins (e.g., patulin, citrinin) detrimental to human immune, nervous, and gastrointestinal systems (Chen, Zhao, et al., 2025).

3.6. Antimicrobial effect of paeonol and films

As shown in Fig. 2a and b, Pae showed good bacteriostatic properties against Escherichia coli and Staphylococcus aureus with MICs of 300 μg/mL and 500 μg/mL, respectively. In the positive control group, microorganisms grew normally after ethanol addition, indicating that ethanol in the Pae solution had no significant effect on the results. This may be because the amount of solvent added was insufficient to produce antimicrobial properties. The films were added to the culture medium, and the growth curves of the microorganisms were plotted (shown in Fig. 2c and d). PLA film showed negligible inhibition, whereas Pae-containing films all demonstrated significant inhibitory effects. During the early growth stage, Pae in the fiber films showed a pronounced burst release effect, with higher concentrations of antimicrobial substances in the solution. As the concentration of Pae decreased, the inhibitory effect gradually weakened. Fig. 2e and f illustrate the inhibitory effect of different concentrations of Pae on two Penicillium spp. from red grapes. As concentrations increased, the diameter of the inhibition zone expanded, indicating Pae effectively suppresses the growth and reproduction of red grape spoilage fungi. The films also showed good inhibition of Penicillium spp. attributed to the excellent release profile of Pae in the films, indicating their potential for combating microbial food spoilage. These results confirmed that Pae effectively inhibited common bacteria and red grape spoilage fungi, with its activity released from the film, indicating that the prepared films had the potential to inhibit food spoilage microorganisms.

Fig. 2.

Fig. 2

(a) Antibacterial effect of paeonol on Escherichia coli (Negative control; Positive control (ethanol); 300 μg/mL; 250 μg/mL; 200 μg/mL; 150 μg/mL); (b) Antibacterial effect of paeonol on Staphylococcus aureus (Negative control; Positive control (ethanol); 600 μg/mL; 500 μg/mL; 400 μg/mL; 300 μg/mL); Antimicrobial effect of the films against Escherichia coli (c) and Staphylococcus aureus (d); The diameter of the inhibition zone of two strains of Penicillium with different concentrations of paeonol (e) XX1, (f) XX2.

Pae's inhibitory mechanisms include inhibiting microbial cell wall formation, disrupting cell membrane and mycelial structural integrity, causing mitochondrial dysfunction, and affecting energy metabolism and genetic material synthesis (Liang et al., 2024). Microorganisms may mount a series of adaptive responses to antimicrobial agents. By upregulating genes associated with cell membrane repair, altering membrane lipid composition, or activating cell wall synthesis pathways, microorganisms can reinforce their cell envelopes, thereby reducing the efficiency of Pae in disrupting membrane structures (Fu et al., 2022). Additionally, microorganisms may increase the expression level of the efflux pump. These membrane proteins will actively excrete Pae molecules that enter the cell, thereby reducing the intracellular Pae concentration (Li, et al., 2021). Some microorganisms may significantly reduce metabolic activity and metabolite level, entering a dormant state (Chen et al., 2022). In this state, their sensitivity to antimicrobials that do not specifically target metabolic pathways is reduced, allowing them to maintain survival and enter a quiescent phase (Zhang et al., 2024).

3.7. Application of films in red grapes

3.7.1. Sensory evaluation

Fig. 3a shows the appearance changes of red grapes stored at room temperature for 12 days, and Fig. 3b shows the sensory score changes. Over time, PE and PLA film groups exhibited mildew, softening, water loss, and wrinkling. In contrast, the PLA/NC/Pae film group showed only slight wrinkling, maintaining a smooth surface, bright color, and high edibility (Gong et al., 2025). All groups' scores declined continuously, but the PLA/NC/Pae group consistently scored highest. The PE and PLA film groups showed mold infections on the 6th day and 10th day, resulting in red grapes unmarketable. On the 12th day, the PLA/NC/Pae film group still showed better edible value, demonstrating its effectiveness in inhibiting rot and maintaining quality.

Fig. 3.

Fig. 3

Sensory image of red grapes during storage (a); changes of Sensory scores (b), Weight loss rate (c), Good fruit rate (d), Hardness (e), Total soluble solids (f), Titratable acid (g), Ascorbic acid content (h), Malondialdehyde content (i), and Peroxidase activity (j) of red grapes. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.7.2. Weight loss rate

Weight loss, indicating water transport from berries to the environment, is a key postharvest quality indicator. Water loss causes softening, wrinkling, and reduced edible value (Yu et al., 2025). The weight loss rate of red grapes in all groups showed an increase during storage, primarily due to transpiration and the nutrients by respiration. The weight loss increase in the PE film was relatively small, with only 7.51 ± 0.14 % on the 12th day. This was because the PE film had a dense structure and a strong barrier property to water vapor. The water vapor produced by the respiration and transpiration of red grapes can only condense on the fruit surface. The weight loss in both the PLA film group and the PLA/NC/Pae film group was higher, 20.58 ± 0.27 % and 24.95 ± 0.08 % on the 12th day, respectively. This was because the porosity of electrospun films results in poor barriers to water vapor. The difference between PLA and PLA/NC/Pae films was mainly due to the structure, hydrophobicity of the films, and nutrient consumption. The addition of NC and Pae enhanced the hydrophobicity of the film, which can slow down the rapid loss of water. The internal structure of the PLA/NC/Pae film was denser than PLA film, and the microbial activity was inhibited by Pae. The nutrient consumption of the red grapes was slowed down, which indirectly contributed to more dry weight.

3.7.3. Good fruit rate

Grapes are susceptible to mold and rot during postharvest storage. The good fruit rate was obtained by visual observation of the percentage of fruit free of mechanical damage, insect pests, and disease spots. The results are shown in Fig. 3d. The good fruit rate of all three groups decreased with the change in storage time, which was manifested by the surface of red grapes successively appearing with wrinkles, spots, molds, and the smell of rotting and fermentation. The PE group decreased most rapidly, showing mold infection on day 6 and a good fruit rate of only 33.33 ± 0.13 % by day 12. In the PLA film group and PLA/NC/Pae film group, the good fruit rate decreased on the 6th day and 8th day, respectively. After 12 days of storage in the PLA/NC/Pae film group, there was still no obvious mold contamination or rotting on the surface of red grapes.

The dense structure of PE film results in poor water vapor permeability, causing water vapor generated by respiration and transpiration to accumulate inside the packaging. The relative humidity within the package increased, raising the water activity (Aw) on the surface of red grapes. This accelerates the growth of spoilage microorganisms (Peleg, 2022). The supersaturated water vapor in the package condensed on the surface of the red grapes and the inner wall of the package, forming a thin liquid water film. The water film dissolved nutrients such as sugars exuding from the fruit surface, creating a natural culture medium. Spoilage microorganisms can also directly utilize the liquid water for metabolic growth. In addition, each microorganism had a minimum Aw threshold for growth (Zhou et al., 2025). Packaging with poor moisture permeability elevated Aw to close to 1.0, virtually eliminating all barriers to microbial survival. Simultaneously, low gas permeability accelerates the shift of the internal environment toward anaerobic conditions, causing anaerobic microorganisms to dominate, producing undesirable flavors such as sourness and wine-like odors (Ni et al., 2024).

The release of Pae in PLA/NC/Pae film effectively inhibited the growth of spoilage molds such as Penicillium spp., which was the most direct reason for the high good fruit rate. After Pae inhibited the dominant spoilage fungi, the microbial community structure on the whole fruit surface and the composition of its metabolites will change, indirectly creating a microenvironment more conducive to fruit preservation (Zhang et al., 2020). In addition, the porous network structure of the electrospun film allowed for the exchange of O₂ and CO₂, and is also conducive to water evaporation, which avoided the explosive growth of microorganisms caused by anaerobic or overly humid environments in PE film packaging.

3.7.4. Hardness

Hardness significantly impacts postharvest quality and consumer acceptance. Firmer grapes have cell walls composed of cellulose, hemicellulose, pectin, and glycoproteins, providing better mechanical integrity. Texture loss is a major change during storage, related to metabolic shifts and water content (Zhang et al., 2025). Fig. 3e shows a decrease in the hardness in all groups during storage, which was mainly because hydrolytic enzymes changed the structure of pectin during fruit ripening, and insoluble pectin, hemicellulose, and cellulose in the cell wall were degraded. It made the fruit more susceptible to softening, physiological disorders, and attack by pathogens. The hardness in the PE and PLA film groups showed a drastic decrease from the 10th day, and after storage for 12 days, the PE and PLA film groups decreased by 50.1 % and 55 %, respectively. While the PLA/NC/Pae film group decreased by 30.5 %. This indicated that Pae in PLA/NC/Pae films can directly inhibit molds and bacteria secreting pectinase and cellulase, delay their destruction to the fruit cell walls, and maintain the stiff structure.

3.7.5. Total soluble solids

TSS content is crucial for assessing grape berry quality. Sugars, organic acids, phenolic compounds, and volatiles are the main factors influencing the flavor of the grapes. The main changes in grape flavor during storage are seen in the loss of sweetness and acidity, leading to a bland taste (Maqbool et al., 2024). All three groups showed an increase and then a decrease during the storage period (shown in Fig. 3f). The highest TSS in the PE film group occurred on the 8th day, at 24.2 ± 0.2 %. The PLA film group and PLA/NC/Pae film group appeared on the 10th day with 26.9 ± 0.1 % and 26.67 ± 0.12 %, respectively. The PLA/NC/Pae group maintained the highest TSS at the end of storage, demonstrating its efficacy in inhibiting TSS reduction. In the early stages of storage, the increase in TSS content is due to the conversion of organic matter into soluble sugars and pectin, water loss due to transpiration, and the dissolution of soluble glucuronic acid and hemicellulose in the cell wall. Pae inhibited the utilization and degradation of sugars and organic acids by microorganisms, thereby better preserving the flavor substances of the red grapes. (Nguyen et al., 2020). Later microbial growth and increased intensity of fruit metabolism consume organic matter, causing a decrease in TSS content (Jiang et al., 2021). The TSS of the PLA/NC/Pae film group was better maintained, indicating that this film may reduce the overall metabolic rate of fruit by inhibiting microorganisms and moderately regulating the modified atmosphere environment, sustaining energy metabolism at a more stable level.

3.7.6. Titratable acid

TA content affects the sugar-acid ratio and flavor of grape berries. Changes in TA content during storage were related to the hydrolysis of insoluble polysaccharides to soluble sugars during storage, water loss, and consumption of organic acids during respiration (Sayah et al., 2025). As shown in Fig. 3g, all groups showed an overall decrease, primarily due to respiration consuming organic acids. The increase in the PLA film and PLA/NC/Pae film groups in the middle storage period may be due to respiration, which led to the oxidation of some sugars into organic acids. However, the increase in TA content may be reversed due to enhanced respiration triggered by post-harvest water stress or even sugar anisotropy (Jiang et al., 2025). The most significant decrease occurred in the PE film group was 0.132 %, followed by the PLA film group, 0.102 %, while the PLA/NC/Pae film group decreased only by 0.039 %. This indicated that the PLA/NC/Pae film can effectively delay the decomposition of organic acids, maintain the balance between sugars and acids, better slow down the consumption of energy substrates by respiration, and preserve the metabolic foundation of flavor compounds.

3.7.7. Ascorbic acid

Ascorbic acid (Vitamin C) is an important nutrient that prevents fruit browning by inhibiting the formation of quinone phenols (Guo et al., 2023). Ascorbic acid is easily lost during fruit storage because it is relatively unstable and susceptible to environmental factors (Dong & Tian, 2024). The ascorbic acid content of red grapes in all three groups showed an overall decrease during storage, which may be caused by the oxidation of superoxide and hydroxyl radicals, respiration, and water loss. The ascorbic acid content of the PE film group was 4.17 ± 0.02 mg/100 g on the 12th day, a decrease of 37.5 %, while that of the PLA film group and the PLA/NC/Pae film group showed a decrease of 25.5 % and 14.2 %, respectively. The PLA/NC/Pae film group exhibited the highest ascorbic acid content, primarily attributable to Pae's antioxidant properties. Pae can reduce the oxidative reactions and scavenge the free radicals present by inhibiting the activity of polyphenol oxidase. Furthermore, the overall quality of the PLA/NC/Pae film group slowed fruit ripening rates and reduced vitamin C depletion rates (Cheng et al., 2024).

3.7.8. Malondialdehyde content

MDA is one of the end products of lipid peroxidation and is often used as a key indicator for assessing the extent of cell membrane damage and the level of oxidative stress. MDA reacts strongly with cellular components, reducing enzyme activity and membrane resistance/fluidity, ultimately disrupting membrane integrity. Higher MDA indicates greater membrane damage and faster berry aging (Zeng et al., 2025). The change in MDA content during storage is shown in Fig. 3i. The MDA content in all groups showed an increase during storage, attributed to continuous production and accumulation from fruit senescence and deterioration. The MDA content in the PE film group increased sharply from the 6th day and reached 0.1557 μmol/gFW on the 12th day, which was due to the accelerated senescence of grapes caused by the mold infection. The MDA of the PLA and PLA/NC/Pae film groups were 0.132 μmol/gFW and 0.095 μmol/gFW, respectively, on the 12th day, indicating that the electrospun films effectively reduced the accumulation of MDA. This may be because the electrospun film provided a better gas atmosphere within the packaging, reducing oxidative reactions and preventing postharvest deterioration of cell membrane structure. Pae's antioxidant properties may reduce the production of reactive oxygen species and reduce lipid peroxidation levels. Additionally, as the films inhibited microbial infection, the fruit initiated an excessive immune response, thus maintaining the cell membrane integrity and normal metabolic functions.

3.7.9. Peroxidase activity

POD is an oxidoreductase commonly found in fruits and vegetables and is closely related to growth and aging, especially in enzymatic browning. POD helps to maintain the quality and flavor of fruits and prolongs their freshness by protecting them from reactive oxygen species that cause oxidative damage to fruit tissues (Shi et al., 2023). POD activity increased in all groups of red grapes during storage, indicating that various factors led to an increase in ROS production and stimulated POD activity. All three groups maintained low POD activity for the first 4 days, and from days 4 and 6 onwards, both the PE and PLA film groups showed significant increases, reaching 0.1704 U/gFW and 0.1423 U/gFW, respectively, on day 12, suggesting that higher oxidation levels were observed due to mold infections. In contrast, POD in the PLA/NC/Pae film group was 0.1019 U/gFW, indicating that this film can effectively inhibit POD activity and reduce the degree of oxidative response in red grapes. This may be due to the effective inhibition of microbial infection and quality deterioration in the PLA/NC/Pae film group, and the red grapes faced less stress, so they did not need to activate high levels of POD activity to counteract oxidative damage.

Although this study demonstrated the effectiveness of PLA/NC/Pae films for red grapes, the compared packaging system is inherently versatile. The excellent mechanical strength and hydrophobicity imparted by NC, combined with the broad-spectrum and antimicrobial activity provided by Pae, can address common spoilage mechanisms prevalent in various fresh agricultural products. For example, berries (e.g., strawberries, blueberries) and vegetables that are highly susceptible to fungal rot can also benefit from the antimicrobial effects of Pae. Stone fruits (e.g., peaches, cherries) and cut vegetables prone to rapid quality deterioration represent potential application targets. Furthermore, the electrospun technology employed is flexible. NC can be extracted from a variety of abundant agricultural wastes like rice husks, wheat straw, and corn stalks, ensuring the packaging solution's sustainability and adaptability across diverse regional and resource conditions. In summary, while the red grape preservation experiment only validated the application potential of PLA/NC/Pae films, this study's significance extends far beyond a single application. It provided a common framework for developing high-performance, biodegradable, and active packaging solutions from agricultural waste and natural antimicrobial agents.

4. Conclusion

In this paper, a novel green packaging strategy was developed by constructing PLA/NC/Pae films via electrospun technology for the sustainable preservation of red grapes. The mechanical properties and hydrophobicity of the films were significantly enhanced by optimizing the preparation process (PLA: 1.25 g, NC: 0.03 g, Pae: 0.2 g in 10 mL solvent). The NC significantly enhanced the mechanical properties (The tensile strength was 2.77 ± 0.49 MPa, and the elongation at break was 171.81 ± 5.29 %). Pae demonstrated potent antimicrobial effects against Escherichia coli, Staphylococcus aureus, and Penicillium spp. isolated from rotten grapes and exhibited release from the films. In practical preservation trials, PLA/NC/Pae film maintained the sensory quality, and all the physiological and biochemical indices were better than the commercial PE film, which effectively slowed down the decay process, and the shelf-life could be extended by 2–3 days. This study not only valorized agricultural waste, aligning with circular economy principles, but also provided a biodegradable alternative to petroleum-based plastics, advancing natural, safe, and sustainable food packaging solutions.

CRediT authorship contribution statement

JinTao He: Writing – review & editing, Writing – original draft, Validation. YingTing Liu: Investigation, Data curation. SuXuan Xia: Writing – original draft, Data curation. Jing Deng: Funding acquisition, Conceptualization. Wen Li: Writing – review & editing, Funding acquisition, Conceptualization. QinLu Lin: Funding acquisition, Conceptualization. FeiFei Zhong: Data curation. XiaoXi Zeng: Investigation.

Fundings

This work was supported by the Hunan Provincial Natural Science Foundation [grant numbers 2024JJ8204, 2024JJ8272, 2024JJ3053, 2025JJ80767, 2025JJ80069], Scientific Innovation Fund for Post-graduates of Central South University of Forestry and Technology [grant number 2025CX01108], Changsha Natural Science Foundation [grant numbers kq2402258], Taishan Industry Leading Talent Project [grant numbers tscx202408168], and National Natural Science Foundation of China [grant numbers 32472410].

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.fochx.2025.103004.

Contributor Information

Jing Deng, Email: T20202509@csuft.edu.cn.

Wen Li, Email: T20202532@csuft.edu.cn.

Appendix A. Supplementary data

Supplementary material

mmc1.docx (809.2KB, docx)

Data availability

Data will be made available on request.

References

  1. Almiman B. Identifying phytopathogenic fungi in Al-Baha province, Saudi Arabia through their molecular and morphological features: An overview. Saudi Journal of Biological Sciences. 2023;30(3) doi: 10.1016/j.sjbs.2023.103572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. An N., Zhu X., Xu S., Lin X., Zhu Y., Huang M., Xu Q., Xue F., Wu L. Biodegradable bio-film based on Rhizopus oryzae and metal–organic frameworks for fruit preservation and pesticide degradation. Chemical Engineering Journal. 2024;501 doi: 10.1016/j.cej.2024.157735. [DOI] [Google Scholar]
  3. de Araújo L.G.S., Rodrigues T.H.S., Rates E.R.D., Alencar L.M.R., de Rosa M.F., Ponte Rocha M.V. Production of cellulose nanoparticles from cashew apple bagasse by sequential enzymatic hydrolysis with an ultrasonic process and its application in biofilm packaging. ACS Omega. 2024;9:50671–50684. doi: 10.1021/acsomega.4c08702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chang Y., Ferreira M.D., Correa D.S., Teodoro K.B.R., Procopio F.R., Brexó R.P.…Brecht J.K. Advances in postharvest nanotechnology: Enhancing fresh produce shelf life and quality to reduce losses and waste. Postharvest Biology and Technology. 2025;222 doi: 10.1016/j.postharvbio.2025.113397. [DOI] [Google Scholar]
  5. Charoensopa K., Thangunpai K., Kong P., Enomae T., Ploysri W. Extraction of Nanocellulose from the residue of sugarcane bagasse Fiber for anti-Staphylococcus aureus (S. Aureus) application. Polymers. 2024;16:1612. doi: 10.3390/polym16111612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen J., Wang K., Godana E.A., Solairaj D., Yang Q., Zhang H. Construction of composite microorganisms and their physiological mechanisms of postharvest disease control in red grapes. Foods. 2025;14:408. doi: 10.3390/foods14030408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen L., Jiang X., Sun Y., Gan D., Liu W., Wu Y., Hao X. Composite optimization and characterization of dietary fiber-based edible packaging film reinforced by nanocellulose from grapefruit peel pomace. International Journal of Biological Macromolecules. 2023;253 doi: 10.1016/j.ijbiomac.2023.127655. [DOI] [PubMed] [Google Scholar]
  8. Chen L., Zhao C., Yan T., Li B., Wang S., Gong D., Long D. Antifungal potentiality of non-volatile compounds produced from Hanseniaspora uvarum against postharvest decay of table grape fruit caused by Botrytis cinerea and Penicillium expansum. Postharvest Biology and Technology. 2025;222 doi: 10.1016/j.postharvbio.2024.113364. [DOI] [Google Scholar]
  9. Chen L., Zhao X., Li R., Yang H. Integrated metabolomics and transcriptomics reveal the adaptive responses of salmonella enterica serovar typhimurium to thyme and cinnamon oils. Food Research International. 2022;157 doi: 10.1016/j.foodres.2022.111241. [DOI] [PubMed] [Google Scholar]
  10. Chen Y., Qiu Y., Chen W., Wei Q. Electrospun thymol-loaded porous cellulose acetate fibers with potential biomedical applications. Materials Science and Engineering C. 2020;109 doi: 10.1016/j.msec.2019.110536. [DOI] [PubMed] [Google Scholar]
  11. Cheng S., Chen W., Guo Z., Ding C., Zuo R., Liao Q. Paeonol alleviates ulcerative colitis by modulating PPAR - γ and nuclear factor - κB activation. Scientific Reports. 2024;14(1) doi: 10.1038/s41598-024-68992-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cheran E., Sharmila Rahale C., Divyabharathi P., Viswanathan C., Narayanan L. Corn cob nanocellulose packaging for increasing the shelf life of food products. International Journal of Biological Macromolecules. 2024;268 doi: 10.1016/j.ijbiomac.2024.131403. [DOI] [PubMed] [Google Scholar]
  13. Ding X., Zhao Y., Chen X., Huang Y., Lin Z., Wang J., Chen G., Liu G., Xu X., Jiao B., Zhao X., Xu D. Chitosan/kudzu-based packaging films synergistically reinforced by paeonol@ZIF-8 and Ag2CO3/Ag2O nano-heterojunctions for raspberry preservation. Food Packaging and Shelf Life. 2025;51 doi: 10.1016/j.fpsl.2025.101584. [DOI] [Google Scholar]
  14. Dong H., Tian Z. Preparation and characterization of pullulan-based packaging paper for fruit preservation. Molecules. 2024;29:1394. doi: 10.3390/molecules29061394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Freitas P.A.V., González-Martínez C., Chiralt A. Applying ultrasound-assisted processing to obtain cellulose fibres from rice straw to be used as reinforcing agents. Innovative Food Science and Emerging Technologies. 2022;76 doi: 10.1016/j.ifset.2022.102932. [DOI] [Google Scholar]
  16. Fu J., Liu C., Li L., Liu J., Tie Y., Wen X.…Zheng J. Adaptive response and tolerance to weak acids in Saccharomyces cerevisiae boulardii: A metabolomics approach. International Journal of Food Science and Technology. 2022;57(5):2918–2931. doi: 10.1111/ijfs.15598. [DOI] [Google Scholar]
  17. Gong W., Yang T., He W., Li Y., Hu J. On-demand removable hydrogel film derived from gallic acid-phycocyanin and polyvinyl alcohol for fruit preservation. Food Chemistry. 2025;463 doi: 10.1016/j.foodchem.2024.141404. [DOI] [PubMed] [Google Scholar]
  18. Guo L., Liang K., Huang X., Mai W., Duan X., Wu F. Morin treatment delays the ripening and senescence of postharvest mango fruits. Foods. 2023;12:4251. doi: 10.3390/foods12234251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. He J., Bao F., Li W., Deng J., Zhong F., Lin Q. Polylactic acid amine-sensitive colorimetric indicator film loaded with eugenol / coumarin derivatives : Towards freshness indication and shelf-life extension of chilled pork. International Journal of Biological Macromolecules. 2025;305 doi: 10.1016/j.ijbiomac.2025.141290. [DOI] [PubMed] [Google Scholar]
  20. He J., Peng Q., Wang J., Deng J., Li W., Lin Q., Zhong F., Xia X. An intelligent thymol/alizarin-loaded polycaprolactone/gelatin/zein nanofibrous film with pH-responsive and antibacterial properties for shrimp freshness monitoring and preservation. Food Chemistry. 2025;471 doi: 10.1016/j.foodchem.2025.142812. [DOI] [PubMed] [Google Scholar]
  21. Huang R., Xia S., Gong S., Wang J., Zhang W., Zhong F., Lin Q., Deng J., Li W. Enhancing sensitivity and stability of natural pigments in pH-responsive freshness indicators: A review. Food Chemistry. 2025;463 doi: 10.1016/j.foodchem.2024.141357. [DOI] [PubMed] [Google Scholar]
  22. Huang S., Zhai B., Fan Y., Sun J., Cheng J., Zou J.…Guo D. Development of Paeonol liposomes: Design, optimization, in vitro and in vivo evaluation. International Journal of Nanomedicine. 2022;17:5027–5046. doi: 10.2147/IJN.S363135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huang Z., Lou W., Zhong T., Zhang J., Wang J., Yang H., Shao Q., Cai M. Fabrication of bamboo nanocellulose fibril-based food packaging with dual-antimicrobial property. International Journal of Biological Macromolecules. 2024;281 doi: 10.1016/j.ijbiomac.2024.136249. [DOI] [PubMed] [Google Scholar]
  24. Jiang L., Luo Z., Liu H., Wang F., Li H., Gao H., Zhang H. Lychee (Litchi chinensis Sonn.) pericarp powder and their application as active food packaging. Foods. 2021;10:2834. doi: 10.3390/foods10112834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jiang Z., Li X., Peng S., Li X., Zhou C., Zhao X. Effects of temperature on the physicochemical properties and volatile profiles of ‘Shine Muscat’ grape during postharvest storage. Food Chemistry. 2025;469 doi: 10.1016/j.foodchem.2024.142546. [DOI] [PubMed] [Google Scholar]
  26. Laina K.T., Drosou C., Krokida M. Comparative assessment of encapsulated essential oils through the innovative electrohydrodynamic processing and the conventional spray drying, and freeze-drying techniques. Innovative Food Science and Emerging Technologies. 2024;95 doi: 10.1016/j.ifset.2024.103720. [DOI] [Google Scholar]
  27. Li M., He B., Chen Y., Zhao L. Physicochemical properties of Nanocellulose isolated from cotton stalk waste. ACS Omega. 2021;6(39):25162–25169. doi: 10.1021/acsomega.1c02568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Li Q., Zhao Y., Xie Y. Paeonol disrupts the integrity of aspergillus flavus cell walls via releasing surface proteins, inhibiting the biosynthesis of β-1,3-glucan and promoting the degradation of chitin, and an identification of cell surface proteins. Foods. 2021;10:2951. doi: 10.3390/foods10122951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Li W., Guan J., Fang H., Jiang Y., Zhong Y., Shi S., Cheng F. Continuously enhanced versatile nanocellulose films enabled by sustaining CO2 capture and in-situ calcification. Carbohydrate Polymers. 2024;342 doi: 10.1016/j.carbpol.2024.122362. [DOI] [PubMed] [Google Scholar]
  30. Li Z., Li Q., Ren D., Wu X., Xu D. Superhydrophobic surfaces: A promising strategy for addressing food industry challenges. Innovative Food Science and Emerging Technologies. 2025;100 doi: 10.1016/j.ifset.2024.103899. [DOI] [Google Scholar]
  31. Liang H., Yang M., Li Q., Zhang L., Zhao X. A comprehensive review of the main components of plant essential oils and the mechanisms responsible for the inhibitory effects on fungal growth and aflatoxin synthesis. Innovative Food Science and Emerging Technologies. 2024;96 doi: 10.1016/j.ifset.2024.103747. [DOI] [Google Scholar]
  32. Maneeboon T., Sangchote S., Hongprayoon R., Chuaysrinule C., Mahakarnchanakul W. Occurrence of heat-resistant Mold Ascospores in pineapple and sugarcane field soils in Thailand. International Journal of Microbiology. 2023;2023 doi: 10.1155/2023/8347560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Maqbool A., Beigh M.A., Hussain S.Z., Bhat T.A., Zargar I.A., Akhter S.…Qadri T. Effect of 1-MCP and KMnO4 treatments with different packaging on quality preservation of golden delicious apples. Food Chemistry: X. 2024;23 doi: 10.1016/j.fochx.2024.101768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Neenu K.V., Midhun Dominic C.D., Begum P.M.S., Parameswaranpillai J., Kanoth B.P., David D.A.…Badawi M. Effect of oxalic acid and sulphuric acid hydrolysis on the preparation and properties of pineapple pomace derived cellulose nanofibers and nanopapers. International Journal of Biological Macromolecules. 2022;209:1745–1759. doi: 10.1016/j.ijbiomac.2022.04.138. [DOI] [PubMed] [Google Scholar]
  35. Nguyen V.T.B., Nguyen D.H.H., Nguyen H.V.H. Combination effects of calcium chloride and nano-chitosan on the postharvest quality of strawberry (Fragaria x ananassa Duch .) Postharvest Biology and Technology. 2020;162 doi: 10.1016/j.postharvbio.2019.111103. [DOI] [Google Scholar]
  36. Ni Z.-J., Xue Y., Wang W., Du J., Thakur K., Ma W.-P., Wei Z.-J. Carbon dots-mediated photodynamic treatment reduces postharvest senescence and decay of grapes by regulating the antioxidant system. Foods. 2024;13(17):2717. doi: 10.3390/foods13172717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pan J., Ai F., Shao P., Chen H., Gao H. Development of polyvinyl alcohol/β-cyclodextrin antimicrobial nanofibers for fresh mushroom packaging. Food Chemistry. 2019;300 doi: 10.1016/j.foodchem.2019.125249. [DOI] [PubMed] [Google Scholar]
  38. Patil S., Bharimalla A.K., Nadanathangam V., Dhakane-Lad J., Mahapatra A., Jagajanantha P., Saxena S. Nanocellulose reinforced corn starch-based biocomposite films: Composite optimization, characterization and storage studies. Food Packaging and Shelf Life. 2022;33 doi: 10.1016/j.fpsl.2022.100860. [DOI] [Google Scholar]
  39. Pavalaydon K., Ramasawmy H., Surroop D. Comparative evaluation of cellulose nanocrystals from bagasse and coir agro-wastes for reinforcing PVA-based composites. Environment, Development and Sustainability. 2022;24(8):9963–9984. doi: 10.1007/s10668-021-01852-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Peleg M. Models of the water activity effect on microbial growth rate and initiation. Applied Microbiology and Biotechnology. 2022;106(4):1375–1382. doi: 10.1007/s00253-022-11792-7. [DOI] [PubMed] [Google Scholar]
  41. Pignères E., Masson M., Duret S., Blumenthal D., Gouton M.A., Gontard N.…Gaucel S. Consumer behavior at sale point and consumption according to strawberry quality: How to use those data to evaluate food waste? Current Research in Food Science. 2025;10 doi: 10.1016/j.crfs.2025.101001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Qian L., Jia R., Zhao Q., Sun N., Yang J., Wen J., Li H., Yang J., Mo L., Gao W., Deng S., Qin Z. Tough, antibacterial, and antioxidant chitosan-based composite films enhanced with proanthocyanidin and carvacrol essential oil for fruit preservation. Food Research International. 2025;208 doi: 10.1016/j.foodres.2025.116269. [DOI] [PubMed] [Google Scholar]
  43. Qian W., Li X., Liu Q., Lu J., Wang T., Zhang Q. Antifungal and Antibiofilm efficacy of Paeonol treatment against biofilms comprising Candida albicans and/or Cryptococcus neoformans. Frontiers in Cellular and Infection Microbiology. 2022;12 doi: 10.3389/fcimb.2022.884793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rana R., Ahmad W., Mishra A., Kumar S., Ahmad A. Nanocellulose/nanocellulose-based membranes in wastewater treatment: A sustainable path forward for environmental protection. Food Chemistry: X. 2025;29 doi: 10.1016/j.fochx.2025.102654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ren D., Wang Y., Wang H., Xu D., Wu X. Fabrication of nanocellulose fibril-based composite film from bamboo parenchyma cell for antimicrobial food packaging. International Journal of Biological Macromolecules. 2022;210:152–160. doi: 10.1016/j.ijbiomac.2022.04.171. [DOI] [PubMed] [Google Scholar]
  46. Sayah N., Ibrahim N.A., Elfalleh W., Zouari N., Hamdi N., Jridi M. Characterization, antibacterial properties, and application of gelatin films reinforced with smectite and illite clays for cherry fruit preservation. Food Chemistry: X. 2025;29 doi: 10.1016/j.fochx.2025.102629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Shi C., Fang D., Huang C., Zhou A., Lu T., Wang J., Song Y., Lyu L., Wu W., Li W. Active electrospun nanofiber packaging maintains the preservation quality and antioxidant activity of blackberry. Postharvest Biology and Technology. 2023;199 doi: 10.1016/j.postharvbio.2023.112300. [DOI] [Google Scholar]
  48. Shi C., Zhou A., Fang D., Lu T., Wang J., Song Y., Lyu L., Wu W., Huang C., Li W. Oregano essential oil/β-cyclodextrin inclusion compound polylactic acid/polycaprolactone electrospun nanofibers for active food packaging. Chemical Engineering Journal. 2022;445 doi: 10.1016/j.cej.2022.136746. [DOI] [Google Scholar]
  49. Suhem K., Phothisuwan S., Kongchoosi N., Matan N. Controlled release of Litsea cubeba oil from antimicrobial quail egg tray based on water lettuce root and banana stalk to inhibit the growth of pathologic bacteria, and its reusability. Food Control. 2023;154 doi: 10.1016/j.foodcont.2023.110006. [DOI] [Google Scholar]
  50. Sun W., Hu Y., Pandi A., Yi G., Tan Z. Food chemistry : X Caffeic acid-integrated biopolymer systems : Advancing sustainable active packaging for food preservation. Food Chemistry: X. 2025;29 doi: 10.1016/j.fochx.2025.102763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Tagrida M., Gulzar S., Nilsuwan K., Prodpran T., Zhang B., Benjakul S. Polylactic acid film coated with electrospun gelatin/chitosan nanofibers containing betel leaf Ethanolic extract: Properties, bioactivities, and use for shelf-life extension of Tilapia slices. Moleculars. 2022;27:5877. doi: 10.3390/molecules27185877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Thipchai P., Sringarm K., Punyodom W., Jantanasakulwong K., Thanakkasaranee S., Panyathip R.…Rachtanapun P. Production of Nanocellulose from sugarcane bagasse and development of Nanocellulose conjugated with Polylysine for Fumonisin B1 toxicity absorption. Polymers. 2024;16:1881. doi: 10.3390/polym16131881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Waghmare N.K., Khan S. Extraction and characterization of Nano-cellulose fibrils from Indian sugarcane bagasse- an agro waste. Journal of Natural Fibers. 2022;19(13):6230–6238. doi: 10.1080/15440478.2021.1907831. [DOI] [Google Scholar]
  54. Wang Y., Yue Y., Jia R., Liu X., Cheng Z., Cheng Y.…Xia H. Design and evaluation of Paeonol-loaded liposomes in Thermoreversible gels for atopic dermatitis. Gels. 2023;9:198. doi: 10.3390/gels9030198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xu H., Xu H., Ma S., Wei Y., He X., Guo C., Wang Y., Liang Z., Hu Y., Zhao L., Lian X., Huang D. Bifunctional electrospun poly (L-lactic acid) membranes incorporating black phosphorus nanosheets and nano-zinc oxide for enhanced biocompatibility and antibacterial properties in catheter materials. Journal of the Mechanical Behavior of Biomedical Materials. 2023;142 doi: 10.1016/j.jmbbm.2023.105884. [DOI] [PubMed] [Google Scholar]
  56. Yan Z., Xie L., Li M., Yuan M., Tian Y., Sun D., Zhang Y., Niu L. Phytochemical components and bioactivities of novel medicinal food – Peony roots. Food Research International. 2021;140 doi: 10.1016/j.foodres.2020.109902. [DOI] [PubMed] [Google Scholar]
  57. Yu K., Yang L., Zhang S., Zhang N., Zhu D., He Y., Cao X., Liu H. Tough, antibacterial, antioxidant, antifogging and washable chitosan/nanocellulose-based edible coatings for grape preservation. Food Chemistry. 2025;468 doi: 10.1016/j.foodchem.2024.142513. [DOI] [PubMed] [Google Scholar]
  58. Zeng Y., Zhang J., Su H., Xie L., Zhao Y., Xiong Y., Wenhua Z. Cell wall and reactive oxygen metabolism responses of stored Shine Muscat grapes to combined melatonin and 24-epibrassinolide treatment. Postharvest Biology and Technology. 2025;219 doi: 10.1016/j.postharvbio.2024.113192. [DOI] [Google Scholar]
  59. Zhang F., Shen R., Li N., Yang X., Lin D. Nanocellulose: An amazing nanomaterial with diverse applications in food science. Carbohydrate Polymers. 2023;304 doi: 10.1016/j.carbpol.2022.120497. [DOI] [PubMed] [Google Scholar]
  60. Zhang H., Huang S., Zhao Y., Tian H.S., Lin M., Xie Y., Yu Z. Modification of microporous bionanocomposite films with visible light-activated photocatalytic antimicrobial TNT-CuO nanoparticles for active fruit packaging. Food Research International. 2025;199 doi: 10.1016/j.foodres.2024.115356. [DOI] [PubMed] [Google Scholar]
  61. Zhang X., Chen Y., Guo A., Lv J. Adaptive responses of Dermacoccus abyssi HZAU 226 to lysozyme stress. Food Bioscience. 2024;58 doi: 10.1016/j.fbio.2024.103730. [DOI] [Google Scholar]
  62. Zhang Z., Zhao P., Zhang P., Su L., Jia H., Wei X., Fang J., Jia H. Integrative transcriptomics and metabolomics data exploring the effect of chitosan on postharvest grape resistance to Botrytis cinerea. Postharvest Biology and Technology. 2020;167 doi: 10.1016/j.postharvbio.2020.111248. [DOI] [Google Scholar]
  63. Zhao Y., An J., Su H., Li B., Liang D., Huang C. Antimicrobial food packaging integrating polysaccharide-based substrates with green antimicrobial agents: A sustainable path. Food Research International. 2022;155 doi: 10.1016/j.foodres.2022.111096. [DOI] [PubMed] [Google Scholar]
  64. Zhou Z., Feng J., Ye S., Xiong Q., Hu H., Chen C. Modeling aspergillus flavus growth on Polygonati Rhizoma as the function of temperature and water activity. Lwt. 2025;215 doi: 10.1016/j.lwt.2024.117187. [DOI] [Google Scholar]
  65. Zhu H., Li H.T., Fan X., Wang T., Dhital S. Modification of cellulosic structures from fruit by-products: Toward better nutritional properties. Food Research International. 2025;214 doi: 10.1016/j.foodres.2025.116604. [DOI] [PubMed] [Google Scholar]
  66. Zhuo Y., He J., Li W., Deng J., Lin Q. A review on takeaway packaging waste : Types, ecological impact, and disposal route. Environmental Pollution. 2023;337 doi: 10.1016/j.envpol.2023.122518. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material

mmc1.docx (809.2KB, docx)

Data Availability Statement

Data will be made available on request.


Articles from Food Chemistry: X are provided here courtesy of Elsevier

RESOURCES