Role of Necroptosis and Neuroinflammation in CSVD‐Associated Cognitive Decline in db/db Mice

ABSTRACT

Diabetes‐related cerebral small‐vessel disease (CSVD) is an important causative factor of cognitive impairment, but its molecular mechanisms have not been clarified. The aim of this study was to investigate the role of the necrotic apoptotic pathway (RIP1/RIP3/MLKL) and the inflammatory response in diabetic CSVD. Wild‐type C57BL/6 mice and leptin receptor‐deficient db/db mice were categorized into six groups according to age (8‐, 12‐, and 16‐week time points) and genotype. Cognitive function was assessed by the water maze experiment (escape latency, percentage of time spent in the target quadrant, and number of times through the table); cerebral atrophy and ventricular dilatation were detected by cranial MRI; cerebral microvascular structure, cortical neuronal damage, and ultrapathological changes in hippocampal mitochondria were observed by HE staining and transmission electron microscopy, respectively; and blood–brain barrier‐associated proteins were detected by western blot and RT‐qPCR (occludin, ZO‐1, VEGFA) and necroptotic apoptotic pathway molecules (RIP1, RIP3, MLKL). Western blot and RT‐qPCR were used to detect the protein and mRNA expression of blood–brain barrier‐associated proteins (occludin, ZO‐1, VEGFA) and necroptotic apoptotic pathway molecules (RIP1, RIP3, MLKL). Immunohistochemistry was used to localize the distribution of RIP1/RIP3/MLKL in the brain tissues; and plasma levels of inflammatory factors (IL‐6, IL‐10, TNF‐α, NF‐κB) were quantified by ELISA. In db/db mice: (1) spatial learning and memory abilities were reduced compared to wild‐type (WT) mice; (2) at 16 weeks of age, db/db mice showed signs of temporal lobe atrophy and an enlarged fourth cerebral ventricle; (3) capillary proliferation and cortical injury were observed in the frontal cortex, along with mitochondrial swelling, degeneration, and nuclear membrane rupture in hippocampal cells; (4) the occludin and ZO‐1 protein expression in the db/db‐16W group decreased to 0.48‐ and 0.68‐fold of the WT‐8W group, respectively, and the VEGFA was elevated by 2.87‐fold; the mRNA expression of RIP1/RIP3/MLKL was up‐regulated to 3.02‐, 3.12‐, and 4.02‐fold of the WT group, the relative expression of western blot proteins increased synchronously; the increase in the number of immunohistochemically positive cells increased synchronously, and (5) plasma inflammatory factors were significantly elevated in db/db mice: IL‐6 ↑3.81‐fold, TNF‐α ↑4.23‐fold, NF‐κB ↑3.56‐fold. This study reveals for the first time the molecular mechanism by which diabetes drives cerebral small vessel disease (CSVD) through the spatiotemporal‐dependent activation of the necrotic apoptotic pathway (RIP1/RIP3/MLKL), and targeting the necrotic apoptotic pathway may serve as a potential therapeutic strategy for diabetes‐associated cognitive deficits by concurrently protecting the blood–brain barrier and suppressing neuroinflammation.

Diabetes activates the RIP1/RIP3/MLKL necroptosis pathway in db/db mice, causing blood–brain barrier disruption (↓Occludin/ZO‐1, ↑VEGFA), neuroinflammation (↑IL‐6/TNF‐α/NF‐κB), and cerebral small vessel disease. This spatiotemporal‐dependent mechanism drives cognitive deficits, suggesting therapeutic potential by targeting necroptosis to simultaneously protect BBB and suppress inflammation.

Abbreviations

AD

Alzheimer disease

CSVD

cerebral small vessel disease

db/db

leptin receptor db/db

FBG

fasting blood‐glucose

HE

hematoxylin–eosin staining

IL‐6

interleukin‐6

IL‐10

interleukin‐10

MCI

mild cognitive impairment

MLKL

mixed lineage kinase domain‐like protein

MRI

magnetic resonance imaging

MWM

Morris water maze

NF‐κB

nuclear factor‐κ‐gene binding

RIP1

receptor interacting protein 1

RIP3

receptor interacting protein 3

RT‐qPCR

quantitative real‐time PCR

T2DM

type 2 diabetes mellitus

TNF‐α

tumor necrosis factor‐α

VEGFA

vascular endothelial growth factor

WB

western blot

WMH

white matter hyperintensities

WT

wild type

ZO‐1

zona occludens

1. Introduction

Cerebral small vessel disease (CSVD) is a disease involving cerebral arteries, microarterioles, capillaries, veins, and microvessels with pathologic features including disruption of the blood–brain barrier, microvascular leakage, and chronic hypoperfusion, and is clinically characterized by a significantly increased risk of stroke, cognitive impairment, and mood disorders [1, 2]. In recent years, type 2 diabetes mellitus (T2DM) has been recognized as an important causative agent of CSVD, and CSVD imaging markers such as cerebral white matter hyperintensities or microhemorrhages are present in approximately 40% of T2DM patients and positively correlate with the degree of cognitive decline [3]. Although hyperglycemia‐induced oxidative stress and accumulation of advanced glycosylation end products (AGEs) have been suggested as potential mechanisms of diabetes‐related CSVD [4], the synergistic role of programmed death of microvascular endothelial cells (necrotic apoptosis) and systemic inflammation in the progression of the disease is unclear, and this may be a key hub linking metabolic disorders to central microenvironmental imbalances.

In contrast to conventional apoptosis, necroptosis is a form of programmed necrosis mediated by the RIP1/RIP3/MLKL signaling axis and is characterized by rupture of the cell membrane and release of damage‐associated molecular patterns (DAMPs) that trigger an intense inflammatory response [5]. In chronic metabolic diseases such as diabetes mellitus, sustained hyperglycemia induces necrotic apoptosis of endothelial cells through activation of RIP1 kinase, leading to microvascular leakage and localized inflammatory amplification. This “cell death‐inflammation” positive feedback mechanism has been demonstrated in acute ischemic stroke [6], but whether it plays a predominant role in the chronic progression of diabetes‐related CSVD remains unknown. The db/db mice spontaneously develop severe T2DM due to leptin receptor defects, characterized by insulin resistance, chronic hyperglycemia, and cerebral microvascular pathology (e.g., increased blood–brain barrier permeability, white matter sparing). In this study, db/db mice were selected as research subjects, and the evolutionary pattern of CSVD was resolved by integrating multi‐omics tools through multi‐modal means: CSVD phenotypic assessment by combining Morris water maze, magnetic resonance imaging, and histopathology; and blood–brain barrier integrity was explored by detecting tight junction proteins (occludin, ZO‐1) and pro‐angiogenic factors (VEGF‐A); molecular mechanisms were explored by analyzing mRNA and protein expression and tissue localization of RIP1/RIP3/MLKL, and quantifying plasma IL‐6, TNF‐α, and NF‐κB levels. This study reveals for the first time the synergistic role of RIP1/RIP3/MLKL‐mediated necrotic apoptosis and inflammatory response in diabetic CSVD, providing a novel perspective for targeted intervention in diabetes‐related cognitive impairment.

2. Materials and Methods

2.1. Experimental Animals and Grouping

Eighteen 6‐week‐old male db/db mice of clean grade were obtained from Huachuang Sino PharmaTech Co. Ltd., Taizhou, Jiangsu [Animal License No. SCXK (Su) 2020‐0009]. Twelve 6‐week‐old male C57BL/6 mice of clean grade were acquired from the Health Science Center of China Three Gorges University [Animal License No. SCXK (Hu) 2020‐0012]. All mice were housed in standard specific pathogen‐free (SPF) laboratory cages. Cages, drinking bottles, bedding, and other items were autoclave‐sterilized. Mice had free access to water and were allowed a 2‐week acclimation period in the laboratory environment before the formal experiment. Sample size calculation and grouping: Based on pre‐experimental data (effect size d = 1.8, α = 0.05, β = 0.2) calculated using G*Power 3.1, a minimum of 4 (wild‐type) or 6 (db/db) mice were required in each group to achieve 80% statistical validity. Mice were randomly assigned to the following groups: WT group (n = 12): randomly divided into subgroups of 8W, 12W, 16W (n = 4/group); db/db group (n = 18): randomly divided into subgroups of 8W, 12W, 16W (n = 6/group). Experimental period: total duration of 16 weeks. This study was approved by the Ethics Committee of Shanxi Baiqiu'en Hospital (approval number: SBQKL‐2021‐060).

2.2. Experimental Reagents and Instruments

The primary experimental reagents used in this study include antibodies against occludin and ZO‐1 (Proteintech, USA), VEGF‐A (Abcam, UK), RIP1 and RIP3 (Bioss, Beijing), and MLKL (Affinity, USA); TsingZol Total RNA Extraction Reagent kit, SynScript III cDNA Synthesis Mix kit, and 2 × TSINGKE Master qPCR Mix (SYBR Green I) kit (Tsingke, Tianjin, China); and IL‐6, IL‐10, TNF‐α, and NF‐κB enzyme‐linked immunosorbent assay (ELISA) kits (Elabscience, Wuhan). The main instruments include a Morris water maze video analysis system (Beijing Zhongshi Dichuang Technology Development Co. Ltd.), a small animal magnetic resonance imaging system (Bruker, Germany), a gel imaging system (Bio‐Rad, USA), a real‐time fluorescence‐based quantitative PCR detection instrument (ABI, USA), and a transmission electron microscope (Hitachi, Japan).

2.3. Methods

2.3.1. Blood Glucose Measurement

After the mice were assigned to their respective groups, a 6‐h fast (20:00–2:00 the next day) was implemented before blood glucose testing, and 2% lidocaine gel (Sigma; L5647) was applied topically to reduce stress hyperglycemia prior to tail blood collection, and their tails were wiped with 75% medical alcohol. Following vein dilation, the tail vein was punctured using a blood collection needle. Fasting blood glucose levels were measured from the tail vein while the mice were awake and calm, using a blood glucose meter. The measurement was performed twice for each mouse, and the average value was recorded.

2.3.2. Water Maze Test

The Morris water maze (MWM) consisted of two parts: a place navigation experiment and a spatial exploration experiment. Initially, mice were placed in the pool for a 1‐min free swim without a platform to allow them to familiarize themselves with the maze. Afterward, the mice were placed on the platform for 10 s to associate the platform with escape. Subsequently, mice were released facing the wall from quadrant I (the farthest from the platform), and the timer started. The trial ended when the mouse climbed onto the platform and remained there for 5 s. If the mouse failed to reach the platform within 60 s, the latency was recorded as 60 s. After each trial, the mouse was placed on the platform for 10 s, dried, and returned to its cage. This process was repeated across the remaining three quadrants, with each mouse tested in all four quadrants daily for four consecutive days. On the fifth day, under the same environmental and water temperature conditions, the original platform was removed, and the mouse was released facing the wall from quadrant I for a single test. The swimming trajectory was recorded for 60 s. A video analysis system was used to track and record swimming behavior, trajectory, escape latency, the number of crossings over the original platform location, and other relevant indicators.

2.3.3. Magnetic Resonance Imaging (MRI) Examinations

MRI examinations were performed using a Bruker 7.0T small animal imaging system. Multi‐slice rapid acquisition with relaxation enhancement (RARE)‐T2 scans (coronal) and RARE‐T2‐Flair scans (axial, sagittal, and coronal) were conducted with the following parameters: TR (repetition time) = 2743.9625 ms, echo train length = 8, TE (echo time) = 33 ms, field of view (FOV, rectangular) = 20 × 20 mm, matrix size = 256 × 256 × 18, and voxel size = 0.078125 × 0.078125 × 0.6 mm. Each scan took approximately 14 min for the RARE‐T2 scan and 15 min for the RARE‐T2‐Flair scan.

2.3.4. Hematoxylin–Eosin Staining

The fresh mouse brain tissue was fixed in 10% formalin, embedded in paraffin, and sectioned. The sections were then deparaffinized and rehydrated through a graded alcohol series for 30 min. After two washes with phosphate‐buffered saline (PBS), the sections were stained with hematoxylin for 5 min to highlight the nuclear components. Subsequently, the sections were rinsed with water and stained with 1% aqueous eosin solution for 5 min to stain the cytoplasm.

2.3.5. Observation Under Transmission Electron Microscope

The brain tissue was fixed in 1% osmium tetroxide solution prepared in 0.1 M phosphate buffer (pH 7.4) for 2 h in the dark at room temperature. After fixation and dehydration, the tissue was infiltrated, embedded, and sectioned. The sections were then stained with 2% uranyl acetate followed by 2.6% lead citrate. Finally, the specimens were examined under a transmission electron microscope.

2.3.6. Western Blot Analysis

The brain tissues were lysed using a lysis buffer containing phenylmethylsulfonyl fluoride (PMSF). Protein quantification was performed with a bicinchoninic acid (BCA) protein assay kit to measure the total protein concentration. After denaturation at 95°C for 5 min, the protein samples underwent sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‐PAGE). The proteins were then transferred to a polyvinylidene fluoride (PVDF) membrane and blocked with 5% non‐fat dry milk. The membrane was incubated overnight at 4°C with primary antibodies targeting occludin, ZO‐1, VEGF‐A, RIP1, RIP3, MLKL, and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) (the dilution ratios are presented in Table 1). Following washes with phosphate‐buffered saline with Tween 20 (PBST), the membrane was incubated with horseradish peroxidase (HRP)‐conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized by exposing the membrane to a chemiluminescent reagent for 2.0 s, and the gray values of the bands were analyzed using ImageJ 2.0 software.

TABLE 1.

Antibody dilution ratios.

Antibody	Product number	Origin	Ratio
Occludin	27260‐1‐AP	Proteintech	1:1000
ZO‐1	21773‐1‐AP	Proteintech	1:1000
VEGFA	ab46154	Abcam	1:1000
Actin	66009–1‐IG	Proteintech	1:5000
RIP1	bs‐5805R	Bioss	1:500
RIP3	bs‐3551R	Bioss	1:500
p‐MLKL	AF7420	Affinity	1:1000
Actin	66009‐1‐IG	Proteintech	1:5000
PE goat anti‐mouse IgG (H&L)	115‐035‐003	Jackson	1:10 000
Goat anti‐rabbit IgG (H+L)	111‐035‐003	Jackson	1:10 000

Note: Electrophoresis conditions: 10% separation gel, 4% concentration gel, 30 μg total protein per well. Wet transfer method (100 V, 90 min, 4°C), PVDF membrane (0.45 μm; Millipore).

2.3.7. Real‐Time Fluorescence‐Based Quantitative PCR Detection (RT‐qPCR)

Total RNA was extracted using the TsingZol Total RNA Extraction Reagent kit in conjunction with the Trizol method. The extracted RNA was then reverse transcribed into complementary deoxyribonucleic acid (cDNA) using the SynScript III cDNA Synthesis Mix kit. The resulting cDNA was amplified and detected with the 2 × TSINGKE Master qPCR Mix kit on a fluorescence‐based quantitative PCR instrument. The PCR reaction conditions were as follows: initial denaturation at 95°C for 1 min (one cycle), followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 15 s. The data were collected and analyzed (the primer sequences are presented in Table 2).

TABLE 2.

Primer pairs and primer sequence table.

Name	Sequence (5′–3′)	Size (bp)
Musβ‐actin	CACGATGGAGGGGCCGGACTCATC	240
	TAAAGACCTCTATGCCAACACAGT
MusRIP1	GGAGTACATGGAGAAGGGCA	152
	TCTCAGGCTTCAGGTCCTTG
MusRIP3	GTACTTGGACCCAGAGCTGT	156
	CTGTCACACACTGTTTCCCG
MusMLKL	AAGAAGAACCTGCCCGATGA	237

2.3.8. Immunohistochemistry

After deparaffinization, paraffin‐embedded sections underwent antigen retrieval using an electric ceramic heater. Endogenous peroxidase activity was subsequently blocked. The sections were then incubated with primary antibodies against RIP1, RIP3, and MLKL in PBS containing 3% bovine serum albumin (BSA) at 4°C overnight. Following this, the samples were incubated with a secondary anti‐rabbit antibody for 30 min at room temperature. The sections were then stained with 3,3′‐diaminobenzidine (DAB) chromogenic solution and counterstained with hematoxylin to visualize the nuclei. Finally, the images were analyzed under a microscope, with positive signals indicated by brown or brownish‐yellow staining.

2.3.9. Enzyme‐Linked Immunosorbent Assay (ELISA) Assay

The mice were anesthetized, and blood was collected from the abdominal aorta. Whole blood samples were left at room temperature for 2 h and then centrifuged at 3000 rpm for 10 min. The resulting serum supernatant was collected and stored at −80°C. Detection was carried out following the operational instructions of the ELISA mouse TNF‐α, mouse IL‐6, mouse IL‐10, and mouse NF‐κB ELISA kits.

3. Results

3.1. Blood Glucose Measurement

The fasting blood glucose levels of WT mice and db/db mice were 8.32 ± 0.46 and 25.38 ± 1.59 mmol/L, respectively. Compared to WT mice, db/db mice exhibited significantly higher fasting blood glucose levels, with statistically significant differences (p < 0.001).

3.2. Morris Water Maze Test

To assess the progressive effects of hyperglycemia on cognitive function in db/db mice with CSVD, we evaluated spatial learning and memory abilities in 8‐, 12‐, and 16‐week‐old WT and db/db mice using the MWM (results shown in Figure 1A,B). In db/db mice, escape latencies in the Morris water maze on Days 3 and 4 were longer, the percentage of time spent swimming in the target quadrant was lower, and the number of platform crossings was reduced compared to wild‐type (WT) mice (p < 0.001).

FIGURE 1.

(A, B) Impaired long‐term spatial memory in db/db mice. (A1) In the Morris water maze task, db/db‐8W, db/db‐12W, and db/db‐16W mice showed significantly longer escape latency on Days 3 and 4 compared to WT‐8W mice (p < 0.001). Additionally, db/db‐12W and db/db‐16W mice showed significantly longer escape latency on Day 4 in comparison to db/db‐8W mice (p < 0.001). (A2) Representative swimming trajectories on Day 4 in the Morris water maze task for mice from each group, showing variations in spatial memory performance. (B1) In the spatial exploration experiment, db/db‐8W, db/db‐12W, and db/db‐16W mice spent a significantly lower percentage of swimming time in the target quadrant compared to WT‐8W mice. Additionally, db/db‐16W mice spent a lower percentage of swimming time in the target quadrant compared to db/db‐8W mice. (B2) The spatial exploration experiment also showed that db/db‐8W, db/db‐12W, and db/db‐16W mice had fewer platform crossings than WT‐8W mice. Further, db/db‐12W and db/db‐16W mice showed fewer platform crossings compared to db/db‐8W mice. (B3) Representative swimming trajectories of mice from each group during the spatial exploration experiment, highlighting differences in spatial memory performance (*p < 0.05, **p < 0.01, and ***p < 0.001 indicate significant differences compared to WT‐8W mice; ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 indicate significant differences within db/db groups when compared to 8 week mice).

3.2.1. Water Maze Localization Navigation Experiment

(1) Comparison between groups: compared with WT‐8W mice, there was a statistically significant difference in the prolongation of water maze escape latency in db/db‐8W, db/db‐12W, and db/db‐16W mice on Day 2 (p < 0.05), and the water maze escape latency in db/db‐8W, db/db‐12W, and db/db‐16W mice on Days 3 and 4 was significantly prolonged (p < 0.001). (2) Comparison within groups: there was no significant difference in the water maze escape latency of WT mice of different weekly ages in Days 1–4 (p > 0.05); compared with db/db‐8W, the water maze escape latency of db/db‐12W and db/db‐16W mice in Day 4 was significantly prolonged (p < 0.001).

3.2.2. Water Maze Spatial Exploration Experiment

(1) Between‐group comparison: Compared with WT‐8W mice, there was a statistically significant difference in the percentage of swimming in the target quadrant in db/db‐8W, db/db‐12W, and db/db‐16W mice (p < 0.001), and the number of stage crossings in db/db‐8W, db/db‐12W, and db/db‐16W mice was significantly reduced (p < 0.001). (2) Within‐group comparisons: Compared with WT‐8W mice, WT‐16W mice had an increase in the percentage of swimming in the target quadrant and the number of stage crossings (p < 0.05); compared with db/db‐8W, db/db‐16W mice had a significant decrease in the percentage of swimming in the target quadrant (p < 0.01), and the number of stage crossings was significantly lower in db/db‐12W and db/db‐16W mice (p < 0.01, p < 0.001).

3.3. Imaging Findings of CSVD Mice Based on MRI

CSVD may represent manifestations of cerebral microvascular dysfunction and serve as an indicator of potential brain parenchymal injuries associated with various structural and functional alterations of small vessels. Figure 2 shows the MRI findings. Magnetic resonance imaging showed that 8‐, 12‐, and 16‐week‐old WT mice showed full brain tissue morphology in T2WI and FLAIR sequences, and no obvious abnormal signals were seen; the signals of 8‐ and 12‐week‐old db/db group mice in T2WI and FLAIR sequences were not significantly different from those of the WT group; and the 16‐week‐old db/db mice showed bilateral temporal lobe sulcus widening and mild temporal lobe atrophy, and enlargement of the four ventricles. In the coronal plane, a new onset of punctate low signal was seen in the T2WI image of db/db mice compared with 16‐week‐old WT mice.

FIGURE 2.

Cerebral imaging of mice in each group. In 16‐week‐old db/db mice, imaging revealed bilateral widening of the temporal lobe sulci, mild atrophy of the temporal lobe, and enlargement of the fourth cerebral ventricle. Arrows indicate the temporal lobe sulci and the fourth cerebral ventricle, highlighting these structural changes associated with disease progression in db/db mice.

3.4. Evaluation of Cerebral Microvascular Structure and Function by Hematoxylin–Eosin (HE) Staining and Western Blot

Cerebral microvasculature is a critical component of the blood–brain barrier, and its permeability reflects microvascular function. Blood–brain barrier permeability can be assessed through neuroimaging or biochemical methods. In this study, we evaluated cerebral microvascular function by performing western blot analysis of the expression of tight junction proteins (occludin and ZO‐1) and VEGF‐A in the blood–brain barrier (Figure 3).

FIGURE 3.

(A) Changes in cerebral microvascular structure in mice from each group. In WT mice, the frontal cortex showed a generally normal microvascular structure. In db/db‐8W mice, a small number of capillary dilatations were observed. The db/db‐12W mice displayed mild capillary endothelial proliferation and a few capillary dilatations. In db/db‐16W mice, capillary dilatation and a slight increase in capillary number were evident in brain tissue. Red arrows indicate capillary dilatation, while green arrows point to capillary endothelial proliferation. (B–D) Bar graphs showing expression levels of occludin, ZO‐1, and VEGF‐A in the brain tissues of each group (*p < 0.05, **p < 0.01, and ***p < 0.001 based on inter‐group comparison with WT‐8W mice. ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 based on intra‐group comparison with 8 week mice). (E) Western blot analysis of occludin, ZO‐1, and VEGF‐A protein expression levels in each group of mice.

3.4.1. Occludin, ZO‐1, and VEGFA Protein Expression

Occludin, ZO‐1 protein expression was significantly reduced in db/db‐8W, db/db‐12W, and db/db‐16W mice compared to WT‐8W mice (p < 0.001). ZO‐1 decreased to 0.68‐fold in the db/db‐16W group (vs. WT‐8W, p < 0.001), and occludin decreased to 0.48‐fold (vs. WT‐8W, p < 0.001). VEGFA protein expression was significantly higher in db/db‐8W, db/db‐12W, and db/db‐16W mice compared to WT‐8W mice (p < 0.001). A 2.87‐fold increase in VEGFA was observed in the db/db‐16W group (vs. WT‐8W, p < 0.001) reflecting that the blood–brain barrier integrity is severely compromised with the course of diabetes.

3.5. Observation of Neuronal Injury in Brain Tissue by Hematoxylin–Eosin Staining and Transmission Electron Microscopy

WT mice exhibited abundant and orderly arranged cells in the brain. However, db/db‐8W mice showed mild injury in the cerebral cortex, with some brain cells displaying darkly stained and pyknotic nuclei. The db/db‐12W mice displayed a clear disorder in the cerebral cortical cell arrangement, extensive cell injuries, and darkly stained, pyknotic nuclei. Meanwhile, db/db‐16W mice exhibited significant local brain tissue damage, destruction of the cortical structure, widespread cell injuries, and darkly stained and pyknotic nuclei (Figure 4A,B).

FIGURE 4.

(A, B) HE staining results of the frontal cortex in each mouse group. In (A) 100× light microscopy and (B) 200× light microscopy images, black arrows indicate areas of cortical injury, while red arrows highlight pyknotic nuclei. (C) Electron microscopy observation of the ultrastructure of hippocampal neurons in each group. Red arrows point to the nucleus, and blue arrows indicate mitochondria in the hippocampal neurons, displaying structural changes across groups.

Under electron microscopy, all WT mice showed intact nuclear and nuclear membrane structures, with round or short rod‐shaped mitochondria in the cytoplasm, and most cytoplasmic structures were intact. However, the db/db‐8W mice exhibited vacuolar degeneration of mitochondria in the cytoplasm, with some mitochondria undergoing autophagy. The db/db‐12W mice showed disrupted organelle structures in the cytoplasm and visible autophagosomes. At later stages of mitochondrial swelling in db/db‐12W mice, the double‐membrane structure was disrupted. The db/db‐16W mice displayed a reduced number of organelles in the field of view, visible autophagosomes, ruptured nuclear membrane structures with unclear boundaries, and extensive vacuolar degeneration of mitochondria at the later stages of mitochondrial swelling (Figure 4C).

3.6. Detection of mRNA Expression Levels of RIP1, RIP3, and MLKL via RT‐qPCR

Detection of necroptosis markers in the brain tissues of db/db mice was conducted, focusing on the mRNA expression levels of RIP1, RIP3, and MLKL (Figure 5).

FIGURE 5.

Bar graph showing the mRNA expression levels of (A) RIP1, (B) RIP3, and (C) MLKL in brain tissues across each mouse group. Significant differences are indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001 for comparisons with WT‐8W mice; ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 for comparisons within db/db groups across different ages.

3.6.1. RIP1 mRNA Expression

mRNA expression of RIP1 was significantly higher in db/db‐8W, db/db‐12W, and db/db‐16W mice compared to WT‐8W mice (p < 0.001). db/db‐8W expression was elevated to 1.85‐fold; db/db‐12W group: expression was elevated to 3.02‐fold; db/db‐16W group: expression was elevated to 4.15‐fold (p < 0.001), indicating a significant enhancement of necrotic apoptotic signaling late in the course of diabetes.

3.6.1.1. The mRNA Expression of RIP3

Compared with WT‐8W mice, the mRNA expression of RIP3 was increased in db/db‐8W mice (p < 0.05); the mRNA expression of RIP3 was significantly increased in db/db‐12W and db/db‐16W mice (p < 0.001). db/db‐12W group: The expression was elevated up to 2.45‐fold (p < 0.001). db/db‐16W group: Further elevated to 3.12‐fold (p < 0.001).

3.6.1.2. MLKL mRNA Expression

Compared with WT‐8W mice, the mRNA expression of MLKL in db/db‐8W, db/db‐12W, and db/db‐16W mice was significantly higher (p < 0.001). mLKL expression in the db/db group showed a stepwise increase (2.18‐fold → 4.02‐fold) with the disease duration (8 weeks → 16 weeks), suggesting that the longer the duration of disease, the more irreversible the cell death.

3.7. Detection of Expression Levels of RIP1, RIP3, and MLKL Proteins Using Western Blot Analysis

Detection of RIP1, RIP3, and MLKL protein expression levels, markers of necroptosis, in the brain tissues of db/db mice was performed using western blot analysis (Figure 6).

FIGURE 6.

(A–C) Bar graphs showing the protein expression levels of (A) RIP1, (B) RIP3, and (C) MLKL in brain tissues of each mouse group. Significant differences are denoted as follows: *p < 0.05, **p < 0.01, and ***p < 0.001 for inter‐group comparisons with WT‐8W mice; ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 for intra‐group comparisons with db/db‐8W mice. (D) Western blot analysis showing the expression levels of RIP1, RIP3, and MLKL proteins in the brain tissues of each group.

3.7.1. Protein Expression of RIP1

The protein expression of RIP1 was significantly higher in db/db‐8W, db/db‐12W, and db/db‐16W compared to WT‐8W mice (p < 0.001). db/db‐16W group: 3.65‐fold (vs. WT‐8W, p < 0.001), and RIP1 was significantly elevated in a time‐dependent manner in diabetes models (8 weeks → 16 weeks), suggesting significant activation of the necroptotic apoptotic pathway with disease progression in diabetic model mice.

3.7.2. Protein Expression of RIP3

Compared with WT‐8W mice, the protein expression of RIP3 was significantly higher in db/db‐8W, db/db‐12W, and db/db‐16W mice (p < 0.001). db/db‐8W group: RIP3 was elevated up to 1.53‐fold (p < 0.001), which indicated that the necroptotic apoptotic pathway was activated at the early stage of diabetes. db/db‐16W group: RIP3 was elevated to 1.53‐fold (p < 0.001), suggesting that necroptosis was activated in the early stage of diabetes. db/db‐16W group: RIP3 was significantly elevated in the early stage of diabetes. db/db‐16W group: RIP3 was further elevated to 1.89‐fold (p < 0.001), suggesting that the prolonged hyperglycemic environment exacerbated the persistent activation of the necrotic apoptotic pathway.

3.7.3. Protein Expression of MLKL

The protein expression of MLKL was significantly higher in db/db‐8W, db/db‐12W, and db/db‐16W mice compared with that in WT‐8W mice (p < 0.001). db/db‐8W group: MLKL was elevated to 2.01‐fold (p < 0.001), and the doubled expression of MLKL suggests that necrotic apoptotic signaling has been delivered to the downstream executive stage, which may directly lead to the disruption of cell membrane integrity, and MLKL was elevated to 3.12‐fold when the disease progressed to 16 weeks, suggesting that persistent metabolic disturbances triggered the accumulation of irreversible cell death.

3.8. Detection of Expression Levels of RIP1, RIP3, and MLKL Using Immunohistochemical Staining

The expression levels of RIP1, RIP3, and MLKL in the frontal cortex of mice from each group were observed using immunohistochemical staining (Figure 7).

FIGURE 7.

Immunohistochemical staining and optical density analysis of RIP1, RIP3, and MLKL in the frontal cortex of mice in each group: (A) RIP1, (B) RIP3, and (C) MLKL (*p < 0.05, **p < 0.01, and ***p < 0.001 based on inter‐group comparison with WT‐8W mice. ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 based on intra‐group comparison with 8 week mice).

3.8.1. Immunohistochemical Staining for RIP1

RIP1 expression was significantly higher in db/db‐12W and db/db‐16W mice compared to WT‐8W mice (p < 0.001). db/db‐12W group: 1.86‐fold (vs. WT‐8W, p < 0.001), db/db‐16W group: 2.69‐fold (vs. WT‐8W, p < 0.001). Immunohistochemical staining deepened, and the number of positive cells increased.

3.8.2. Immunohistochemical Staining for RIP3

RIP3 expression was significantly higher in db/db‐16W mice compared to WT‐8W mice (p < 0.001). db/db‐16W group: 2.81‐fold (vs. WT‐8W, p < 0.001). Immunohistochemical staining deepened, and the number of positive cells increased.

3.8.3. Immunohistochemical Staining of MLKL

MLKL expression was increased in db/db‐12W mice compared with WT‐8W mice (p < 0.05); MLKL expression was significantly increased in db/db‐16W mice (p < 0.001). db/db‐12W group: 1.86‐fold (vs. WT‐8W, p < 0.05), db/db‐16W group: 2.64‐fold (vs. WT‐8W, p < 0.001). Immunohistochemical staining deepened and the number of positive cells increased.

3.9. Detection of Plasma Levels of IL‐6, IL‐10, TNF‐α, and NF‐κB Using ELISA

Plasma levels of IL‐6, IL‐10, TNF‐α, and NF‐κB were measured in mice from each group using ELISA (Figure 8).

FIGURE 8.

Bar graphs of plasma (A) IL‐6, (B) IL‐10, (C) TNF‐α, and (D) NF‐κB concentrations in mice of each group (*p < 0.05, **p < 0.01, and ***p < 0.001 based on inter‐group comparison with WT‐8W mice. ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 based on intra‐group comparison with 8 week mice).

3.9.1. IL‐6 Plasma Level Assay

Plasma levels of IL‐6 were increased in db/db‐12W mice compared to WT‐8W mice (p < 0.01); plasma levels of IL‐6 were significantly increased in db/db‐16W mice (p < 0.001). WT‐16W: IL‐6 concentration was elevated 2.22‐fold compared to WT‐8W (p < 0.01) suggesting natural accumulation of low‐grade inflammation during aging, but to a much lesser extent than in the diabetic model (3.81‐fold vs. 2.22‐fold), reflecting that long‐term metabolic disorders lead to continuous amplification of inflammatory signals.

3.9.2. Plasma TNF‐α Content Assay

Compared with WT‐8W mice, plasma TNF‐α content in db/db‐12W and db/db‐16W mice was significantly higher (p < 0.001). Plasma TNF‐α content in db/db mice showed a stepwise increase (1.95‐fold → 4.23‐fold) with the disease duration (8 weeks → 16 weeks).

3.9.3. Plasma NF‐κB Content Assay

Compared with WT‐8W mice, the plasma levels of NF‐κB in db/db‐12W and db/db‐16W mice were significantly higher (p < 0.001). db/db mice showed a stepwise increase (1.90‐fold → 3.56‐fold) in plasma NF‐κB content with disease duration (8 weeks → 16 weeks), suggesting that early inflammation activation and late uncontrolled inflammation lead to increased tissue damage.

3.9.4. Plasma IL‐10 Content Assay

Compared with WT‐8W mice, the plasma content of IL‐10 in db/db‐16W mice was significantly higher (p < 0.001). It was suggested that the inflammatory response was continuously enhanced, balancing the pro‐inflammatory effects of IL‐6, NF‐κB and TNF‐α by enhancing anti‐inflammatory signaling.

4. Discussion

This study revealed key evidence that diabetes (db/db mouse model) exacerbates cerebral small‐vessel vascular disease (CSVD)‐related cognitive deficits through necrotic apoptosis and inflammatory mechanisms through a combined multi‐omics analysis: (1) Cognitive and imaging changes: db/db mice exhibited significant spatial memory deficits in the Morris water maze (MWM), and MRIs showed the presence of 16‐week‐old temporal lobe and hippocampal atrophy and enlargement of the fourth ventricle at 16 weeks of age, suggesting typical imaging features of CSVD. (2) Microvascular pathology: HE staining showed that prefrontal cortical capillary dilatation, endothelial hyperplasia, and increased number in db/db mice, which gradually worsened along with the progression of the disease, suggesting that diabetes drives microvascular remodeling and dysfunction. (3) Activation of necrotic apoptosis: The mRNA and protein expression levels of RIP1, RIP3, and MLKL in the brain tissues of db/db mice increased linearly with the course of the disease, and immunohistochemistry showed a significant increase in the number of positive cells, suggesting that necrotic apoptosis is an important mechanism of cognitive impairment associated with CSVD. (4) Inflammatory cascade response: Plasma levels of pro‐inflammatory factors (IL‐6, TNF‐α, NF‐κB) increased significantly with the progression of diabetes mellitus, whereas the anti‐inflammatory factor IL‐10 was compensatory up‐regulated, reflecting the central role of inflammatory imbalance in cognitive impairment.

The MWM is a classic cognitive and behavioral task used to assess spatial learning and memory in experimental animals. The results from the MWM conducted in this study revealed that db/db mice exhibited longer escape latency, shorter time spent in the target quadrant, and fewer platform crossings, indicating impaired spatial memory of the underwater platform location. These findings suggest a significant interaction between diabetes mellitus and disease duration in db/db mice.

In line with previous research, it can be concluded that patients with diabetes are at higher risk for cognitive impairment, with both hyperglycemia and the duration of diabetes being associated with cognitive decline [4, 5, 6]. Earlier studies have shown that 12‐week‐old db/db mice exhibited significantly increased MWM latency, while 24‐week‐old db/db mice showed reduced path efficiency, and 26‐week‐old db/db mice showed significantly increased MWM latency on Days 2–4 [7, 8]. Our findings are consistent with these observations.

Memory impairment in db/db mice was found to be dependent on disease duration, while WT mice did not exhibit age‐dependent memory impairment based on their performance. This discrepancy, as revealed in this study, may be explained by three factors: (1) WT mice retained memory from previous tasks, whereas db/db mice did not, suggesting a lack of positive transfer of training in db/db mice; (2) WT mice were only observed for 16 weeks, and the effects of age on memory impairment may not have fully manifested. Future studies may extend the observation period for WT mice; (3) The learning performance in the MWM of db/db mice deteriorated with increasing diabetes duration.

According to MRI results in this study, 16‐week‐old db/db mice exhibited atrophy in the temporal lobe and hippocampus, as well as enlargement of the fourth cerebral ventricle, compared to WT mice. These experimental findings indicate the occurrence of CSVD in db/db mice at 16 weeks of age. MRI indications suggest that CSVD represents the end‐stage condition resulting from small vessel disease in the brain, with these imaging findings reflecting brain parenchymal injuries potentially linked to structural and functional changes in the brain's small blood vessels. Based on the analysis in this study, the occurrence of CSVD in db/db mice was concluded to be associated with hyperglycemic stimulation. First, CSVD features were linked to increased blood–brain barrier permeability [9]. The integrity of the blood–brain barrier was not significantly abnormal in white matter with a normal appearance, but disruption occurred near white matter hyperintensities. Furthermore, this disruption correlated with the severity of white matter hyperintensities that appeared over time [9]. CSVD features progressed linearly with elevated blood glucose levels and were associated with blood glucose levels [10, 11]. Second, hippocampal atrophy may result from microvascular alterations in mice with T2DM [12]. Studies have shown that MRI of T2DM mice revealed a significant reduction in cortical volume, and two studies from Fudan University reported hippocampal atrophy and ventricular enlargement in aged mice with diabetes [13, 14, 15]. These findings align with this study, suggesting that diabetes mellitus may cause microvascular lesions leading to CSVD‐like manifestations.

The progressive changes in microvascular morphology of the frontal cortex in db/db mice were observed in this study using HE staining. The results showed that, compared with WT mice, db/db mice gradually developed capillary dilation, capillary endothelial proliferation, and an increased capillary number in the frontal cortex at 8, 12, and 16 weeks of age. Additionally, the vascular lesions showed progressive aggravation. T2DM‐induced cognitive impairment potentially involves multiple underlying mechanisms. A growing body of evidence suggests that microvascular dysfunction may be one of these mechanisms [16, 17]. Morphologically, changes in the cerebral microcirculation in patients with diabetes include substrate membrane thickening and increased angiogenesis. Based on the analysis, this phenomenon can be attributed to the following causes: (1) Under the combined influence of diabetes mellitus and its duration, the microvasculature of the frontal cortex in db/db mice generally exhibited a hyperplastic state, manifested as capillary endothelial proliferation and an increased capillary number. Previous studies have shown that the substrate membrane of cerebral microvasculature in patients with diabetes is significantly thickened [18]. The db/db mice experience increased microvascular density, an increase in the density of penetrating arteriole branches, as well as cerebral neovascularization and remodeling [19]. (2) Neovascular dysfunction in db/db mice. Studies have found that T2DM leads to an increase in cerebral neovascularization in db/db mice, but with impaired function [20]. A subsequent study provided evidence that T2DM rats experienced increases in the number of collateral vessels and vascular tortuosity. However, such newly formed blood vessels exhibited poor wall maturity, as evidenced by reduced pericytes and increased vascular permeability [21]. These factors contribute to changes in the structure of the microvasculature in patients with diabetes, leading to the occurrence of CSVD.

The formation of cerebral capillaries is mediated by vascular endothelial growth factor (VEGF) and the Wnt signaling pathway. Endothelial cells are interconnected by specific tight junction proteins, such as occludin and ZO‐1, which form a high‐resistance cellular barrier. In this study, we found that, compared with those in WT‐8W mice, the expression levels of occludin and ZO‐1 proteins gradually decreased, while the expression levels of VEGF‐A protein gradually increased in 12‐week‐old and 16‐week‐old db/db mice. These findings suggest that, with the progression of diabetes mellitus, the blood–brain barrier function in db/db mice is progressively impaired, leading to cognitive impairment in these mice. Based on the analysis, we attributed these findings to the following causes: (1) The blood–brain barrier permeability in diabetic mice is significantly increased. Studies have shown that the expression levels of VEGF‐A, occludin, and ZO‐1 were significantly decreased in 8‐week‐old mice with diabetes [22]. Salameh et al. observed under electron microscopy that mice with diabetes exhibited shortened electron density of tight junctions/adherens junctions [23]. Additionally, MRI assessments of blood–brain barrier permeability in a rat model with T2DM revealed that 84% of rats with T2DM exhibited significant changes in cerebral blood–brain barrier integrity [24]. (2) Blood–brain barrier dysfunction in mice with diabetes precedes cognitive decline and neurodegeneration. Studies have shown that occludin‐1, a blood–brain barrier protein, was significantly reduced by 35% in mice with diabetes compared to the control group. After 24 weeks, these diabetic mice exhibited significant deterioration in cognitive function and extensive neurodegeneration, both of which were significantly correlated with increased blood–brain barrier permeability [25]. Therefore, as diabetes mellitus progresses, microvascular dysfunction gradually emerges in the brains of db/db mice.

The cortical brain tissue damage, injured cells, and pyknotic nuclei in db/db mice were observed under light microscopy. Under electron microscopy, db/db mice exhibited vacuolar degeneration of mitochondria in the hippocampal cytoplasm, disruption in mitochondrial double membrane structures, a reduced number of organelles in the field of view, and ruptured nuclear membranes with unclear boundaries. These pathological changes worsened as the disease progressed. These findings reflect neuronal injury caused by the diabetic process in db/db mice and severe damage to the subcellular structures of hippocampal neurons, consistent with the characteristics of necroptosis. Analysis revealed that diabetes mellitus may lead to ultrastructural injury in brain tissue. Significant neuronal loss in the hippocampus was found in this study in comparison to controls [26]. Nissl staining revealed that 18‐ and 26‐week‐old db/db mice exhibited pyknotic nuclei in brain neurons, sparse Nissl bodies, and abnormal staining [27]. Furthermore, diabetes mellitus may impair autophagy in brain tissue. Ultrastructural analysis by Zhang et al. revealed that db/db mice exhibited significantly swollen nerve cells, reduced formation of autolysosomes, and decreased intracellular organelles and mitochondria; all these findings are consistent with those found in this study [28].

Ultrastructural damage such as mitochondrial vacuolization and nuclear membrane rupture in the hippocampus of db/db mice in the present experiments is consistent with the features of necrotic apoptosis, which may directly lead to the loss of hippocampal neurons and abnormal synaptic function. The findings indicate that in db/db mice, the mRNA and protein levels of RIP1, RIP3, and MLKL in the brain tissue exhibited a linear increase with the development of diabetes mellitus and were significantly higher than those in WT mice. Immunohistochemical staining also revealed a significant increase in the number of RIP1‐, RIP3‐, and MLKL‐positive cells, along with darker staining in the frontal cortex of db/db mice. These results suggest that diabetes mellitus may promote the occurrence of CSVD‐associated cognitive impairment in mice through necroptosis. Based on the analysis, these findings can be attributed to the following causes: First, glucose and its metabolism play a crucial role in driving necroptosis. Larocca et al. found that hyperglycemia, which upregulates necroptosis and shifts from apoptosis to necroptosis, is associated with increased expression levels of RIP1, RIP3, and MLKL proteins [29]. Studies have shown that the intensity of necroptosis is closely related to high glucose levels, and hyperglycemia can enhance necrosis. Second, necroptosis plays an important role in the pathogenesis of cognitive impairment [30]. Some scholars have observed that the mRNA levels of p‐RIPK1, p‐RIPK3, and p‐MLKL in the hippocampal tissue of mice with T2DM, as well as the relative protein abundance, were significantly higher than those in normal age‐matched controls [31]. It was found in this study that necroptosis has a longer active duration in the hippocampus compared to other brain regions, which results in the hippocampus being more vulnerable to necroptosis [32]. Evidence suggests that necroptosis of neurons may lead to neuronal loss in the early stages of Alzheimer's disease (AD), and necroptosis markers are correlated with disease stages [33, 34]. In the early stages of AD, necroptosis markers are involved in AD degeneration before the detection of Aβ plaques in the brain [35, 36, 37]. Inhibition of necroptosis can alleviate Aβ‐induced neurodegeneration and memory impairment in mice and zebrafish [33, 38, 39]. Therefore, it is concluded that necroptosis plays an important role in CSVD‐associated cognitive impairment in patients with diabetes. The present study suggests that diabetes exacerbates CSVD‐associated neuronal damage through a similar mechanism, providing a theoretical rationale for targeting necrotic apoptotic pathways such as RIP1 inhibitors.

The findings in this study revealed that, in comparison to 8‐week‐old WT mice, 12‐week and 16‐week‐old db/db mice exhibited significantly higher plasma levels of IL‐6, TNF‐α, and NF‐κB. Moreover, 16‐week‐old db/db mice showed elevated plasma levels of IL‐6, TNF‐α, and NF‐κB compared to younger db/db mice. These results suggest that IL‐6, TNF‐α, and NF‐κB promote neuroinflammation by activating microglia and disrupting the integrity of the blood–brain barrier (BBB); whereas compensatory elevations in IL‐10 may reflect the body's attempt to suppress excessive inflammatory responses. However, as diabetes progresses, the continued dominance of pro‐inflammatory signals (IL‐6, TNF‐α) eventually overwhelms anti‐inflammatory mechanisms, leading to chronic neuroinflammation and cognitive decline. Analysis reveals that T2DM, as a chronic metabolic disease, leads to the release of various cytokines by immune cells, which in turn causes neuroinflammation. Neuroinflammation, including the activation of glial cells and the secretion of inflammatory cytokines, is increasingly recognized as a potential underlying mechanism for diabetes mellitus‐related cognitive impairment [40].

4.1. IL‐6

Elevated levels of IL‐6 can induce neuroinflammation and damage the myelin structure of neurons, further compromising brain function [41]. Studies have shown that patients with T2DM and cognitive impairment have higher serum IL‐6 levels, and this increase is negatively correlated with cognitive performance, as measured by the Montreal Cognitive Assessment (MoCA) score [42, 43]. IL‐6 signaling also upregulates vascular endothelial cell adhesion molecules, a hallmark of the early stages of inflammation, leading to increased vascular permeability and contributing to cognitive decline in patients with T2DM [44].

4.2. TNF‐α

Increased TNF‐α levels are associated with cognitive decline, partly due to their role in enhancing the reactivity of microglia and astrocytes in the brain [45]. Several animal studies have shown that pro‐inflammatory cytokines like IL‐6 and TNF‐α are significantly elevated in diabetic models, such as in streptozotocin (STZ)‐induced diabetic rats and db/db mice [27, 46]. Moreover, TNF‐α and IL‐6 levels tend to increase with the progression of diabetes, aligning with the findings observed in this study [47].

4.3. NF‐κB

Intracerebral TNF‐α induces JNK‐mediated intracerebral insulin resistance, contributing significantly to both T2DM and its associated cognitive impairment. Chronic inflammation results in the secretion of NF‐κB, TNF‐α, and other pro‐inflammatory factors by microglia and astrocytes. These factors cross the blood–brain barrier, exerting neurotoxicity and leading to cognitive impairment in patients with diabetes [48]. The levels of these inflammatory mediators serve as key indicators of both the inflammatory response and the severity of the disease.

Based on the above analysis, it can be concluded that the inflammatory processes involving IL‐6, TNF‐α, and NF‐κB are closely linked to the progression of cognitive impairment in diabetic mice.

This experimental study suggests that diabetes mellitus may contribute to the clinical and pathological damage observed in patients with CSVD through mechanisms involving necroptosis and inflammation. Further investigations are required to conclusively identify and understand these risk factors.

There were some limitations in the present study. First, only male db/db mice were used in this study, and female individuals were not included, and sex differences may influence metabolic and inflammatory responses [49]. Additional comparative sex analyses are needed in the future. Second, WT mice were observed only up to 16 weeks, failing to reveal the long‐term effects of aging on cognitive function; late pathology (e.g., after 26 weeks) in db/db mice still needs to be followed up further. Third, despite the finding of necrotic apoptosis and inflammatory marker changes, intervention experiments with specific pathway inhibitors (e.g., RIP1 inhibitors) are lacking to clarify causality.

The db/db model mainly simulates type 2 diabetes, whereas human CSVD is often accompanied by multifactorial interactions such as hypertension and atherosclerosis, and conclusions need to be validated in more complex models.

Inhibition of the RIP1/RIP3 pathway (e.g., necrostatin‐1) has been shown to be neuroprotective in AD models, and this study supports the prospect of its similar application in diabetes‐related CSVD. In the future, multifactorial cohort studies should be conducted to longitudinally monitor plasma IL‐6 and TNF‐α levels and brain imaging changes in diabetic patients to clarify the correlation between inflammatory markers and CSVD progression.

Author Contributions

Conception and design of the research: Dan‐Qiong Wang, Xin Li, and Lei Wang. Acquisition of data: Dan‐Qiong Wang, Tao Li, and Na An. Analysis and interpretation of the data: Dan‐Qiong Wang, Ping Zhao, Tao Li, and Na An. Statistical analysis: Dan‐Qiong Wang, Yu‐Meng Gu, and Xiao‐Shuang Xia. Writing of the manuscript: Dan‐Qiong Wang. Critical revision of the manuscript for intellectual content: Xin Li, Ping Zhao, Yu‐Meng Gu, Xiao‐Shuang Xia, and Lei Wang. All authors read and approved the final draft.

Ethics Statement

This study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Shanxi Bethune Hospital (approval number: SBQKL‐2021‐060).

Consent

The authors have nothing to report.

Conflicts of Interest

The authors declare no conflicts of interest.

Wang D.‐Q., Wang L., Zhao P., et al., “Role of Necroptosis and Neuroinflammation in CSVD‐Associated Cognitive Decline in db/db Mice,” The FASEB Journal 39, no. 18 (2025): e70868, 10.1096/fj.202500772R.

Data Availability Statement

The datasets generated and/or analyzed during the current study are not publicly available due to the lack of an online platform but are available from the corresponding author on reasonable request.