Skip to main content
NCBI home page
Investigative Ophthalmology & Visual Science logoLink to Investigative Ophthalmology & Visual Science
. 2025 Sep 19;66(12):46. doi: 10.1167/iovs.66.12.46

Exon Skipping Therapy Restores Ciliary Function in USH2A-Related Retinal Degeneration

Wuyi Li 1, Yamei Li 1, Yunyu Zhou 1, Yue Liu 1, Huixin Liu 1, Xing Wei 1, Zixi Sun 1, Xiaoxu Han 1, Xuan Zou 1, Hui Li 1, Ruifang Sui 1,✉
PMCID: PMC12453064  PMID: 40970667

Abstract

Purpose

This study aimed to evaluate the exon-skipping efficacy and safety of an antisense oligonucleotide (AON) targeting USH2A exon 13 across multiple models, including the Rb1 cell line, humanized USH2A-e13 transgenic mice, and patient-derived retinal organoids. Additionally, we investigated the pathogenic mechanisms of USH2A variants and the therapeutic effects of exon skipping on photoreceptor cilia structure and function.

Methods

Bioinformatic tools were used to design AONs targeting USH2A exon 13, and their exon-skipping efficiency was assessed at both RNA and protein levels in Rb1 cells. A humanized USH2A-e13 transgenic mouse model was generated via gene editing and received intravitreal AON injections. Retinal distribution, exon-skipping efficiency, and toxicity were evaluated through fundus fluorescence imaging, immunofluorescence staining, droplet digital PCR (ddPCR), Western blot (WB), apoptosis assays, and electroretinography (ERG). Patient-derived induced pluripotent stem cells (iPSCs) were differentiated into retinal organoids and analyzed using transcriptomic profiling, immunofluorescence, ddPCR, WB, apoptosis assays, and transmission electron microscopy (TEM).

Results

PUMCH-E13 effectively induced exon 13 skipping in the Rb1 cell line, USH2A-e13 mice (44.44% ± 1.61% reduction), and patient-derived retinal organoids (16.4% ± 4.1% reduction). No significant adverse effects were observed through apoptosis assays or ERG. Additionally, treatment with PUMCH-E13 resulted in the restoration of GPR98 and PDZD7 expression within the USH2 complex, alongside the reorganization of microtubule structures in the photoreceptor cilia.

Conclusions

PUMCH-E13 effectively induces exon 13 skipping in USH2A with low toxicity. Additionally, PUMCH-E13 can promote the restoration of photoreceptor cilia structure in patient-derived retinal organoids, revealing its potential therapeutic mechanism.

Keywords: antisense oligonucleotide, USH2A, exon 13, Usher syndrome (USH), retinal degeneration, exon skipping, retinal organoids

Usher syndrome (USH) is an autosomal recessive genetic disease characterized by sensorineural hearing loss and retinitis pigmentosa, leading to hearing loss, reduced visual field, and visual impairment.1 The condition is clinically classified into three subtypes (USH1, USH2, and USH3), based on the severity of symptoms.1,2 USH2 is the most prevalent subtype, with variants in the USH2A gene (OMIM: 608400) found in 58% to 90% of patients with this form.3–5 The USH2A-encoded usherin protein localizes to the photoreceptor connecting cilium. The laminin-type epidermal growth factor-like (LE) repeats in usherin extracellular domain interact with matrix proteins, such as collagen IV and fibronectin, playing a crucial role in maintaining ciliary stability.6,7 Notably, exon 13 of USH2A encodes the LE 4-8 domains and contains frequent pathogenic variants, such as c.2299delG (24.5% allele frequency) and c.2802T>G (7%–10% allele frequency).3,8–12 The high frequency of pathogenic variants and the characteristics of multiples of triplet codons make exon 13 an ideal target for gene therapy. The repetitive domain of usherin can be skipped through the exon skipping strategy, thereby preserving most of the protein’s function.

Antisense oligonucleotide (AON) achieves exon skipping by regulating pre-mRNA splicing, providing a new strategy for restoring usherin function. AONs target pre-mRNA splicing sites or regulatory regions and can induce exon skipping to restore open reading frames.13–16 Pendse et al. demonstrated that exon 13 skipping enables the synthesis of a shorter usherin, which restores the function of photoreceptors and the retina.17 QR-421a (Ultevursen), developed by ProQR, can skip exon 13 in USH2A, with its efficacy, safety, and tolerability preliminarily validated in animal studies and clinical trials (NCT06627179).18–22 Although AON has exhibited potential for clinical gene therapy, its therapeutic efficiency still requires optimization. Whereas zebrafish and mouse models provide a rapid screening system for ophthalmic drugs,23–27 species-specific gene sequence differences (such as QR-421a targeting exon 12 in mice) complicate the accurate prediction of AON splicing efficiency in human usherin.17,28 This limitation prompted us to construct a humanized USH2A-e13 mice model and replace mice Ush2a exons 10 to 15 with human sequences to achieve an accurate evaluation of targeted therapeutic efficacy.

Existing animal models of USH2A, such as Ush2a knockout mice and zebrafish, fail to accurately replicate the phenotypic characteristics of patients with USH2A variants due to the slower degeneration of photoreceptor cells.29 Patient-derived induced pluripotent stem cell (iPSC)-differentiated retinal progenitor cells (60 days) had not yet formed a structured retinal architecture or a functional USH2 protein network, limiting the previous study of AON therapeutic mechanisms to the mRNA level.30 Patients with USH2A variants retinal organoids constructed by Guo et al. revealed that structure abnormalities appeared at 34 days of differentiation.31 Mature retinal organoids (120 days) can express photoreceptor-specific markers (rhodopsin) and develop outer segment-like structures,32,33 providing a physiologically relevant in vitro model for investigating the pathogenic mechanisms of USH2A-related retinal degeneration and the therapeutic effects of AON. Based on this, the study analyzed the repair mechanism of AON on photoreceptor cell structure and pathways by sequentially intervening in the patient retinal organoid model.

This study aims to provide an effective AON strategy for the treatment of USH2A exon 13 through systematic research. The exon-skipping efficiency and safety of AON were validated in Rb1 cells and humanized USH2A-e13 transgenic mice, and the efficacy of in vivo AON injection was assessed in a relevant biological environment. This study investigates the therapeutic potential of PUMCH-E13 in repairing the microstructural damage and functional impairments in retinal organoids derived from patients with USH2A variants. Our findings demonstrate that PUMCH-E13 stabilizes and restores the USH protein complex while also promoting the reorganization of ciliary microtubules. These effects collectively contribute to the recovery of photoreceptor cell function and the restoration of retinal structure. These mechanisms provide important insights into how PUMCH-E13 may address the underlying cellular disruptions in retinal diseases caused by USH.

Methods

Antisense Oligonucleotide Design and Synthesis

AONs targeting USH2A exon 13 were designed using bioinformatics tools, considering sequence specificity, melting temperature, and GC content. Secondary structure predictions were performed, and AONs were chemically modified with gapmer structures incorporating 2'-OMe and 2'-MOE modifications. Synthesized AONs underwent quality control before experimental use. Detailed design and validation methods are provided in the Supplementary Methods.

Cell Culture, Transfection, and Molecular Analysis

Rb1 cells were cultured under standard conditions and transfected with AONs at concentrations ranging from 10 to 40 micromolar (µM). RNA extraction and droplet digital PCR (ddPCR) were performed to quantify exon 13 skipping efficiency, and Western blot (WB) was used to assess usherin protein expression. Fluorescence microscopy was used to examine AON localization. Detailed transfection conditions, RNA extraction, ddPCR, WB, and fluorescence imaging protocols are in the Supplementary Methods.

Humanized USH2A-e13 Mouse Model and In Vivo Analysis

A humanized USH2A-e13 transgenic mouse model was generated via clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-mediated gene editing. Intravitreal AON injections were performed, followed by fundus fluorescence imaging to examine retinal distribution. Exon 13 skipping efficiency was quantified using ddPCR and WB. Retinal structure was assessed by histology and immunofluorescence staining, and functional evaluation was conducted using electroretinography (ERG). Apoptosis analysis was performed using TUNEL and cleaved Caspase-3 staining. All procedures adhered to the Guidelines for the Care and Use of Laboratory Animals of Peking Union Medical College Hospital and complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Details of mouse model generation, genotyping, injection procedures, imaging protocols, and apoptosis assays are in the Supplementary Methods.

Patient-Derived iPSCs and Retinal Organoids

Patient-derived fibroblasts were reprogrammed into iPSCs and differentiated into retinal organoids. AON treatment was administered, and molecular analysis included transcriptomic profiling, immunofluorescence staining, WB, ddPCR, and transmission electron microscopy (TEM). Apoptosis analysis was performed using TUNEL and cleaved Caspase-3 staining. All human studies were approved by the Institutional Review Board of Peking Union Medical College Hospital and adhered to the tenets of the Declaration of Helsinki. Detailed reprogramming, differentiation, AON treatment, and analysis protocols are in the Supplementary Methods and Supplementary Table S1.

Statistical Analysis

Data from three independent experiments are presented as mean ± SEM. Statistical significance was determined using Student's t-test (2 groups) or 1-way ANOVA with Tukey's post hoc test (multiple groups) in GraphPad Prism software version 9.4.1 (GraphPad Software, USA). A P value < 0.05 was considered statistically significant.

Results

Design and Optimization of AON

Bioinformatic analysis was conducted to design and select the most efficient AON sequences targeting exon 13 of the USH2A gene. Eighteen candidate AON sequences were optimized based on their secondary structure predictions. The sequences (AGCUUCGGAGAAAUUUAAAUC) with lower free energies and stable secondary structures were prioritized to ensure effective targeting. Further bioinformatic screening was conducted to assess the melting temperature, GC content, and potential off-target effects of the AON sequences, resulting in the selection of 12 optimized AON sequences. These AONs were chemically modified with phosphorothioate (PS) and 2′-methoxyethyl (2′-MOE) modifications to enhance their stability and efficiency. A gapmer structure (gapmer length = 7, and wing length = 7) was incorporated to improve exon 13 skipping efficiency.

Exon 13 Skipping Efficiency of PUMCH-E13 in Rb1 Cells

Exon skipping efficiency of PUMCH-E13 was assessed in Rb1 cells at concentrations of 2 µM, 5 µM, 10 µM, and 40 µM using ddPCR. Supplementary Figure S1 shows that the skipping efficiency increased with the concentration of PUMCH-E13, reaching 15.8 copies/µL at 40 µM, which was higher than the positive control QR421a (14.9 copies/µL). No significant skipping was observed at concentrations of 2 µM and 5 µM. Both PUMCH-E13 and QR-421a were successfully internalized into Rb1 cells, with GFP fluorescence primarily localized in the cytoplasm and minimal fluorescence in the nucleus (Supplementary Fig. S2).

Exon 13 Skipping Efficiency of PUMCH-E13 in Humanized USH2A-e13 Mice

Fluorescence fundus photography showed that GFP-PUMCH-E13 was evenly distributed throughout the vitreous cavity in the eyes of the mice (Supplementary Fig. S3). Retinal sections revealed GFP fluorescence across multiple retinal layers, with the strongest signal observed in the outer segment region. To evaluate in vivo efficacy, humanized USH2A-e13 mice were intravitreally injected with PUMCH-E13 at doses of 20 µg and 40 µg. The ddPCR analysis of retinal tissues showed a dose-dependent exon skipping efficiency of 68.3% (Supplementary Fig. S4). WB analysis confirmed that PUMCH-E13 treatment resulted in a 55.56% ± 1.61% reduction in the exon 13 region of usherin (Supplementary Fig. S5). Immunofluorescence analysis showed stable expression of usherin in PUMCH-E13-treated mice. Exon 13 skipping did not affect the expression of usherin or cone cell morphology, with no pronounced changes in opsin expression (Fig. 1). TUNEL and Caspase-3 staining revealed no noteworthy retinal cell apoptosis in PUMCH-E13 treated mice. Opsin blue staining confirmed that cone cell morphology and opsin expression were unaffected by treatment (Supplementary Fig. S6). The ERG analysis at 24 weeks revealed no marked differences in a-wave and b-wave amplitudes between PUMCH-E13-treated and untreated USH2A-e13 mice under both dark-adapted and light-adapted conditions (Supplementary Fig. S7).

Figure 1.

Figure 1.

Open in a new tab

Analysis of co-expression of usherin protein and red/green opsin after intravitreal injection of PUMCH-E13 in USH2A-e13 mice. Retinal section staining images using anti-usherin antibody and red/green opsin (Opsin red/green). Scale bars are 50 µm.

Exon Skipping Efficiency and Structural Restoration in Retinal Organoids

The iPSC lines were successfully established from five patients with USH2A variants and four healthy controls. All 5 patients carried the c.2802T>G variant, whereas no variants in the USH2A gene were detected in the control group. These iPSC lines were derived from skin fibroblasts and reprogrammed using Sendai virus (Supplementary Fig. S8). The fibroblast reprogramming process exhibited characteristic cell morphological changes over time. By day 7, the cells began to spread and adhere to the culture dish. At day 15, the cell density had extensively increased, filling the dish’s surface. Clear iPSC clones were observed after 25 days, indicating successful reprogramming. The iPSC clones were then selected and purified over several passages, achieving uniform morphology and stable proliferation. The iPSC lines were confirmed to have normal genetic stability and pluripotency, as evidenced by surface marker expression of SOX2 and SSEA4, a normal karyotype, and strong alkaline phosphatase staining (Supplementary Fig. S9). The morphological changes of patient-derived retinal organoids were observed with clear layering and structural development by day 60 (Supplementary Fig. S10). Supplementary Figure S11 displays hematoxylin and eosin (H&E)-stained retinal organoid sections at days 60, 90, 120, and 150 for both the patient and the healthy control groups, showing the maturation of retinal layers in controls and delayed development in patient-derived organoids. Immunofluorescence analysis of retinal markers in patient-derived and control retinal organoids showed that PAX6 and TUJ1 expressions were consistent with retinal progenitor and early neuronal development at day 60 (Fig. 2). At day 90, significant differences were observed in photoreceptor differentiation between patient and control organoids. Recoverin expression was appreciably reduced in patient-derived organoids. At day 150 and day 210, GFP-PUMCH-E13 expression in patient-derived retinal organoids was primarily localized to the inner retinal layers, with weaker distribution in the outer segments (Supplementary Fig. S12).

Figure 2.

Figure 2.

Open in a new tab

Immunofluorescence characterization of retinal organoids from healthy controls and USH2A patients. (A) PAX6 (red) marks retinal progenitor cells, and TUJ1 (green) marks retinal ganglion cells. On day 60, both PAX6 and TUJ1 disclosed clear expression and localization in healthy control organoids, indicating normal retinal progenitor cell development and early neuron formation. In patient-derived organoids, PAX6 and TUJ1 expressions were relatively normal, suggesting that there was no pronounced difference in retinal progenitor cell differentiation and neuron formation at this stage. (B) Recoverin (red) marks photoreceptors, and CRX (green) marks photoreceptor cell precursors. On day 90, recoverin and CRX were strongly expressed in healthy control organoids and evenly distributed in the outer layer, suggesting that the photoreceptor cell structure in the outer layer of the organoids was well developed. In patient-derived organoids, recoverin expression was pronouncedly reduced, suggesting abnormal differentiation of photoreceptor cells. (C) Expression of recoverin (red) and rhodopsin (RHO; green) at day 120. Recoverin continues to label photoreceptors, whereas RHO labels mature rods. In healthy control organoids, the co-localization of recoverin and RHO is uniform and strong, indicating the normal development of rods. In patient-derived organoids, the co-localization of recoverin and RHO is weakened, and the distribution layer is considerably narrower than that of the control group. Scale bar is 50 µm.

PUMCH-E13 treatment induced a dose-dependent increase in exon 13 skipping efficiency in patient-derived retinal organoids. The ddPCR quantification showed a peak efficiency of 6.49 ± 0.5 copies/µL at 200 nM (Supplementary Fig. S13). Digital WB disclosed that exon 13 skipping considerably reduced full-length usherin expression in the PUMCH-E13-treated group. Compared to the untreated patient group, the exon 13 region of usherin decreased by 16.4% ± 4.1% (P = 0.0402) in the treatment group (Supplementary Fig. S14). TUNEL staining revealed no appreciable increase in apoptotic cells in the PUMCH-E13-treated group compared with the untreated patient group at day 120 (Supplementary Fig. S15). Caspase-3 staining further supported this, showing no notable differences in apoptosis between the groups. TEM revealed substantial structural differences among healthy controls, patient-derived organoids, and those treated with PUMCH-E13. Patient-derived organoids exhibited severe edema, membrane damage, and microtubule loss in cilia (Fig. 3). In contrast, after PUMCH-E13 treatment, the cilia displayed improved microtubule arrangement, although some disorganization remained, the edema and structure damage were reduced (see Fig. 3).

Figure 3.

Figure 3.

Open in a new tab

Electron microscopic analysis of photoreceptor cell microstructure changes before and after retinal organoid treatment. This figure illustrates in detail the differences in photoreceptor cell microstructure among the healthy control group (A, B), the patient-derived group (C, D), and the PUMCH-E13-treated group (E, F). (A, B) indicates the microstructure of photoreceptor cells in the retinal organoids of the healthy control group. The overall structure of photoreceptor cells is intact, the membrane structure is clear, and the intracellular matrix is uniform. There are a large number of tight junctions (TJs) between cells, with long dense areas and narrow gaps, indicating that the connection between cells is good. The connecting cilia (Cil) have a good structure and contain obvious microtubule structures of the axoneme. Most of the mitochondria (M) have normal structures, intact membranes, and uniform matrix, and neatly arranged cristae. The rough endoplasmic reticulum (RER) is not dilated, and ribosomes can be seen attached to the surface. (C, D) These panels show the microstructure of photoreceptor cells in retinal organoids derived from USH2A patients. Compared with the healthy control group, the photoreceptor cells in the patient group displayed severe pathological changes. Photoreceptor cells were severely edematous, with large areas of membrane damage and disintegration, sparse intracellular matrix and dissolution, forming large areas of low electron density edema. Most organelles were obviously swollen. Although there were a large number of tight junctions (TJs) between cells, the dense area was longer and lighter in color, and the local gap was widened. The connecting cilia (Cil) illustrated swelling, sparse cytoplasm, and the number of microtubules inside the axoneme was reduced and broken. Mitochondria (M) were swollen and enlarged, the matrix was dissolved, the number of cristae was reduced or disappeared, and the tripartite microtubule structure of the centrosome (Cen) was blurred. The Golgi apparatus (Go) highlighted hypertrophy and capsule expansion, and the number of autophagic lysosomes (ASS) was small, indicating a weakening of autophagy. (E, F) These panels show the microstructure of photoreceptor cells in the PUMCH-E13 treatment group. Compared with the patient group, the photoreceptor cells in the PUMCH-E13 treatment group improved in edema and membrane damage, but still had obvious pathological characteristics. The photoreceptor cells are still substantially edematous, the membrane structure is partially damaged, the intracellular matrix is sparse, and a large area of low electron density edema is formed. The swelling of organelles is alleviated compared with the patient group, but it is still not completely normal. There are a large number of tight junctions (TJs) between cells, the dense area is long, and the gap is narrow, showing a certain degree of repair of intercellular connections. The connecting cilia (Cil) are still swollen, the microtubule structure inside the axoneme is clear but disordered, and the number of microtubules is improved compared with the patient group. The mitochondria (M) are partially enlarged and swollen, the matrix is slightly lighter, the number of cristae is reduced but not completely disappeared, and the centrosome (Cen) structure is normal. Only a small amount of autophagic lysosomes (ASS) are present. The scale bars are 10 µm.

Transcriptomic Analysis and Pathway Validation of Retinal Organoids

Transcriptomic analysis revealed noteworthy differences in gene expression between patient-derived and healthy control retinal organoids. A total of 2762 differentially expressed genes were identified, with 989 genes upregulated and 1773 genes downregulated (Supplementary Fig. S16). At day 90, a total of 6344 differentially expressed genes were identified between the patient and healthy groups, with 3689 genes upregulated and 2655 downregulated. At day 120, PUMCH-E13 treatment resulted in 3061 differentially expressed genes, with 1802 upregulated and 1259 downregulated compared with untreated patient organoids. The Gene Ontology (GO) enrichment analysis presented those pathways, such as “cilium movement” and “axoneme assembly” were substantially downregulated in the patient group (Supplementary Fig. S17). The “axoneme part” and “ciliary plasm” pathways also presented substantial downregulation, further confirming defects in ciliary structures in the patient group.

The qPCR analysis illustrated a marked reduction in USH2A expression in the patient group (P < 0.001), with no appreciable change after PUMCH-E13 treatment (Fig. 4). WHRN expression was elevated in patients but decreased post-treatment (P < 0.01). PDZD7 expression was reduced in the patient group (P < 0.01), and restored after PUMCH-E13 treatment (P < 0.01). GPR98 was downregulated in patients but returned to control levels after treatment (P < 0.001). TEKT5, DNAH5, HYDIN, RSPH4A, and CCDC114 indicated no pronounced improvement after PUMCH-E13 treatment.

Figure 4.

Figure 4.

Open in a new tab

The qPCR validation of differentially expressed genes in retinal organoids. (A) The relative expression of USH2A gene was notably decreased in the patient group (P < 0.001), but there was no pronounced change in the PUMCH-E13 treatment group. (B) The expression of WHRN gene was pronouncedly upregulated in the patient group (P < 0.05), and strikingly decreased after PUMCH-E13 treatment (P < 0.01). (C) The relative expression of PDZD7 gene was substantially decreased in the patient group (P < 0.01), and was still pronouncedly upregulated after PUMCH-E13 treatment (P < 0.01). (D) The GPR98 gene was considerably downregulated in the patient group (P < 0.001), and its expression in the PUMCH-E13 treatment group returned to a level close to that of the healthy control group (P < 0.001). (E) There was no substantiated difference in the expression level of TEKT5 gene among the three groups. (F) The expression of DNAH5 gene was appreciably decreased in the patient group (P < 0.01), and there was no considerable change after PUMCH-E13 treatment. (G) The relative expression of HYDIN gene was notably y decreased in the patient group (P < 0.01), and the expression remained at a low level in the PUMCH-E13 treatment group. (H) The expression of RSPH4A gene was substantially decreased in the patient group (P < 0.001), and there was no noteworthy change after PUMCH-E13 treatment. (I) The expression of CCDC114 gene was pronouncedly increased in the patient group (P < 0.01), and there was no considerable change after PUMCH-E13 treatment compared with the patient group.

Immunofluorescence analysis revealed a reduced expression of PDZD7 and usherin in patient-derived organoids compared with controls. PUMCH-E13 treatment partially restored the expression of PDZD7 and usherin, although the levels remained lower than those observed in the healthy controls (Fig. 5). GPR98 and WHRN expression was reduced in the patient group, whereas PUMCH-E13 treatment restored GPR98 expression and improved co-localization with WHRN in the outer retinal layer (see Fig. 5). Usherin and DNAH5 expression were lower in the patient group, and PUMCH-E13 treatment partially restored DNAH5 expression, whereas the usherin levels remained lower than in the controls (see Fig. 5). RSPH4A and CCDC114 revealed reduced expression in the patient group, and PUMCH-E13 treatment resulted in limited recovery of both proteins (see Fig. 5). HYDIN and TEKT5 expression were also reduced in the patient group, with partial recovery observed after PUMCH-E13 treatment (see Fig. 5).

Figure 5.

Figure 5.

Open in a new tab

Protein expression analysis of retinal organoids. (A) Expression analysis of PDZD7 and usherin proteins in retinal organoids. This figure describes the expression and co-localization of PDZD7 and usherin in retinal organoids in the healthy control group (Control), patient group (Patient) and PUMCH-E13 treatment group (PUMCH-E13). Immunofluorescence staining of PDZD7 (red) and usherin (green) illustrates the differences in protein expression in different groups. In the healthy control group, PDZD7 and usherin displayed strong expression signals in the outer layer of retinal organoids, and the two revealed obvious co-localization in this area (yellow signal in the Merge image). In the patient group, the expression of PDZD7 and usherin was considerably reduced. In the PUMCH-E13 treatment group, the expression levels of PDZD7 and usherin in the outer layer of retinal organoids were restored compared with those in the patient group, but were still lower than those in the healthy control group, and the co-localization signal in the outer layer was weakened. The scale bar is 50 µm. (B) Expression analysis of GPR98 and WHRN in retinal organoids. The figure indicates the expression and co-localization of GPR98 (red) and WHRN (green) in retinal organoids of the healthy control group (Control), the patient group (Patient), and the PUMCH-E13 treatment group (PUMCH-E13). In the healthy control group, GPR98 and WHRN were highly expressed in the outer layer of retinal organoids, and there was marked co-localization between the two (yellow). In the patient group, the expression level of WHRN was normal, and the expression of GPR98 was extremely low. In the organoids treated with PUMCH-E13, the expression of GPR98 was restored, especially the co-localization signal with WHRN in the outer layer was enhanced compared with that in the patient group. The scale bar is 50 µm. (C) Expression analysis of usherin and DNAH5 in retinal organoids. The figure outlines the expression and co-localization distribution of usherin (red) and DNAH5 (green) in retinal organoids of healthy control group (Control), patient group (Patient) and PUMCH-E13 treatment group (PUMCH-E13). In the healthy control group, the expression of usherin and DNAH5 in the outer layer of retinal organoids was substantiated, and the two were co-localized in the outer layer (yellow signal). The expression of DNAH5 in the patient group was appreciably reduced, especially in the outer layer of retinal organoids, where no obvious signal expression was found. In the PUMCH-E13 treatment group, the expression of DNAH5 in the outer layer of retinal organoids was restored. The scale bar is 50 µm. (D) Expression analysis of RSPH4A and CCDC114 in retinal organoids. The figure illustrates the expression of RSPH4A (red) and CCDC114 (green) in retinal organoids of healthy control group (Control), patient group (Patient) and PUMCH-E13 treatment group (PUMCH-E13) and their co-localization analysis. In the healthy control group, the expression of RSPH4A and CCDC114 was clearly visible in the outer structure of retinal organoids, and the two were co-localized (orange signal). In the patient group, the expression of RSPH4A and CCDC114 was substantially reduced, and the signal distribution in the outer layer of retinal organoids was sparse and invisible. In the PUMCH-E13 treatment group, the expression of the two proteins was slightly restored, with less expression in the outer layer of the retina, and only a small amount of co-localization signal (orange). Scale bar is 50 µm. (E) Expression analysis of HYDIN and TEKT5 in retinal organoids. The figure indicates the expression of HYDIN (red) and TEKT5 (green) in retinal organoids of healthy control group (Control), patient group (Patient) and PUMCH-E13 treatment group (PUMCH-E13) and their co-localization analysis. In the healthy control group, HYDIN and TEKT5 were widely and strongly expressed in retinal organoids, especially in the outer cells of retinal organoids, and the co-localization signals of the two (yellow) were clearly visible. In the patient group, the expression of HYDIN was pronouncedly reduced, and the signal in the outer retinal region was sparse and uneven. In the PUMCH-E13 treatment group, the expression of HYDIN and TEKT5 in the outer layer of retinal organoids was restored to a certain extent, and the co-localization signals displayed were increased. The scale bar is 50 µm.

Discussion

The selection and design of AONs are critical for efficacy in gene therapy. AONs must be highly specific to the target exon while optimizing their physicochemical properties to ensure stability and prolonged activity in both in vitro and in vivo environments.34–36 Through bioinformatic analysis, we successfully identified a series of AON sequences targeting exon 13 of the USH2A gene. In this study, we screened and selected the optimal AON, named PUMCH-E13. PUMCH-E13 demonstrated considerably enhanced exon 13 skipping efficiency at higher concentrations, outperforming lower concentrations and the positive control QR-421a at 40 µM. This result underscores the advantage of incorporating a gapmer structure into the AON design to optimize exon skipping efficiency. Importantly, PUMCH-E13 achieved high exon 13 skipping efficiency even in the absence of a delivery vehicle, providing a promising foundation for its future development and clinical application. PUMCH-E13 predominantly localized in the cytoplasm of Rb1 cells, indicating limited nuclear penetration after diffusing into the cells. Because AON’s activity occurs during pre-mRNA processing in the nucleus,37 inadequate nuclear entry can impair its effectiveness at the splicing site.38 Therefore, enhancing AON’s nuclear uptake is crucial for improving exon skipping efficiency. Future research should focus on developing more efficient systems to increase nuclear penetration and enhancing its regulatory effect on target pre-mRNA.39

In this study, PUMCH-E13 exhibited strong expression in the retinal photoreceptor layer of humanized USH2A-e13 mice, indicating high specificity and effective targeting, which is crucial for potential therapeutic applications in retinal diseases. The results also demonstrated that PUMCH-E13 was able to penetrate various retinal layers, supporting intravitreal injection as an effective and durable delivery method for AONs. By combining digital WB and ddPCR, we verified the high efficacy of PUMCH-E13 in inducing exon 13 skipping at both the RNA and protein levels. Importantly, the usherin antibodies confirmed that the exon skipping process did not disrupt the localization and expression of the usherin protein, thereby ensuring that the skipping of exon 13 did not affect the functional integrity of the protein. Additionally, TUNEL, Caspase-3 staining, and ERG analysis revealed that PUMCH-E13 treatment did not pronouncedly increase retinal cell apoptosis or negatively impact retinal structure and function, providing further evidence of its safety and supporting its potential for clinical application.

Although humanized mice can replicate the ocular environment, they do not exhibit the relevant phenotypic traits. In contrast, patient-derived retinal organoids provide a more precise in vitro model, enabling a more accurate assessment of AON therapeutic efficacy on photoreceptor cells. In the control group, retinal organoids developed a well-structured, multi-layered photoreceptor architecture, whereas USH2A organoids exhibited delayed differentiation with disorganized cell arrangements and poorly defined layers. The reduced expression of rhodopsin (RHO), further underscores the detrimental effects of USH2A variants on photoreceptor development, aligning with previous studies on the impact of USH2A variants in retinal degeneration.40,41 TEM analysis of retinal organoids revealed pronounced swelling of the cilia and a marked reduction in axonemal microtubules in patient-derived organoids. Axonemes are crucial for signal transmission in photoreceptor cells, and their damage directly affects cell function, leading to retinal degeneration.42–44 In addition to ciliary abnormalities, TEM revealed ultrastructural abnormalities in mitochondria, including swelling, cristae reduction, and focal loss, suggestive of impaired mitochondrial homeostasis. These observations align with previous studies, which suggest that USH2A variants not only impair ciliary structure but also may affect mitochondrial function.45–48 These structural changes suggest potential metabolic dysfunction, warranting further functional assays.

Usherin protein is a key component of the cilia structure of photoreceptor cells. The key role of cilia in photoreceptor cells is to transmit signals to the interior of the cell through the axoneme and maintain the structural stability of the cell.49,50 PDZD7, WHRN, GPR98, and other proteins work synergistically with usherin protein to form a stable USH2 complex, which is crucial for maintaining the function of photoreceptor cells.25,51,52 PDZD7, as a co-factor of WHRN, regulates the composition and structure of cilia, whereas GPR98 is a huge transmembrane protein that participates in the structural maintenance of photoreceptor cilia.53,54 Transcriptome, qPCR, and immunofluorescence data all show a significant decrease in the expression and localization of PDZD7 and GPR98 in the retinal photoreceptor layer of USH2A patient-derived retinal organoids, alongside downregulation of cilia-related pathways. This is consistent with previous findings, which also pointed out that the loss of function of the USH2 complex is one of the main pathogenic mechanisms of USH2A-related retinal degeneration.54–56 Cilia dysfunction is a key step in the degeneration of photoreceptor cells, and the impact of the USH2A variants gradually leads to retinal degeneration through this pathway.57,58

In addition to the changes in the USH2 complex, transcriptome analysis highlighted that the expression of a large number of genes in the pathways related to ciliary function and axoneme structure was considerably downregulated, which was consistent with the results of TEM showing that the microtubule structure of the connecting cilia axonemes of photoreceptor cells in the patient’s retinal organoids was damaged. Through immunofluorescence staining analysis, we found that key ciliary axoneme proteins, such as DNAH5, RSPH4A, TEKT5, CCDC114, and HYDIN, were abnormally expressed in the patient’s retinal organoids, and the co-localization signal in the outer layer of photoreceptor cells was also extensively weakened. Among them, DNAH5 encodes heavy-chain motor protein in intraflagellar transport (IFT), which plays a vital role in the beating and transport function of cilia. Its genetic variant or abnormal expression does not affect the morphology of cilia but can cause IFT dysfunction.59 Our study found that the RNA and protein expression of DNAH5 were appreciably reduced in the retinal organoids of patients with USH2A variants, which may lead to the loss of IFT function and affect the normal function of photoreceptor cells. Combined with our findings, this further supports that the USH2A variants affect the expression and function of key ciliary axonemal proteins, leading to impaired ciliary IFT, and thereby exacerbating photoreceptor cell degeneration and retinal degeneration. RSPH4A is one of the pathogenic genes of hereditary ciliopathies and encodes a component of the ciliary central complex, which is an important component of the ciliary structure and function.60,61 Genetic variants in RSPH4A can lead to abnormal ciliary structure. The RNA expression and protein expression of RSPH4A in the patient’s retinal organoids are extremely low, and no protein expression is observed in the outer photoreceptor cells of the organoids, which may be related to the disappearance of the ciliary axoneme structure we observed. In addition, HYDIN is also a key protein in the ciliary central complex and plays a key role in the structural integrity of the ciliary axoneme, especially in the assembly and function of the central microtubule pair of motile cilia, which is closely related to the normal function of cilia.62 Abnormality of HYDIN is considered to be an important cause of ciliary dysfunction. Our qPCR and fluorescent staining found that HYDIN is similar to RSPH4A, with a substantial decrease in gene and protein expression, and this dysfunction may be related to the disorder of the internal structure of the cilia of photoreceptor cells in patients with USH2A variants. TEKT5 belongs to the tektin protein family and is a member of the luminal component of the microtubule pair of the ciliary axoneme, especially the microtubule structure in the motile cilia.63 TEKT5 is involved in maintaining the stability and correct assembly of the microtubule pair of the ciliary axoneme, ensuring the normal motility of the cilia.64 Although the specific role of TEKT5 in photoreceptor cells is currently unknown, it may play an important role in maintaining the structure of the cilia. Our data disclosed that in retinal organoids from patients with USH2A variants, the TEKT5 protein was localized less in the outer layer of photoreceptor cells in retinal organoids, which may indicate that USH2A variants lead to the loss of photoreceptor outer segment structure. Finally, the CCDC114 gene encodes a protein essential for the function of the ciliary axoneme, which is used to assemble the outer arm dynein complex of microtubules in the axoneme.65 Loss of function of CCDC114 can lead to ciliopathies, such as primary ciliary dyskinesia and sensorineural deafness, indicating that it plays a key role in maintaining the structure of the ciliary axoneme.66,67 Although there is little information about CCDC114. There are few studies on its specific role in retinal photoreceptors, but the assembly of ciliary axoneme microtubules is also very important in photoreceptors. Our study revealed that the localization and expression of the CCDC114 protein in the photoreceptor cell layer in retinal organoids with USH2A variants were pronouncedly reduced, which may be related to the damage of microtubule structure observed by TEM. Although the TEKT5 and CCDC114 mRNA levels were unchanged, reduced protein expression suggests post-transcriptional regulation (e.g. protein instability or impaired translation).

PUMCH-E13 was evaluated for its efficacy, delivery efficiency, and low toxicity using patient-derived retinal organoids. GFP-PUMCH-E13 maintained appreciable expression at D150 and D210, indicating robust stability and prolonged activity of the AON. The ddPCR analysis demonstrated effective, dose-dependent exon 13 skipping, supporting its potential for clinical application. Digital WB confirmed a marked reduction in usherin protein expression within the exon 13 region, validating the exon skipping mechanism. Toxicity analysis revealed no significant increase in apoptosis, suggesting that PUMCH-E13 has a favorable safety profile, positioning it as a promising therapeutic candidate for USH2A-related retinal diseases.

Transcriptomic, qPCR, and immunofluorescence analyses of patient-derived retinal organoids demonstrated that PUMCH-E13 effectively restored the expression and localization of GPR98 and PDZD7. However, although partial restoration of the USH2 complex function was observed, the expression of axoneme-related proteins, such as RSPH4A and CCDC114, remained suboptimal, and TEM revealed only partial recovery of ciliary structure, indicating that full axoneme integrity may require prolonged treatment and the coordinated action of multiple proteins.68–70

The therapeutic effects of PUMCH-E13 are highlighted by its ability to mitigate critical microstructural changes in photoreceptor cells, including the restoration of tight junctions and the recovery of the ciliary axoneme's microtubule organization. Furthermore, PUMCH-E13 significantly stabilizes key USH proteins, such as usherin, PDZD7, and GPR98, which are essential for maintaining photoreceptor cell integrity and function. However, the multifactorial nature of ciliary dysfunction in USH2A-related retinal degeneration suggests that these effects may be a result of the combined downregulation of multiple ciliary proteins. Thus, long-term, early, and repeated AON interventions may be required to fully restore ciliary and axoneme function. Future efforts should focus on optimizing AON delivery and further investigating its effects on photoreceptor cell restoration to provide more effective treatments for USH2A-related retinal degeneration.

Supplementary Material

Supplement 1
iovs-66-12-46_s001.docx (22.9MB, docx)

Acknowledgments

The authors thank the patients and their families for contributing biological samples and supporting this research. They also acknowledge the Core Labs of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, for providing the droplet digital PCR equipment. Support for animal breeding was provided by the Laboratory Animal Research Facility, Institute of Clinical Medicine, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences.

Supported by the National Natural Science Foundation of China (82171086).

Disclosure: W. Li, None; Y. Li, None; Y. Zhou, None; Y. Liu, None; H. Liu, None; X. Wei, None; Z. Sun, None; X. Han, None; X. Zou, None; H. Li, None; R. Sui, None

References

  • 1. Petit C. Usher syndrome: from genetics to pathogenesis. Annu Rev Genomics Hum Genet. 2001; 2: 271–297. [DOI] [PubMed] [Google Scholar]
  • 2. Smith RJ, Berlin CI, Hejtmancik JF, et al.. Clinical diagnosis of the Usher syndromes. Usher Syndrome Consortium. Am J Med Genet. 1994; 50: 32–38. [DOI] [PubMed] [Google Scholar]
  • 3. Sun T, Xu K, Ren Y, et al.. Comprehensive molecular screening in Chinese Usher syndrome patients. Invest Ophthalmol Vis Sci. 2018; 59: 1229–1237. [DOI] [PubMed] [Google Scholar]
  • 4. McGee TL, Seyedahmadi BJ, Sweeney MO, Dryja TP, Berson EL.. Novel mutations in the long isoform of the USH2A gene in patients with Usher syndrome type II or non-syndromic retinitis pigmentosa. J Med Genet. 2010; 47: 499–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Verbakel SK, van Huet RAC, Boon CJF, et al.. Non-syndromic retinitis pigmentosa. Prog Retin Eye Res. 2018; 66: 157–186. [DOI] [PubMed] [Google Scholar]
  • 6. Baux D, Blanchet C, Hamel C, et al.. Enrichment of LOVD-USHbases with 152 USH2A genotypes defines an extensive mutational spectrum and highlights missense hotspots. Hum Mutat. 2014; 35: 1179–1186. [DOI] [PubMed] [Google Scholar]
  • 7. Bhattacharya G, Cosgrove D.. Evidence for functional importance of usherin/fibronectin interactions in retinal basement membranes. Biochemistry. 2005; 44: 11518–11524. [DOI] [PubMed] [Google Scholar]
  • 8. Toualbi L, Toms M, Moosajee M.. USH2A-retinopathy: from genetics to therapeutics. Exp Eye Res. 2020; 201: 108330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Eudy JD, Weston MD, Yao S, et al.. Mutation of a gene encoding a protein with extracellular matrix motifs in Usher syndrome type IIa. Science. 1998; 280: 1753–1757. [DOI] [PubMed] [Google Scholar]
  • 10. Weston MD, Eudy JD, Fujita S, et al.. Genomic structure and identification of novel mutations in usherin, the gene responsible for Usher syndrome type IIa. Am J Hum Genet. 2000; 66: 1199–1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Le Quesne Stabej P, Saihan Z, Rangesh N, et al.. Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study. J Med Genet. 2012; 49: 27–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Zhu T, Chen DF, Wang L, et al.. USH2A variants in Chinese patients with Usher syndrome type II and non-syndromic retinitis pigmentosa. Br J Ophthalmol. 2021; 105: 694–703. [DOI] [PubMed] [Google Scholar]
  • 13. Skoblov M. Prospects of antisense therapy technologies. Mol Biol (Mosk). 2009; 43: 984–998. [PubMed] [Google Scholar]
  • 14. Lee Y, Rio DC.. Mechanisms and regulation of alternative pre-mRNA splicing. Annu Rev Biochem. 2015; 84: 291–323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Mansoor M, Melendez AJ.. Advances in antisense oligonucleotide development for target identification, validation, and as novel therapeutics. Gene Regul Syst Bio. 2008; 2: 275–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Li D, Mastaglia FL, Fletcher S, Wilton SD.. Precision medicine through antisense oligonucleotide-mediated exon skipping. Trends Pharmacol Sci. 2018; 39: 982–994. [DOI] [PubMed] [Google Scholar]
  • 17. Pendse N, Lamas V, Maeder M, et al.. Exon 13-skipped USH2A protein retains functional integrity in mice, suggesting an exo-skipping therapeutic approach to treat USH2A-associated disease. bioRxiv Preprint, 10.1101/2020.02.04.934240. [DOI]
  • 18. Van Diepen H, Dulla K, Chan H, et al.. QR-421a, an antisense oligonucleotide, for the treatment of retinitis pigmentosa due to USH2A exon 13 mutations. Invest Ophthalmol Vis Sci. 2019; 60: 3250. [Google Scholar]
  • 19. ProQR Therapeutics. ProQR announces positive findings from an interim analysis in the phase 1/2 trial of QR-421a for Usher syndrome and provides business update. Available at: https://www.proqr.com/press-releases/proqr-announces-positive-findings-from-an-interim-analysis-in-the-phase-12-trial-of.
  • 20. ProQR Therapeutics. ProQR announces first patients dosed in phase 2/3 pivotal trials of QR-421a for USH2A mediated retinitis pigmentosa. Available at: https://www.proqr.com/press-releases/proqr-announces-first-patients-dosed-in-phase-23-pivotal-trials-of-qr-421a-for-ush2a-mediated-retinitis-pigmentosa.
  • 21. Dulla K, Slijkerman R, van Diepen HC, et al.. Antisense oligonucleotide-based treatment of retinitis pigmentosa caused by USH2A exon 13 mutations. Mol Ther. 2021; 29: 2441–2455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Audo I, Birch DG, Jayasundera KT, et al.. QR-421a RNA therapy in retinitis pigmentosa due to mutations in USH2A: Stellar trial phase 1b/2 interim results. Abstracts from the 2021 European Association for Vision and Eye Research Festival. Acta Ophthalmol. 2022; 100: 205. [Google Scholar]
  • 23. Glass AS, Dahm R.. The zebrafish as a model organism for eye development. Ophthalmic Res. 2004; 36: 4–24. [DOI] [PubMed] [Google Scholar]
  • 24. Santhanam A, Shihabeddin E, Wei H, Wu J, O'Brien J. Molecular basis of retinal remodeling in a zebrafish model of retinitis pigmentosa. Cell Mol Life Sci. 2023; 80: 362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Toms M, Dubis AM, de Vrieze E, et al.. Clinical and preclinical therapeutic outcome metrics for USH2A-related disease. Hum Mol Genet. 2020; 29: 1882–1899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Angueyra JM, Kindt KS.. Leveraging zebrafish to study retinal degenerations. Front Cell Dev Biol. 2018; 6: 110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Dona M, Slijkerman R, Lerner K, et al.. Usherin defects lead to early-onset retinal dysfunction in zebrafish. Exp Eye Res. 2018; 173: 148–159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Slijkerman R, Goloborodko A, Broekman S, et al.. Poor splice-site recognition in a humanized zebrafish knockin model for the recurrent deep-intronic c.7595-2144A>G mutation in USH2A. Zebrafish. 2018; 15: 597–609. [DOI] [PubMed] [Google Scholar]
  • 29. Liu X, Bulgakov OV, Darrow KN, et al.. Usherin is required for maintenance of retinal photoreceptors and normal development of cochlear hair cells. Proc Natl Acad Sci USA. 2007; 104: 4413–4418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. van Diepen H, Dulla K, Chan HL, et al.. QR-421a, an antisense oligonucleotide, for the treatment of retinitis pigmentosa due to USH2A exon 13 mutations. Invest Ophthalmol Vis Sci. 2019; 60: 3250. [Google Scholar]
  • 31. Guo Y, Wang P, Ma JH, et al.. Modeling retinitis pigmentosa: retinal organoids generated from the iPSCs of a patient with the USH2A mutation show early developmental abnormalities. Front Cell Neurosci. 2019; 13: 361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Khan M, Arno G, Fakin A, et al.. Detailed phenotyping and therapeutic strategies for intronic ABCA4 variants in Stargardt disease. Mol Ther Nucleic Acids. 2020; 21: 412–427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Dulla K, Aguila M, Lane A, et al.. Splice-modulating oligonucleotide QR-110 restores CEP290 mRNA and function in human c.2991+1655A>G LCA10 models. Mol Ther Nucleic Acids. 2018; 12: 730–740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Aartsma-Rus A, van Ommen GJ.. Antisense-mediated exon skipping: a versatile tool with therapeutic and research applications. RNA. 2007; 13: 1609–1624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Kole R, Krainer AR, Altman S.. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat Rev Drug Discov. 2012; 11: 125–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Takakusa H, Iwazaki N, Nishikawa M, Yoshida T, Obika S, Inoue T.. Drug metabolism and pharmacokinetics of antisense oligonucleotide therapeutics: typical profiles, evaluation approaches, and points to consider compared with small molecule drugs. Nucleic Acid Ther. 2023; 33: 83–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Le Hir H, Sauliere J, Wang Z. The exon junction complex as a node of post-transcriptional networks. Nat Rev Mol Cell Biol. 2016; 17: 41–54. [DOI] [PubMed] [Google Scholar]
  • 38. Cartegni L, Chew SL, Krainer AR.. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002; 3: 285–298. [DOI] [PubMed] [Google Scholar]
  • 39. Hammond SM, Aartsma-Rus A, Alves S, et al.. Delivery of oligonucleotide-based therapeutics: challenges and opportunities. EMBO Mol Med. 2021; 13: e13243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Furukawa T, Morrow EM, Cepko CL.. Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell. 1997; 91: 531–541. [DOI] [PubMed] [Google Scholar]
  • 41. Koyanagi Y, Akiyama M, Nishiguchi KM, et al.. Genetic characteristics of retinitis pigmentosa in 1204 Japanese patients. J Med Genet. 2019; 56: 662–670. [DOI] [PubMed] [Google Scholar]
  • 42. Ramamurthy V, Cayouette M.. Development and disease of the photoreceptor cilium. Clin Genet. 2009; 76: 137–145. [DOI] [PubMed] [Google Scholar]
  • 43. Wright ZC, Loskutov Y, Murphy D, et al.. ADP-Ribosylation Factor-Like 2 (ARL2) regulates cilia stability and development of outer segments in rod photoreceptor neurons. Sci Rep. 2018; 8: 16967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Sanchez-Bellver L, Toulis V, Marfany G.. On the wrong track: alterations of ciliary transport in inherited retinal dystrophies. Front Cell Dev Biol. 2021; 9: 623734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Wheway G, Parry DA, Johnson CA.. The role of primary cilia in the development and disease of the retina. Organogenesis. 2014; 10: 69–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Meschede IP, Ovenden NC, Seabra MC, et al.. Symmetric arrangement of mitochondria:plasma membrane contacts between adjacent photoreceptor cells regulated by Opa1. Proc Natl Acad Sci USA. 2020; 117: 15684–15693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Zhou B, Fang L, Dong Y, et al.. Mitochondrial quality control protects photoreceptors against oxidative stress in the H(2)O(2)-induced models of retinal degeneration diseases. Cell Death Dis. 2021; 12: 413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Giarmarco MM, Cleghorn WM, Sloat SR, Hurley JB, Brockerhoff SE.. Mitochondria maintain distinct Ca(2+) pools in cone photoreceptors. J Neurosci. 2017; 37: 2061–2072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Chen HY, Welby E, Li T, Swaroop A. Retinal disease in ciliopathies: recent advances with a focus on stem cell-based therapies. Transl Sci Rare Dis. 2019; 4: 97–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Bujakowska KM, Liu Q, Pierce EA.. Photoreceptor cilia and retinal ciliopathies. Cold Spring Harb Perspect Biol. 2017; 9: a028274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Grati M, Shin JB, Weston MD, et al.. Localization of PDZD7 to the stereocilia ankle-link associates this scaffolding protein with the Usher syndrome protein network. J Neurosci. 2012; 32: 14288–14293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Jacobson SG, Cideciyan AV, Aleman TS, et al.. Usher syndromes due to MYO7A, PCDH15, USH2A or GPR98 mutations share retinal disease mechanism. Hum Mol Genet. 2008; 17: 2405–2415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Zou J, Chen Q, Almishaal A, et al.. The roles of USH1 proteins and PDZ domain-containing USH proteins in USH2 complex integrity in cochlear hair cells. Hum Mol Genet. 2017; 26: 624–636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Guan Y, Du HB, Yang Z, et al.. Deafness-associated ADGRV1 mutation impairs USH2A stability through improper phosphorylation of WHRN and WDSUB1 recruitment. Adv Sci (Weinh). 2023; 10: e2205993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Zou J, Zheng T, Ren C, et al.. Deletion of PDZD7 disrupts the Usher syndrome type 2 protein complex in cochlear hair cells and causes hearing loss in mice. Hum Mol Genet. 2014; 23: 2374–2390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Ebermann I, Phillips JB, Liebau MC, et al.. PDZD7 is a modifier of retinal disease and a contributor to digenic Usher syndrome. J Clin Invest. 2010; 120: 1812–1823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Weil D, Blanchard S, Kaplan J, et al.. Defective myosin VIIA gene responsible for Usher syndrome type 1B. Nature. 1995; 374: 60–61. [DOI] [PubMed] [Google Scholar]
  • 58. Roepman R, Wolfrum U.. Protein networks and complexes in photoreceptor cilia. Subcell Biochem. 2007; 43: 209–235. [DOI] [PubMed] [Google Scholar]
  • 59. Li B, Li S, Yan Z.. Axonemal dynein DNAH5 is required for sound sensation in drosophila larvae. Neurosci Bull. 2021; 37: 523–534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Yoke H, Ueno H, Narita A, et al.. Rsph4a is essential for the triplet radial spoke head assembly of the mouse motile cilia. PLoS Genet. 2020; 16: e1008664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. De Jesus-Rojas W, Melendez-Montanez J, Muniz-Hernandez J, et al.. The RSPH4A gene in primary ciliary dyskinesia. Int J Mol Sci. 2023; 24: 1936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Lechtreck KF, Delmotte P, Robinson ML, Sanderson MJ, Witman GB.. Mutations in Hydin impair ciliary motility in mice. J Cell Biol. 2008; 180: 633–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Chen Z, Shiozaki M, Haas KM, et al.. De novo protein identification in mammalian sperm using in situ cryoelectron tomography and AlphaFold2 docking. Cell. 2023; 186: 5041–5053 e19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Geng XY, Jin HJ, Xia L, Wang BB, Chen SR.. Tektin bundle interacting protein, TEKTIP1, functions to stabilize the tektin bundle and axoneme in mouse sperm flagella. Cell Mol Life Sci. 2024; 81: 118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Onoufriadis A, Paff T, Antony D, et al.. Splice-site mutations in the axonemal outer dynein arm docking complex gene CCDC114 cause primary ciliary dyskinesia. Am J Hum Genet. 2013; 92: 88–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Wu DH, Singaraja RR.. Loss-of-function mutations in CCDC114 cause primary ciliary dyskinesia. Clin Genet. 2013; 83: 526–527. [DOI] [PubMed] [Google Scholar]
  • 67. Li P, He Y, Cai G, et al.. CCDC114 is mutated in patient with a complex phenotype combining primary ciliary dyskinesia, sensorineural deafness, and renal disease. J Hum Genet. 2019; 64: 39–48. [DOI] [PubMed] [Google Scholar]
  • 68. Ishikawa T. Axoneme structure from motile cilia. Cold Spring Harb Perspect Biol. 2017; 9: a028076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Wood CR, Rosenbaum JL.. Proteins of the ciliary axoneme are found on cytoplasmic membrane vesicles during growth of cilia. Curr Biol. 2014; 24: 1114–1120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Rao VG, Subramanianbalachandar V, Magaj MM, Redemann S, Kulkarni SS.. Mechanisms of cilia regeneration in Xenopus multiciliated epithelium in vivo. bioRxiv Preprint, 10.1101/2023.06.14.544972. [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement 1
iovs-66-12-46_s001.docx (22.9MB, docx)

Articles from Investigative Ophthalmology & Visual Science are provided here courtesy of Association for Research in Vision and Ophthalmology

RESOURCES