Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Sep 26.
Published in final edited form as: Reproduction. 2025 Sep 25;170(5):e250045. doi: 10.1530/REP-25-0045

Human Placental Trophoblast Cells Express and Secrete Basigin via a Regulated Process of Extracellular Vesicle Release

Muhammad Ashir Nabeel 1, Victoriya Ermilova 1, Kailiang Li 1, Richard Leach 2, Romana A Nowak 1
PMCID: PMC12463142  NIHMSID: NIHMS2110860  PMID: 40996566

Abstract

Successful pregnancy relies on the regulated invasion of trophoblast cells into the maternal endometrium and subsequent remodeling of spiral arteries. Various factors are involved in regulating these processes, including matrix metalloproteinases (MMPs), cytokines such as interleukins (IL) and transforming growth factor β (TGFβ), and hypoxic conditions. Basigin (BSG), a glycosylated protein, plays an important role in MMP induction and inflammation. The role of BSG during early stages of placental development is not yet clear, nor the process by which BSG is secreted by trophoblast cells. This study investigated the mechanism of BSG secretion from trophoblast cells in extracellular vesicles (EVs) and whether BSG release in EVs is a regulated process. RT-PCR was used to identify BSG isoforms 2, 3, and 4 in the trophoblast-like cell lines JAR, JEG-3, and HTR-8/SVneo. BSG protein expression was confirmed in trophoblast cell lines and conditioned medium by immunoblotting. We confirmed that BSG is released from HTR-8/SVneo cells via EVs. Treatment of HTR-8/SVneo cells with the protein kinase C activator PMA increased release of BSG-containing EVs, whereas the protein kinase C inhibitor Bis reduced release. Hypoxia/reoxygenation increased BSG protein in released EVs. IL-1β enhanced, while TGF-β1 reduced BSG in released EVs. This effect occurred at the post-transcriptional level as the quantity of EVs released and levels of BSG mRNA expression in HTR-8/SVneo cells were not altered. Our findings support that BSG, released via EVs, may play an important role in facilitating interactions between trophoblast cells and uterine cells during early stages of placental development.

Keywords: Early placental development, trophoblast, basigin, Extracellular vesicles

INTRODUCTION

A successful pregnancy and implantation are the results of tightly regulated processes that ensure the establishment and maintenance of maternal-fetal interactions. Implantation begins with the adhesion of the blastocyst to the receptive uterine epithelium then followed by trophoblast differentiation and the invasion into the maternal endometrium (Cross et al., 1994, Fournier et al., 2021, Bagchi and Bagchi, 2024). Proper trophoblast invasion and remodeling of the uterine vasculature ensure a sufficient nutrient and oxygen supply to the growing embryo (Pijnenborg, 1990, Moser et al., 2018). The remodeling of spiral arteries is essential to create a conducive environment for growing embryos (Huppertz, 2008, Patel et al., 2010). However, abnormal trophoblast invasion and defective spiral artery remodeling during the first trimester are associated with serious pregnancy complications, such as fetal growth restriction and preeclampsia (Lyall et al., 2013, Ortega et al., 2022). Hypoxia is a normal physiologic condition during early pregnancy. Abnormal remodeling of the uterine spiral arteries can lead to ischemia-reperfusion. This change in the uterine environment from low oxygen to reoxygenation i.e (hypoxia/reoxygenation) induces oxidative stress, alteration in angiogenesis, enhanced inflammatory response, and leads to preeclampsia and fetal growth restriction (Rosser and Katz, 2013, Chiarello et al., 2020).

Remodeling of the uterine arteries and trophoblast invasion are regulated by various factors, such as matrix metalloproteinases (MMPs), hypoxic conditions, immunomodulatory cytokines, chemokines, and cellular growth factors (Harris, 2010, Albrecht and Pepe, 2020, Bacon et al., 2024). The cytokines IL-1β and TGF-β1 play a vital role in modulating trophoblast proteases (Karmakar and Das, 2002, Prutsch et al., 2012, Cheng et al., 2013). Basigin (BSG) has various names, including CD147 and EMMPRIN, and is a multifunctional glycoprotein (Biswas et al., 1995, Miyauchi et al., 1990). This protein plays a crucial role in many physiological and pathological processes, for example, cell adhesion (Muramatsu, 2016), extracellular matrix degradation (Guindolet and Gabison, 2020), angiogenesis (Li and Nowak, 2020), and monocarboxylate transporter shuttling to the plasma membrane (Koltai and Fliegel, 2024). Its role in extracellular matrix degradation, through the regulation of MMPs, facilitates the breakdown of structural barriers, thus enabling trophoblast penetration into maternal tissues (Li and Nowak, 2020). Acting as both a ligand and a receptor, BSG, in its soluble form can interact with the transmembrane form to activate the extracellular signal-regulated kinase (ErK signaling) and enhance MMP production in uterine fibroblasts (Belton et al., 2008, Peterson, 2017). Additionally, BSG is released from cells, including both normal and tumor-derived cells, via extracellular vesicle (EVs) release from the plasma membrane (Comber et al., 2017, Watanabe et al., 2023).

EVs, including both microvesicles and exosomes, are membrane-bound nanoparticles involved in cell-to-cell communication by transferring proteins, lipids, and miRNAs (Nabeel and Nowak, 2025). Microvesicles are formed by plasma membrane budding, while exosomes originate from multivesicular bodies through endosomal pathways (Raposo and Stoorvogel, 2013, Dixson et al., 2023, Welsh et al., 2024). Studies have shown that full-length BSG is packaged into EVs from the surface of lung carcinoma cells (Sidhu et al., 2004). These BSG-containing EVs are capable of binding to receptors on fibroblasts, initiating the induction of MMPs, and promoting tumor invasion and metastasis (Taylor et al., 2002). In human ovarian carcinoma cells, BSG-containing EVs have been found to promote angiogenesis and upregulate MMP expression in endothelial cells, hence emphasizing their role in cancer progression and angiogenesis (Sidhu et al., 2004). Additionally, uterine epithelial cells release BSG via EV release that stimulates MMP production in uterine stromal cells, facilitating endometrial tissue remodeling (Braundmeier et al., 2012).

BSG plays a significant role in various reproductive processes, including fertilization (Li et al., 2021), implantation (Li and Nowak, 2020), and parturition (Li et al., 2004). Studies have shown that both embryonic and uterine expression of BSG is essential for successful implantation. In mice, BSG expression is upregulated in the uterine endometrial epithelium at the sites of embryo apposition (Kuno et al., 1998). BSG knockout embryos fail to implant, even though they develop normally during the pre-implantation stage (Li and Nowak, 2020). Furthermore, BSG is expressed in pre- and peri-implantation embryos, with localization in both the inner cell mass and trophectoderm (Chen et al., 2007). In humans, BSG is expressed in trophoblast cells and amniotic epithelial cells of the term placenta, where it is thought to promote MMP production and facilitate fetal membrane rupture and placental detachment during labor (Li et al., 2004, Dang et al., 2013).

While BSG expression and its roles during implantation and labor have been previously studied, its function in the first trimester of pregnancy remains largely undefined. Additionally, the mechanisms by which trophoblast cells release BSG have not yet been studied. We hypothesize that BSG is expressed in the first-trimester trophoblast cells and is released into the extracellular environment via EV release, similar to its release from tumors and other normal cell types. This EV-mediated release of BSG may enable paracrine communication with maternal uterine cells. Furthermore, we hypothesize that the release of EVs by trophoblast cells is a highly regulated process and can be modulated by specific factors i.e (Hypoxia, protein kinase C activator PMA, and protein kinase C inhibitor Bis) and by cytokines i.e (IL-1β and TGF-β1) (Sidhu et al., 2004).

MATERIALS AND METHODS

Cell Culture

The immortalized human trophoblast cell line (HTR-8/SVneo) derived from the first-trimester placenta (Graham et al., 1993), and the human carcinoma cell lines (JAR and JEG-3 from ATCC) were provided by Dr. Stephen Charnock-Jones from Cambridge University, UK. All cell culture experiments were performed at 37 °C with 5% CO2. The cell lines JAR (passage # 6–8), JEG-3 (passage # 5–7), and HTR-8/SVneo (passage # 10–18) at 3.5 × 104 cells/cm2 were cultured in RPMI 1640 medium (Cellgro, Manassas, VA, catalog # 10–040) supplemented with penicillin (100U/ml) and streptomycin (100 μg/ml). The HTR-8/SVneo cells were further enriched with 5% heat-inactivated fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA, catalog # S11150), while JAR and JEG-3 cells were cultured with 10% and 5% fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA, catalog # S11150), respectively. The cells were passaged upon 80% confluency. A 1x trypsin-EDTA Solution, 1ml (Plant cell Labs, catalog # TRL02) was used to detach the cells, and cells were collected in 15 ml tubes and seeded at 3.5 × 104 cells/cm2 in new flasks.

RNA Extraction and Gene Expression

Total RNA extraction and cDNA synthesis from cells were performed using the method as described by (Bashir et al., 2022). In brief, total RNA was isolated from cells using RNeasy Mini kit (Qiagen Inc., Valencia, CA, catalog # 74104) according to the manufacturer’s guidelines. For cDNA synthesis, total RNA (0.5 μg) was reverse transcribed using a high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Atlanta, GA, Catalog #4368814). RT-PCR analyses were performed in triplicate in 10 μl reactions containing TaqMan® Universal PCR Master Mix (4304437, Applied Biosystems, Atlanta, GA), diluted cDNA, nuclease-free water, and 20X Assays-on-Demand™ Gene Expression Assay (Applied Biosystems, Atlanta, GA) reagents. 20X Assays-on-Demand™ Gene Expression Assays were purchased for the following genes: basigin (Applied Biosystems catalog # HS00174305-m1) and the processing of precursor 4 (POP4) (Applied Biosystems catalog # Hs00198357-m1). The PCR reactions were conducted in MicroAmp Optical 384-Well Reaction Plates (Applied Biosciences, Catalog # 4309849). Relative gene expression changes were determined using the 2-ΔΔCT method, normalized to the endogenous control gene POP4. For non-quantitative RT-PCR analysis to identify BSG splice variants, 2μg of total RNA per sample was converted to cDNA using the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, catalog # 18080–051). A cDNA synthesis mixture containing 5x First-Strand Buffer, 0.1 M DTT, RNaseOUT, and SuperScript III Reverse Transcriptase, was added and incubated sequentially at 25°C for 5 minutes, 50°C for 1 hour, and then 70°C for 15 minutes to terminate the reaction. The resulting cDNA was used for RT-PCR in 50μl reactions prepared with Takara Prime STAR HS DNA Polymerase Reaction Mix (Takara Bio Inc., Shiga, Japan, code # R010A), which includes polymerase, 5x PCR Buffer (Mg2+), and dNTP mix. The reaction also contained cDNA, forward and reverse primers, and sterilized water. Oligonucleotide primers for BSG isoforms (BSG-2, BSG-3, BSG-4) were obtained from integrated DNA Technologies, with sequences as follows: BSG-2, basigin isoform 2 (F: 5’-GCGAGGAATAGGAATCATGG-3’, R: 5’-TACTCTCCCCACTGGTCGTC-3’); BSG-3, basigin isoform 3 (F: 5’-TTAGTCTGCGGTCCTCTTGC-3’, R: 5’- TACTCTCCCCACTGGTCGTC -3’); BSG-4, basigin isoform 4 (F: 5’- TTAGTCTGCGGTCCTCTTGC -3’, R: 5’- TACTCTCCCCACTGGTCGTC -3’).

Phorbol 12-myristate 13-acetate (PMA) and Bisindolylmaleimide (Bis) Treatment Studies

HTR-8/SVneo cells passage numbers from 10–18 were cultured until they reached 80% confluence and then transferred to a serum-free medium supplemented with L-glutamine and antibiotics for 24 hours before the treatment. For PMA (a protein kinase C activator) experiments, cells were treated with 0, 100, or 200 ng/ml PMA (Sigma-Aldrich, St. Louis, MO, catalog # P1585-IMG) for either 2 or 4 hours in a serum-free medium. For Bis (a protein kinase C inhibitor) experiments, cells were treated with serum-free medium alone, vehicle control, 100 ng/ml PMA, 4.5 ng/ml Bis (EMD Millipore, Billerica, MA, catalog # 203291) alone, a combination of 100 ng/ml PMA and 4.5 ng/ml Bis for 2 hours, or 4.5 ng/ml Bis for 1 hour followed by 100 ng/ml PMA for an additional 2 hours. These treatment time points and concentrations are based on previous studies (Sidhu et al., 2004). Following the treatment periods, the conditioned medium was collected for the isolation of EVs and supernatant and stored at −20°C until they were used for immunoblotting analysis.

IL-1β and TGF-β1 Treatment Studies

HTR-8/SVneo cells were cultured to approximately 80% confluence, after which they were transferred to a serum-free medium supplemented with L-glutamine and antibiotics for 24 hours. Following this, cells were treated with either serum-free medium alone, 1, 2.5, or 5 ng/ml IL-1β (R&D Systems, Minneapolis, MN, catalog # P1585-IMG) or 1, 2.5, or 5 ng/ml TGF-β1 (R&D Systems, Inc., Minneapolis, MN, catalog # 240-B) for 0, 8, or 24 hours. Following the treatment periods, conditioned medium was collected, and EVs were isolated and stored at −20°C for subsequent immunoblotting. RNA was also extracted from the cells for RT-PCR analysis as described earlier.

Hypoxia/Reoxygenation Experiment

Cells were cultured until they reached approximately 60–70% confluence and then transferred to a serum-free medium supplemented with L-glutamine and antibiotics for a 24-hour incubation period. Following this, the cells were subjected to one of four conditions: (1) 2% O2, (2) 8% O2, (3) 20% O2 for 4 hours and 30 minutes, or (4) hypoxia/reoxygenation (4 hours at 2% O2 followed by 30 minutes at 8% O2). Apoptosis in the cells was not triggered due to different O2 concentrations (Supplementary Fig.1C). Low oxygen conditions were achieved using a humidified incubator equipped with individually controlled chambers (Hypoxia Control System, Plas Labs, Inc., Lansing, MI). After the incubation, a conditioned medium was collected for the isolation of EVs and supernatant and stored at −20°C for immunoblotting.

Cell Lysate Collection and Concentration of Conditioned Cell Medium

Culture medium was removed when the cells became 80% confluent and were washed with PBS twice before collection. Cell lysates were prepared using preheated (95°C for 5 minutes) 1X Laemmli sample buffer (LSB), containing 10% glycerol, 62.5 mM Tris Base pH 6.8, 2% sodium dodecyl sulfate. Cells were scraped manually, and the lysates were sonicated and centrifuged at 14,000 × g for 10 minutes to remove cellular debris. The resulting samples were collected and stored at −20°C until further processing. Conditioned cell medium was directly collected from treated cell cultures after the time mentioned for specific treatments, centrifuged at 1,000 × g for 10 minutes to eliminate debris, and concentrated using Amicon Ultra-15 centrifugal filter units with a 10-KDa cutoff (EMD Millipore, Billerica, MA, catalog # UFC91024). The medium was concentrated to 10-, 30-, or 50-fold. These concentrated samples were stored at −20°C for subsequent analysis.

Extracellular Vesicle Isolation

Human trophoblast cell lines were cultured at 3.5 ×104 cells/cm2 until reaching approximately 80% confluence and medium was replaced by a RPMI 1640 serum-free medium with L-glutamine (cellgro, Manassas, VA, catalog # 10–040) and antibiotics (penicillin (100U/ml) and streptomycin (100 μg/ml) and incubated for 24 hours at this confluency. The conditioned medium from 2 flasks (25ml/flask) was collected and combined for each experiment and subjected to centrifugation at 1500 × g for 10 minutes. The supernatant was centrifuged once again at 1500 × g for 15 minutes to remove cellular debris. Half of the conditioned medium was stored at −20°C for later use. The remaining half of the supernatant was ultracentrifuged at 100,000 × g for 1 hour at 4°C. Following the ultracentrifugation, the EV pellets and supernatant were saved at −20°C for further analysis. Isolated EVs were characterized according to International Society for Extracellular vesicles (ISEV) guidelines using nanoparticle tracking analysis (NTA) for their size, scanning transmission electron microscope (STEM) for their morphology, and western blotting for tetraspanin proteins CD9 and CD81. EVs were characterized using three independent biological replicates n=3. NTA was performed after isolating EVs from treated samples.

Nanoparticle Tracking Analysis

The NanoSight NS300 system is equipped with a blue laser (405) and was used for EV analysis. The instrument was calibrated using polystyrene beads according to the manufacturer’s instructions. EV samples diluted in PBS (1:100) were loaded into the sample chamber of the NanoSight NS300, and analysis was performed using the NanoSight software. Each sample was analyzed for 60 seconds with two replicates. The NanoSight software automatically tracked and recorded the Brownian motion of the individual EVs in real time.

Scanning Transmission Electron Microscope Analysis

The isolated EVs were placed on a 200-mesh Ted Pella TEM grid for 3 minutes, followed by negative staining with 2% uranyl acetate for 30 seconds. The prepared grids were loaded onto a scanning transmission electron microscope (Thermo Fisher FEI Tecnai G2 F20 S-TWIN STEM). Imaging was performed at an acceleration voltage of 160 kV. EVs were visualized at various magnifications to observe their morphology and structure. Images were captured using an attached digital camera system (AMT BIOSPR16).

Immunoblotting

Protein samples were denatured in 4X LSB dye (Containing 10% glycerol, 50 mM Tris Base, 2% sodium dodecyl sulfate, 100 mM dithiothreitol, and 0.025% Bromphenol Blue) by heating at 95°C for 5 minutes. The samples were loaded and run for an hour onto 4–20% precise protein gradient gels (Thermo Scientific, Rockford, IL, catalog # PI-25244) and subsequently transferred to the membranes made of nitrocellulose (Thermo Scientific, Rockford, IL, catalog # 88018) or PVDF (EMD Millipore, Billerica, MA, catalog # IPVH00010) through overnight transfer. To block nonspecific binding, the membranes were incubated for 1 hour at room temperature with 5% nonfat dry milk. Membranes were then treated overnight at 4°C with primary antibodies diluted in TBST containing 2% BSA. Afterward, membranes were incubated for 1 hour at 25°C with HRP-conjugated secondary antibodies diluted in TBST containing 2.5% nonfat dry milk at a dilution of 1:10,000. The primary antibodies that were used, include purified mouse anti-human CD147 (BD Biosciences, San Jose, CA, catalog # 555961, 0.5 mg/ml), rabbit polyclonal anti-human MCT1 (H-70) (Santa Cruz Biotechnology, Santa Cruz, CA, catalog # sc-50324, 200μg/ml), and mouse anti-human integrin B1 (Chemicon International, Temecula, CA, catalog # MAB2251Z, 100μg/ml), anti-CD81 antibody (Abcam, Cambridge, UK, catalog # ab155760), anti-CD-9 antibody (Abcam, Cambridge, UK, catalog # ab223052), anti-Actin antibody (Abcam, Cambridge, UK, catalog # ab179467) at a dilution of 1:1000. Following secondary antibodies, HPR-linked anti-mouse IgG (Cell Signaling, Danvers, MA, catalog # 7076S) or HPR-linked anti-rabbit IgG (Cell Signaling, Danvers, MA, catalog # 7074S) incubation, membranes were washed six times for 5 minutes each with TBST. The immunocomplexes were visualized using SuperSignal West Pico Chemiluminescent Substrate (Pierce Chemical Co., Rockford, IL, catalog # PI34080). Protein standards were provided by the precision Plus Protein all-blue molecular weight marker (Bio-Rad Laboratories, Hercules, CA, catalog # 161–0373). Densitometric analysis of protein bands was performed using the ImageJ software provided by the National Institutes of Health.

BCA Protein Assay

The protein concentration in the EV pellets was measured using the BCA protein assay. The BCA protein assay kit (Thermo Scientific, Rockford, IL, catalog # 23225) was used, following the manufacturer’s guidelines for the microplate method. Absorbance readings at 570nm wavelength were obtained using a μ Quant microplate spectrophotometer (Bio-Tek Instruments, Inc., Winooski, VT, SKU Lab2434). Total protein in the samples were measured by comparing their intensities with the standard used, provided in the assay kit.

Data and Statistical Analysis

Experimental outcomes were analyzed using an ANOVA model after assessing normality using the Shapiro-Wilk test in the SAS software (SAS Institute Inc.). To determine the statistical differences between treatments, planned comparisons were conducted using orthogonal contrast statements. The measured outcomes included integrated density values for densitometry, total extracellular vesicle protein quantified via BCA assay, and the 2-ΔΔCt between the target gene and POP4 for gene expression analysis. For gene expression analysis, the threshold cycle was defined as the point where transcripts entered the linear phase of amplification. The 2-ΔΔCt valves were normalized against control treatment expression and expressed as relative fold changes. At least 3 biological replicates were used for each experiment.

RESULTS

Human Trophoblast-Like Cells JAR, JEG-3, and HTR-8/SVneo Express BSG Transcript Variants 2–4 and Release BSG into Medium via Extracellular Vesicular Release.

BSG mRNA transcript and protein expression were analyzed in two choriocarcinoma cell lines JAR and JEG-3, as well as in the first-trimester trophoblast cell line HTR-8/SVneo (Fig.1).

Fig.1:

Fig.1:

Open in a new tab

Human trophoblast-like cells JAR, JEG-3, and HTR-8/SVneo express BSG transcript variants 2–4 and release BSG protein into the surrounding medium. (A) RT-PCR for BSG transcript variants 2–4 in cultured trophoblast-like cell lines. M, base pair marker; Ctr, no template negative control; +, detected BSG transcript variants; -, no RT negative control; (B) Immunoblotting shows BSG in JAR, JEG-3, and HTR-8/SVneo cell lysates (5 or 10 μg total protein was loaded). (C) Immunoblotting shows BSG in JAR, JEG-3, and HTR-8/SVneo 1x (unconcentrated) or 10, 30, 50 x concentrated conditioned medium collected after 24 h incubation. (D) Immunoblotting shows BSG is released from JAR, JEG-3, and HTR-8/SVneo human trophoblast-like cells via EV release. Lane 1, 1x unconcentrated trophoblast-cell clarified conditioned medium; lane 2, 30x concentrated clarified conditioned medium; lane 3, supernatant after ultracentrifugation; lane 4, EVs pellet. Equal volumes of 1x or 30x conditioned medium, supernatant, or resuspended EV pellets were loaded. HES, human uterine epithelial cell line was used as a positive control. For all experimental conditions three biological replicates were used (n=3).

RT-PCR was carried out using primers specific to each variant to determine the expression of the different transcript variants. Three distinct bands corresponding to BSG transcript variants 2, 3, and 4 were identified in all three trophoblast-like cell lines. (Fig.1A). Transcript variant 2 was the most abundantly expressed, as six times more PCR product was loaded to visualize transcript variants 3 and 4 on the gels. (10μl of PCR product was loaded for transcript 2 and 60μl for variants 3 and 4). BSG protein was detected in all three cell lines in the cell lysates and appears as a smear on blots (Fig.1B). Interestingly, the choriocarcinoma cell lines showed a higher level of glycosylation compared to the HTR-8/SVneo cells. BSG protein was also found in the conditioned medium of these cell lines (Fig.1C). We were not able to detect BSG in the conditioned medium before ultracentrifugation or in the supernatant after ultracentrifugation. However, BSG was detected in the EV pellets isolated from the conditioned medium (Fig.1D). A small amount of BSG protein was detected in the 30-fold concentrated conditioned medium before ultracentrifugation. From these findings, we concluded that BSG is predominantly released via EVs release. We also performed immunoblotting for the additional cell membrane proteins MCT1 and ITGB1 on the EV pellets to confirm the vesicular origin. For further downstream analysis, how the release of BSG in EVs is regulated, we used only HTR-8 SV/neo cells because it is physiologically more relevant to the human extravillous trophoblast as compared to the other two cancer cell lines.

Characterization of Extracellular Vesicles from Human Trophoblast HTR-8/SVneo Cell Line.

EVs were isolated from the conditioned medium of HTR-8/SVneo cells using ultracentrifugation. EVs were characterized for their shape, size, and known biomarkers for EVs (Fig.2). TEM was used to visualize the cup-shaped morphology of the EVs. TEM showed the presence of both types of EVs, small (20–150 nm) as well as large (150–1000 nm) EVs (Fig.2A). Nanoparticle tracking analysis (NTA) analysis was used to determine the size of the EVs. The size of the EVs was found to range between 50 nm–550 nm (Fig.2B). Expression of tetraspanin proteins CD9 and CD81 was confirmed by Western blot in the EV pellets (Fig.2C).

Fig.2:

Fig.2:

Open in a new tab

EVs are present in HTR-8/SVneo cells (A). Scanning transmission electron microscopy showed the cup-shaped structure of EVs. (B) Nanoparticle tracking analysis revealed that the range of EV size is between 50–550 nm. (C) Western blot analysis showed the presence of CD81 and CD9 in EVs isolated from HTR-8/SVneo cells, n=3. Western blot uncropped picture is available in supplementary data, supplementary Fig.1A.

Secretion of BSG-Containing Extracellular Vesicles by HTR-8/SVneo Cells is Regulated by the PKC Activator PMA and the PKC Inhibitor Bis

We utilized a tumor promoter PMA, a diacylglycerol (DAG) analog (that activates the PKC signaling pathway) to investigate the mechanism of BSG release via EVs in HTR-8/SVneo cells. HTR-8/SVneo cells treated with 0, 100, and 200 ng/ml of PMA for 2 or 4 hours showed a significant increase in BSG release within EVs in both time and dose-dependent manner (Fig.3A). To show that there was no substantial degradation over the treatment period supernatants (S) were also analyzed. At the 0-hour time point, BSG release in the EVs was not detectable. To confirm a role for PKC in the EV release, HTR-8/SVneo cells were treated with serum-free medium (SF), 0.1% ethanol (EtOH), 100 ng/ml PMA, 4.5 ng/ml Bisindolylmaleimide I (Bis; a PKC inhibitor), or a combination of Bis and PMA (Bis+PMA) for 2 hours. In addition, some cells were pretreated with Bis for 1 hour before exposure to the PMA (Bis/PMA) (Fig.3B). Our results showed that Bis inhibited the release of BSG containing EVs induced by PMA, supporting a role for PKC activation in regulating EV release (Fig.3A and B).

Fig.3:

Fig.3:

Open in a new tab

BSG release via EVs by HTR-8/SVneo cells is stimulated by the PKC activator PMA and inhibited by the PKC inhibitor Bis. (A) Immunoblotting shows that PMA (100 ng/ml, 200 ng/ml) stimulates an increase in BSG, MCT1, and ITGB1 levels in EVs isolated from HTR-8/SVneo cell ultracentrifuged conditioned medium collected after 2 or 4 h incubation in a time- and dose-dependent manner. S, supernatant after ultracentrifugation; P, resuspended EV pellets; (B) Immunoblotting of HTR-8/SVneo EVs collected after 2 h treatment showing that induction of BSG, MCT, and ITGB1 release in EVs by PMA (100 ng/ml) is inhibited by the PKC inhibitor Bis (4.5 ng/ml). Immunoblotting shows resuspended EV pellets isolated from ultracentrifuged conditioned medium after treatment with serum free medium (SF), 0.1% ethanol (EtOH) vehicle control, 100 ng/ml PMA, 4.5 ng/ml Bis, 100 ng/ml PMA and 4.5 ng/ml Bis combined for 2 h (Bis+PMA), or a 1 h 4.5 ng/ml Bis pretreatment followed by 2 h 100 ng/ml treatment with PMA (Bis/PMA).

Extracellular Vesicle Release and BSG Release by HTR-8/SVneo Cells are Increased in Response to Hypoxia/Reoxygenation

To evaluate the effect of hypoxia/reoxygenation on BSG release via EVs release, we analyzed BSG protein levels under different oxygen conditions. Hypoxia/reoxygenation (2% / 8% O2) increased the release of BSG via EV release as compared to cells maintained in 2%, 8%, or 20% O2 alone (Fig. 4A). This increase in BSG release via EVs was associated with an overall increase in EV release, as determined by higher total protein in the EV fractions (Fig.4B).

Fig.4:

Fig.4:

Open in a new tab

BSG release via EVs by HTR-8/SVneo cells and overall amounts of EVs shed are increased in response to hypoxia/reoxygenation. (A) Immunoblot showing BSG levels in EV fractions isolated from HTR-8/SVneo cell ultracentrifuged conditioned medium after exposure of trophoblast cells to 2%, 8%, or 20% oxygen levels for 4h 30 min, or hypoxia/reoxygenation conditions (4h at 2% followed by 30 min at 8% oxygen). (B) BCA assay analysis of total protein content within the EV fractions isolated from HTR-8/SVneo cell ultracentrifuged conditioned medium. * Indicates significance between treatment groups (n=3; *p<0.05).

TGF-β1 Inhibits BSG Release in EVs but Does Not Affect Overall EV Release or BSG mRNA Levels in HTR-8/SVneo cells.

To investigate the effect of transforming growth factor-beta 1 (TGF- β1) (known to inhibit trophoblast invasion), HTR-8/SVneo cells were treated with 0, 1, 2.5, or 5 ng/ml of TGF- β 1 for either 8 or 24 hours. Immunoblotting was done on isolated EVs to determine the BSG protein levels. The results showed that the release of BSG via EVs was reduced after both 8 hours (Fig.5A) and 24 hours (Fig.5D) of TGF- β1 treatment in a dose-dependent manner. There was no difference in total protein between treatments either at 8 (Fig.5B) or 24 hours (Fig.5E). This indicated that the total amount of EVs released remained unchanged. There was no difference in BSG transcript levels by qPCR in the HTR-8/SVneo cells either at 8 (Fig.5C) or 24 hours (Fig.5D) of TGF- β1 treatment. These results led us to conclude that the reduction of BSG protein in response to TFG- β1 was not due to a decrease in BSG gene transcription or EV release but was due to selective inhibition of BSG incorporation into EVs at a post-transcriptional level.

Fig.5:

Fig.5:

Open in a new tab

Incorporation of BSG protein into EVs is decreased while overall amounts of EVs shed and BSG mRNA levels in HTR-8SV/neo cells did not change after treatment with 0, 1, 2.5, and 5 ng/ml TGF-β1 for 8 or 24 hours. (A) Immunoblotting shows a decrease in BSG, MCT1, and ITGB1 levels in EVs after TGF-β1 treatments for 8 hours. HES, human uterine epithelial cell line used as a positive control. The * indicates a significance between untreated samples at 0 hours compared to 8 hours. Bars with different letters are significantly different from each other after 8 hours (n=3; p<0.05). (B) BCA assay of total protein content in EV fractions indicates no change in overall amounts of EVs shed. The * indicates a significance between untreated samples at 0 hours compared to 8 hours (n=3; p<0.05). (C) No change in BSG mRNA levels occurred in HTR-8SV/neo cells in response to treatments (n=3). (D) Immunoblotting shows a decrease in BSG, MCT1, and ITGB1 levels in EVs isolated from ultracentrifuged conditioned medium after TGF-β1 treatments for 24 hours. 0 h showing no release of BSG in EVs occurred at 0 hours of treatment. HES, human uterine epithelial cell line used as a positive control. The * indicates a significance between untreated samples at 0 hours compared to 24 hours. Bars with different letters are significantly different from each other after 24hours (n=3; p<0.05). (E) BCA assay analysis of total protein content in EV fractions indicates no change in overall amounts of EVs shed. The * indicates a significance between untreated samples at 0 hours compared to 24 hours. (F) No change in BSG mRNA levels occurred in HTR-8SV/neo cells in response to treatments (n=3).

IL-1β Stimulated BSG Release in Extracellular Vesicles but Did Not Affect Overall Extracellular Vesicle Release or BSG mRNA Levels in HTR-8/SVneo cells.

HTR-8/SVneo cells were treated with a known promoter of trophoblast invasion IL-1β. To investigate its effect on the release of BSG via EVs, HTR-8/SVneo cells were treated with 0, 1, 2.5, or 5 ng/ml of IL-1β for 8 or 24 hours. EVs were isolated and immunoblotting was performed to determine BSG release. The results showed an increase in BSG release via EVs after 8 hours of treatment, but this effect was not dose-dependent (Fig.6A), and there was no effect on BSG release after 24 hours of treatment (Fig.6D). The total amount of protein in EVs was assessed and there was no difference in the total amount of protein across treatments at either 8 (Fig.6B) or 24 hours (Fig.6E). We observed no difference in BSG transcript level in HTR-8/SVneo cells s by qPCR at any tested concentration of IL-1β after 8 (Fig.6C) or 24 hours (Fig.6F) of treatment. Our findings indicated that IL-1β induced a rapid increase in BSG protein release in EVs at 8 hours but not at 24 hours. The observed increase in BSG level in EVs was again likely due to the selective incorporation of BSG protein into EVs at a post-translational level.

Fig.6:

Fig.6:

Open in a new tab

Incorporation of BSG into EVs is increased while overall amounts of EVs shed and BSG mRNA levels in HTR-8SV/neo cells did not change after treatment with 0, 1, 2.5, and 5 ng/ml IL-1β for 8 hours. (A) Immunoblotting shows the increase in BSG, MCT1, and ITGB1 levels in EV fractions isolated from ultracentrifuged conditioned medium after IL-1β treatments for 8 hours. 0 h showing no release of BSG in EVs occurred at 0 hours of treatment. HES, human uterine epithelial cell line used as a positive control. The * indicates a significance between untreated samples at 0 hours compared to 8 hours. Bars with different letters are significantly different from each other after 8 hours (n=3; p<0.05). (B) BCA assay analysis of total protein content in EV fractions indicates no change in overall amounts of EVs shed. The * indicates a significance between untreated samples at 0 hours compared to 8 hours (n=3; p<0.05) (C) No change in BSG mRNA levels occurred in HTR-8/SVneo in response to treatments (n=3). (D) Immunoblotting shows no change in BSG, MCT1, and ITGB1 levels in EV fractions isolated from ultracentrifuged conditioned medium after IL-1β treatments for 24 hours. 0h showing no release of BSG in EVs occurred at 0 hours of treatment. HES, human uterine epithelial cell line used as a positive control. The * indicates a significance between untreated samples at 0 hours compared to 24 hours (n=3; p<0.05). (E) BCA assay analysis of total protein content in EV fractions indicates no change in overall amounts of EVs shed. The * indicates a significance between untreated samples at 0 hours compared to 24 hours (n=3; p<0.05). (F) No change in BSG mRNA levels occurred in HTR-8 SV/neo cells in response to treatments (n=3).

DISCUSSION

The placenta is a highly specialized organ that plays a vital role in the establishment and maintenance of a successful pregnancy (Boss et al., 2018). During early pregnancy, the controlled invasion of trophoblast into maternal uterine tissues and the remodeling of uterine spiral arteries are important processes. Proteolytic enzymes such as matrix metalloproteinases (MMPs), cellular growth factors, cytokines, and oxygen concentration are the key factors that regulate these processes (Nissinen and Kähäri, 2014). BSG protein is known to induce MMP secretion and plays a critical role in embryonic implantation and parturition (Li and Nowak, 2020, Guindolet and Gabison, 2020, Igakura et al., 1998). Proper maternal-fetal communication is required for a successful pregnancy. EVs play an important role in cell-to-cell communication through their cargos, i.e. proteins, miRNA, and nucleic acids (van Niel et al., 2022). Our goal for this study was to investigate the mechanism of release of BSG via EV release in trophoblast-like cell lines.

Our current findings showed the expression of BSG in two human choriocarcinoma cell lines JAR, JEG-3, and a human trophoblast cell line HTR-8/SVneo. Immunoblotting showed that BSG is a highly glycosylated protein and ranges in size from 37–75 kDa. Our results were consistent with previous reports that BSG is a highly glycosylated protein (Miyauchi et al., 1990, Cui et al., 2018). It was previously reported by Miyauchi et al that the molecular weight of BSG ranges between 43–66 kDa, and non-glycosylated BSG is 27 kDa (Miyauchi et al., 1990). Similarly, Li et al. identified BSG with a molecular weight of 30 kDa and 40–55 kDa in human-term placentas from both laboring and non-laboring patients (Li et al., 2004). These findings highlight that BSG is a highly glycosylated protein, and its molecular weight varies across cell lines and tissues depending on the level of glycosylation. Interestingly, the degree of glycosylation influences BSG biological activity and localization. The highly glycosylated (HG-CD147) form is considered the biologically active form responsible for inducing MMPs, modulating interactions with MCTs, and facilitating its incorporation into the plasma membrane. On the other hand, the core-glycosylated low-glycosylation (LG-CD147) form (32 kDa) is an immature precursor found predominantly in the endoplasmic reticulum (Bai et al., 2014).

We also identified that the trophoblast cells express BSG transcript variants 2, -3, and -4. Previous studies reported that BSG has 4 transcript variants, BSG 1, -2, -3, and -4, that encode BSG isoforms 1, -2, -3, and -4, respectively (Belton et al., 2008, Solstad et al., 2023, Xiong and Deng, 2024). Belton et al. and Xiong el al. reported that BSG-2 was the predominant splice variant, which encoded the BSG protein with two immunoglobulin-like domains, and this was the only secreted isoform (Belton et al., 2008, Xiong and Deng, 2024). BSG transcript variants 3 and 4 were less abundant. Liao et al. reported that overexpression of BSG -3 isoform inhibited the proliferation of hepatocellular carcinoma cells, induction of MMPs, and cellular invasion (Liao et al., 2011). Our current findings were consistent with the previously discussed studies. We detected the transmembrane form, transcript variant-2, as well as the two intracellular forms, transcript variant-3 and -4 in trophoblast-like cell lines. Transcript variant-2 was the most abundant and was consistent with prior findings (Belton et al., 2008, Xiong and Deng, 2024).

Our findings confirmed that BSG is secreted in EVs from trophoblast cells. Several previous studies have reported that BSG is shed in EVs. Sugimoto et al. reported that BSG was released in EVs from peritoneal mesothelial cells (PMCs) and promoted gastric cancer (GCs) cell invasion (Sugimoto et al., 2021). In another study, Braundmeier et al. found that the full intact form of BSG protein was released by human uterine epithelial cells (HECs) through EV release and stimulated MMP production in human uterine fibroblast (HUFs) cells (Braundmeier et al., 2012). Proteomic analysis of the human first-trimester trophoblast cells, Swan-71 revealed the presence of BSG isoform-2 (Atay et al., 2011). Our findings support that trophoblast cells release BSG via EV release.

BSG secretion via EV release may play an important role in the remodeling of spiral arteries during early pregnancy. The mechanism through which BSG protein is released in EVs is not well understood. We investigated whether the release of BSG via EV release in HTR-8/SVneo cells was a regulated process. Our findings revealed that the PKC signaling pathway played a key role in the release of BSG via EV release. We also observed that HTR/SVneo cells exposed to hypoxia/reoxygenation significantly increased release of BSG via EVs. Exposure of HTR-8/SVneo cells to the inflammatory cytokine IL-1β enhanced, whereas TGF- β1 reduced BSG incorporation into EVs at the post-translational level, while overall release of EVs was unaltered. These results showed that the release of BSG via EVs by HTR-8/SVneo cells is a regulated process. Aoki et al. demonstrated that full-length BSG is released in EVs from epithelioid sarcoma cell lines and regulates MMP-2 production by fibroblast cells (Aoki et al., 2017). In a recent study Watanabe et al. revealed that BSG is released from primary-cultured proximal tubular epithelial cells (PTECs) in EVs from diabetic kidney disease patients and is regulated by proteinuria (Watanabe et al., 2023). Sidhu et al. investigated the release of BSG via EVs from tumor cells, which was increased by PMA, a known PKC activator, and thapsigargin, which induced the release of Ca2+ from the ER. Furthermore, Bis, a PKC inhibitor, along with the Ca2+ chelator BAPTA/AM and inhibitors targeting mitogen-activated protein kinase 1/2 (MEK 1/2), were all shown to suppress the PMA-mediated increase of BSG release. The above-mentioned studies indicated that the release of full-length BSG via EVs is a physiologically regulated process mediated by PKC, Ca2+, and MEK 1/2 dependent signaling pathways (Aoki et al., 2017, Watanabe et al., 2023, Sidhu et al., 2004). Our findings are consistent with the above-mentioned studies. We observed that the release of BSG via EVs from HTR-8/SVneo cells is increased in a time and dose-dependent manner with exposure to PMA but was reduced when cells were treated with Bis.

We also investigated the effect of hypoxia/reoxygenation on the release of BSG via EVs in HTR-8/SVneo cells. Extravillous trophoblast (EVT) cells invade the spiral arteries in the uterus, modifying their diameter and blood flow (Paul et al., 2023). In previous studies, it was proposed that oxidative stress in the placenta is increased by intermittent perfusion of oxygenated blood into the intervillous space, a process referred to as hypoxia/reoxygenation (Paul et al., 2023, Salomon et al., 2017). Salomon et al. reported that EVs isolated from cytotrophoblast cells in a hypoxic condition increased EVT proliferation and invasion. They also found a change in the protein content of EVs which was oxygen dependent (Salomon et al., 2013). Our findings revealed that hypoxia/reoxygenation increased the amount of BSG released in EVs by HTR-8/SVneo cells supporting that physiologic hypoxia during early pregnancy alters the proteins shed in EVs from the placenta.

Trophoblast invasion is a tightly controlled process, and trophoblast cells invade actively during the early stage of pregnancy. Previous studies have reported that trophoblast cells and decidual cells in the endometrium secrete IL-1β and TGF- β1 and these play an important role in trophoblast invasion (Mercnik et al., 2023, Karmakar and Das, 2002). Lee et al showed that BSG plays an important role in embryo implantation, trophoblast invasion, differentiation and ERK activation in human cytotrophoblast cells (Lee et al., 2013). We found that IL-1β increases the release of BSG protein via EVs at a post-transcriptional level, whereas TGF-β1 decreases the release of BSG. We did not find any change in the amount of total EV protein in response to these treatments. We propose that EVs containing BSG may act as signaling molecules and facilitate trophoblast invasion by increasing MMP activity from trophoblast or uterine cells. TGF-β1 reduced BSG incorporation into EVs suggesting that this may be one mechanism by which it can limit the invasive potential of trophoblast cells.

In summary, this study highlights a potential key role for BSG in trophoblast function and its role in placental development during early pregnancy. BSG, expressed abundantly in trophoblast-like cell lines, is released via EVs. These BSG-containing EVs serve as signaling molecules, stimulating MMP production in surrounding uterine cells, and may contribute to spiral artery remodeling. Our findings revealed that the release of BSG via EVs is a regulated process including through the PKC pathway, by specific cytokines, and by hypoxia/reoxygenation conditions. These results provide new insights into the interactions between trophoblast cells and the uterine environment during early pregnancy. Further research is needed to unravel the precise mechanisms regulating BSG incorporation into EVs and its downstream effects on placental development.

A potential limitation of our model is the use of the HTR-8/SVneo cell line rather than primary first-trimester trophoblast cells. HTR-8/SVneo cells are immortalized cells, which may alter certain signaling pathways, proliferation rates, and gene expression profiles compared to primary trophoblast cells. This cell line retains several functional characteristics of extravillous trophoblasts, including invasiveness and cytokine responsiveness, as Jovanovic and Vicovac reported that interleukin-6 stimulates the invasion and migration of HTR-8SV/neo cells. (Jovanović and Vićovac, 2009). However, due to ethical and technical limitations in accessing and culturing primary human trophoblast cells from early pregnancy, HTR-8/SVneo remains a widely accepted and valuable model for investigating the mechanistic aspects of trophoblast function. Moreover, the reproducibility and availability of HTR-8/SVneo cells make them well-suited for the experimental design in this study.

Supplementary Material

01

Acknowledgment

The authors would like to thank the past and current members of the Nowak Lab.

Funding

The study was funded by NIH grant U54HD40093.

Footnotes

Declaration of Interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

In Brief Statement: The release of basigin protein by human placental trophoblast cells via extracellular vesicle release is a regulated process. This study shows interactions of trophoblast cells with uterine cells during early placental development.

Data Availability

All data is available upon request.

References

  1. Albrecht ED & Pepe GJ 2020. Regulation of uterine spiral artery remodeling: a review. Reproductive Sciences, 27, 1932–1942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aoki M, Koga K, Hamasaki M, Egawa N & Nabeshima K 2017. Emmprin, released as a microvesicle in epithelioid sarcoma, interacts with fibroblasts. International journal of oncology, 50, 2229–2235. [DOI] [PubMed] [Google Scholar]
  3. Atay S, Gercel-Taylor C, Kesimer M & Taylor DD 2011. Morphologic and proteomic characterization of exosomes released by cultured extravillous trophoblast cells. Experimental cell research, 317, 1192–1202. [DOI] [PubMed] [Google Scholar]
  4. Bacon SJ, Zhu Y & Ghosh P 2024. Early spiral arteriole remodeling in the uterine–placental interface: A rat model. Journal of Anatomy. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bagchi IC & Bagchi MK 2024. Maternal–fetal mechanisms underlying adaptation to hypoxia during early pregnancy. Trends in Endocrinology & Metabolism. [DOI] [PubMed] [Google Scholar]
  6. Bai Y, Huang W, Ma L-T, Jiang J-L & Chen Z-N 2014. Importance of N-glycosylation on CD147 for its biological functions. International journal of molecular sciences, 15, 6356–6377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bashir ST, Chiu K, Zheng E, Martinez A, Chiu J, Raj K, Stasiak S, Lai NZE, Arcanjo RB & Flaws JA 2022. Subchronic exposure to environmentally relevant concentrations of di-(2-ethylhexyl) phthalate differentially affects the colon and ileum in adult female mice. Chemosphere, 309, 136680. [DOI] [PubMed] [Google Scholar]
  8. Belton RJ, Chen L, Mesquita FS & Nowak RA 2008. Basigin-2 is a cell surface receptor for soluble basigin ligand. Journal of Biological Chemistry, 283, 17805–17814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Biswas C, Zhang Y, Decastro R, Guo H, Nakamura T, Kataoka H & Nabeshima K 1995. The human tumor cell-derived collagenase stimulatory factor (renamed EMMPRIN) is a member of the immunoglobulin superfamily. Cancer research, 55, 434–439. [PubMed] [Google Scholar]
  10. Boss AL, Chamley LW & James JL 2018. Placental formation in early pregnancy: how is the centre of the placenta made? Human reproduction update, 24, 750–760. [DOI] [PubMed] [Google Scholar]
  11. Braundmeier A, Dayger C, Mehrotra P, Belton JR R & Nowak R 2012. EMMPRIN is secreted by human uterine epithelial cells in microvesicles and stimulates metalloproteinase production by human uterine fibroblast cells. Reproductive Sciences, 19, 1292–1301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chen L, Nakai M, Belton RJ & Nowak RA 2007. Expression of extracellular matrix metalloproteinase inducer and matrix metalloproteinases during mouse embryonic development. Reproduction, 133, 405–414. [DOI] [PubMed] [Google Scholar]
  13. Cheng J-C, Chang H-M & Leung PC 2013. Transforming growth factor-β1 inhibits trophoblast cell invasion by inducing Snail-mediated down-regulation of vascular endothelial-cadherin protein. Journal of Biological Chemistry, 288, 33181–33192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chiarello DI, Abad C, Rojas D, Toledo F, Vázquez CM, Mate A, Sobrevia L & Marín R 2020. Oxidative stress: Normal pregnancy versus preeclampsia. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease, 1866, 165354. [DOI] [PubMed] [Google Scholar]
  15. Comber L, Coote S, Finlayson M, Galvin R, Quinn G & Peterson E 2017. An exploration of fall-related, psychosocial variables in people with multiple sclerosis who have fallen. British journal of occupational therapy, 80, 587–595. [Google Scholar]
  16. Cross JC, Werb Z & Fisher SJ 1994. Implantation and the placenta: key pieces of the development puzzle. Science, 266, 1508–1518. [DOI] [PubMed] [Google Scholar]
  17. Cui J, Huang W, Wu B, Jin J, Jing L, Shi WP, Liu ZY, Yuan L, Luo D & Li L 2018. N‐glycosylation by N‐acetylglucosaminyltransferase V enhances the interaction of CD147/basigin with integrin β1 and promotes HCC metastasis. The Journal of pathology, 245, 41–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Dang Y, Li W, Tran V & Khalil RA 2013. EMMPRIN-mediated induction of uterine and vascular matrix metalloproteinases during pregnancy and in response to estrogen and progesterone. Biochemical pharmacology, 86, 734–747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dixson AC, Dawson TR, Di Vizio D & Weaver AM 2023. Context-specific regulation of extracellular vesicle biogenesis and cargo selection. Nature Reviews Molecular Cell Biology, 24, 454–476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fournier SB, D’errico JN & Stapleton PA 2021. Uterine vascular control preconception and during pregnancy. Comprehensive Physiology, 11, 1871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Graham CH, Hawley TS, Hawley RC, Macdougall JR, Kerbel RS, Khoo N & Lala PK 1993. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Experimental cell research, 206, 204–211. [DOI] [PubMed] [Google Scholar]
  22. Guindolet D & Gabison EE 2020. Role of CD147 (EMMPRIN/Basigin) in tissue remodeling. The Anatomical Record, 303, 1584–1589. [DOI] [PubMed] [Google Scholar]
  23. Harris L 2010. Trophoblast-vascular cell interactions in early pregnancy: how to remodel a vessel. Placenta, 31, S93–S98. [DOI] [PubMed] [Google Scholar]
  24. Huppertz B 2008. The anatomy of the normal placenta. Journal of clinical pathology, 61, 1296–1302. [DOI] [PubMed] [Google Scholar]
  25. Igakura T, Kadomatsu K, Kaname T, Muramatsu H, Fan Q-W, Miyauchi T, Toyama Y, Kuno N, Yuasa S & Takahashi M 1998. A null mutation in basigin, an immunoglobulin superfamily member, indicates its important roles in peri-implantation development and spermatogenesis. Developmental biology, 194, 152–165. [DOI] [PubMed] [Google Scholar]
  26. Jovanović M & Vićovac L 2009. Interleukin-6 stimulates cell migration, invasion and integrin expression in HTR-8/SVneo cell line. Placenta, 30, 320–328. [DOI] [PubMed] [Google Scholar]
  27. Karmakar S & Das C 2002. Regulation of trophoblast invasion by IL‐1β and TGF‐β1. American Journal of Reproductive Immunology, 48, 210–219. [DOI] [PubMed] [Google Scholar]
  28. Koltai T & Fliegel L 2024. Exploring monocarboxylate transporter inhibition for cancer treatment. Exploration of Targeted Anti-tumor Therapy, 5, 135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kuno N, Kadomatsu K, Fan Q-W, Hagihara M, Senda T, Mizutani S & Muramatsu T 1998. Female sterility in mice lacking the basigin gene, which encodes a transmembrane glycoprotein belonging to the immunoglobulin superfamily. FEBS letters, 425, 191–194. [DOI] [PubMed] [Google Scholar]
  30. Lee C-L, Lam MP, Lam KK, Leung CO, Pang RT, Chu IK, Wan TH, Chai J, Yeung WS & Chiu PC 2013. Identification of CD147 (basigin) as a mediator of trophoblast functions. Human reproduction, 28, 2920–2929. [DOI] [PubMed] [Google Scholar]
  31. Li K, Li Q, Bashir ST, Bany BM & Nowak RA 2021. Loss of basigin expression in uterine cells leads to subfertility in female mice. Biology of reproduction, 105, 859–875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li K & Nowak RA 2020. The role of basigin in reproduction. Reproduction, 159, R97–R109. [DOI] [PubMed] [Google Scholar]
  33. Li W, Alfaidy N & Challis JR 2004. Expression of extracellular matrix metalloproteinase inducer in human placenta and fetal membranes at term labor. The Journal of Clinical Endocrinology & Metabolism, 89, 2897–2904. [DOI] [PubMed] [Google Scholar]
  34. Liao C-G, Kong L-M, Song F, Xing J-L, Wang L-X, Sun Z-J, Tang H, Yao H, Zhang Y & Wang L 2011. Characterization of basigin isoforms and the inhibitory function of basigin-3 in human hepatocellular carcinoma proliferation and invasion. Molecular and cellular biology, 31, 2591–2604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lyall F, Robson SC & Bulmer JN 2013. Spiral artery remodeling and trophoblast invasion in preeclampsia and fetal growth restriction: relationship to clinical outcome. Hypertension, 62, 1046–1054. [DOI] [PubMed] [Google Scholar]
  36. Mercnik MH, Schliefsteiner C, Fluhr H & Wadsack C 2023. Placental macrophages present distinct polarization pattern and effector functions depending on clinical onset of preeclampsia. Frontiers in immunology, 13, 1095879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Miyauchi T, Kanekura T, Yamaoka A, Ozawa M, Miyazawa S & Muramatasu T 1990. Basigin, a new, broadly distributed member of the immunoglobulin superfamily, has strong homology with both the immunoglobulin V domain and the β-chain of major histocompatibility complex class II antigen. The Journal of Biochemistry, 107, 316–323. [DOI] [PubMed] [Google Scholar]
  38. Moser G, Windsperger K, Pollheimer J, De Sousa Lopes SC & Huppertz B 2018. Human trophoblast invasion: new and unexpected routes and functions. Histochemistry and cell biology, 150, 361–370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Muramatsu T 2016. Basigin (CD147), a multifunctional transmembrane glycoprotein with various binding partners. The journal of biochemistry, 159, 481–490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Nabeel MA & Nowak RA 2025. Extracellular Vesicles in Implantation: Cross-Talk Between the Embryo and Endometrium. Springer. [DOI] [PubMed] [Google Scholar]
  41. Nissinen L & Kähäri V-M 2014. Matrix metalloproteinases in inflammation. Biochimica et Biophysica Acta (BBA)-General Subjects, 1840, 2571–2580. [DOI] [PubMed] [Google Scholar]
  42. Ortega MA, Fraile-Martínez O, García-Montero C, Sáez MA, Álvarez-Mon MA, Torres-Carranza D, Álvarez-Mon M, Bujan J, García-Honduvilla N & Bravo C 2022. The pivotal role of the placenta in normal and pathological pregnancies: a focus on preeclampsia, fetal growth restriction, and maternal chronic venous disease. Cells, 11, 568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Patel J, Landers K, Mortimer R & Richard K 2010. Regulation of hypoxia inducible factors (HIF) in hypoxia and normoxia during placental development. Placenta, 31, 951–957. [DOI] [PubMed] [Google Scholar]
  44. Paul N, Sultana Z, Fisher JJ, Maiti K & Smith R 2023. Extracellular vesicles-crucial players in human pregnancy. Placenta. [DOI] [PubMed] [Google Scholar]
  45. Peterson E 2017. Basigin-2 Mediated Activation of ERK1/2 Signaling in Human Glioblastoma Multiforme Cells. Northern Michigan University. [Google Scholar]
  46. Pijnenborg R 1990. Trophoblast invasion and placentation in the human: morphological aspects. Trophoblast invasion and endometrial receptivity: novel aspects of the cell biology of embryo implantation. Springer. [Google Scholar]
  47. Prutsch N, Fock V, Haslinger P, Haider S, Fiala C, Pollheimer J & Knöfler M 2012. The role of interleukin-1β in human trophoblast motility. Placenta, 33, 696–703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Raposo G & Stoorvogel W 2013. Extracellular vesicles: exosomes, microvesicles, and friends. Journal of Cell Biology, 200, 373–383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Rosser ML & Katz NT 2013. Preeclampsia: an obstetrician’s perspective. Advances in chronic kidney disease, 20, 287–296. [DOI] [PubMed] [Google Scholar]
  50. Salomon C, Guanzon D, Scholz-Romero K, Longo S, Correa P, Illanes SE & Rice GE 2017. Placental exosomes as early biomarker of preeclampsia: potential role of exosomal microRNAs across gestation. The Journal of Clinical Endocrinology & Metabolism, 102, 3182–3194. [DOI] [PubMed] [Google Scholar]
  51. Salomon C, Kobayashi M, Ashman K, Sobrevia L, Mitchell MD & Rice GE 2013. Hypoxia-induced changes in the bioactivity of cytotrophoblast-derived exosomes. PloS one, 8, e79636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sidhu SS, Mengistab AT, Tauscher AN, Lavail J & Basbaum C 2004. The microvesicle as a vehicle for EMMPRIN in tumor–stromal interactions. Oncogene, 23, 956–963. [DOI] [PubMed] [Google Scholar]
  53. Solstad AD, Brown JM & Ochrietor JD 2023. The retina-specific basigin isoform does not induce IL-6 expression in mouse monocytes. Molecular Vision, 29, 13. [PMC free article] [PubMed] [Google Scholar]
  54. Sugimoto A, Okuno T, Miki Y, Tsujio G, Sera T, Yamamoto Y, Kushiyama S, Nishimura S, Kuroda K & Togano S 2021. EMMPRIN in extracellular vesicles from peritoneal mesothelial cells stimulates the invasion activity of diffuse-type gastric cancer cells. Cancer Letters, 521, 169–177. [DOI] [PubMed] [Google Scholar]
  55. Taylor PM, Woodfield RJ, Hodgkin MN, Pettitt TR, Martin A, Kerr DJ & Wakelam MJ 2002. Breast cancer cell-derived EMMPRIN stimulates fibroblast MMP2 release through a phospholipase A2 and 5-lipoxygenase catalyzed pathway. Oncogene, 21, 5765–5772. [DOI] [PubMed] [Google Scholar]
  56. Van Niel G, Carter DR, Clayton A, Lambert DW, Raposo G & Vader P 2022. Challenges and directions in studying cell–cell communication by extracellular vesicles. Nature Reviews Molecular Cell Biology, 23, 369–382. [DOI] [PubMed] [Google Scholar]
  57. Watanabe T, Maeda K, Kato N, Seko H, Sugimura M, Sato Y, Ryuge A, Kato S, Kadomatsu K & Maruyama S 2023. Basigin is released in extracellular vesicles derived from the renal tubular epithelium in response to albuminuria. Nephrology, 28, 629–638. [DOI] [PubMed] [Google Scholar]
  58. Welsh JA, Goberdhan DC, O’driscoll L, Buzas EI, Blenkiron C, Bussolati B, Cai H, Di Vizio D, Driedonks TA & Erdbrügger U 2024. Minimal information for studies of extracellular vesicles (MISEV2023): From basic to advanced approaches. Journal of extracellular vesicles, 13, e12404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Xiong W & Deng Y 2024. BSG Isoform 2 (ENST00000353555) Is a Prognostic Biomarker in Predicting Unfavorable Overall Survival of Patients With Liver Hepatocellular Carcinoma. Cureus, 16. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS2110860-supplement-01.docx (1.2MB, docx)

Data Availability Statement

All data is available upon request.

RESOURCES