Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Jun 18;57(4-5):289–302. doi: 10.1007/s10863-025-10064-z

TKT regulates the pentose phosphate pathway via RBKS to promote epithelial-mesenchymal transition during AML progression

Feifan Li 1,#, Jiaqi Liu 2,#, Yinghua Geng 3, Lin Liu 3, Jun Li 3, Lianfang Pu 3, Zhongli Hu 3, Yanli Yang 3,✉
PMCID: PMC12464144  PMID: 40531362

Abstract

Acute myeloid leukemia is a life-threaten disease. Researches have indicated that increased expression of TKT was closely related to the progression of malignant tumors. However, the mechanism of TKT in the pathogenesis of AML need to be further elucidated. Here, we showed that the expression levels of TKT was increased in AML patients and AML cells. TKT overexpression in AML cells significantly promoted the proliferation, migration and invasion of cells while TKT knockdown had opposite effects. Mechanistically. We proved that TKT was located on up-stream of RBKS and TKT promoted the growth of AML cells through RBKS. In addition, our data indicated that TKT regulates the pentose phosphate pathway via RBKS. Notably, we demonstrated that the pentose phosphate pathway is crucial for EMT program in AML cells. Taken together, this study identified the molecular mechanism by which TKT promotes AML progression, namely, TKT promotes EMT by regulating the pentose phosphate pathway through RBKS. Our results suggest that TKT maybe a novel therapeutic target for AML treatment.

Keywords: TKT, RBKS, PPP, EMT, AML

Introduction

Acute myeloid leukemia (AML) is a malignant tumor caused by abnormally proliferating of bone marrow stem cells, often accompanied by poor prognosis. With the advancement of chemotherapy and hematopoietic stem cell transplantation, the survival rate of AML patients has significantly improved(Döhner et al. 2015; Papaemmanuil et al. 2016; Röllig et al. 2011). However, there are still clinical issues of high mortality and recurrences rates. Therefore, it is urgent to further explore the pathogenesis of AML.

Ribokinase (RBKS) is a member of the ribokinase family, also known as the pfkB family(Park and Gupta 2008). As RBKS was highly conserved from prokaryotes to human, so the structure of RBKS was well understood(Riggs et al. 2016; Park et al. 2007; Hope et al. 1986). RBKS, as a key kinase in ribose metabolism, can promote the phosphorylation of ribose and generate ribose 5-phosphate (R5P). Then, the R5P is used for nucleotide synthesis to promote cell growth(Quiroga-Roger et al. 2015). Recent studies shown that there is a relationship between elevated RBKS expression and leukemia progression(Chen et al. 2015). However, the mechanism of RBKS involved in AML progression remains unclear.

Epithelial mesenchymal transition (EMT) has attracted more attention due to its crucial role in tumor metastasis. The occurrence of EMT in tumor cells can lead to a decrease in cell adhesion, making the cells to detach from the primary site and transition to another site(Jiang et al. 2022; Du and Shim 2016). The EMT process involves a large number of transcription factors, including Snail, Vimentin, N-cadherin, E-cadherin, etc(Wang et al. 2013; Satelli and Li 2011; Na et al. 2020; Wu and Zhou 2010). An increasing number of studies indicate that EMT is involved in the progression of AML(Yang et al. 2019; Lu et al. 2023; Tian et al. 2021). Thus, targeting EMT is emerging as a hot spot for treating AML. In our study, we aimed to explore the new regulators that can regulates the EMT in AML cells.

Tumor cells are metabolic disease, and in 2011, Hanahan and Weinberg refined the characteristics of tumor cells to ten points(Hanahan et al. 2011). As an important pathway in tumor metabolism, the pentose phosphate pathway (PPP) is an important component of glucose metabolism and has two branches. In the oxidative branch, the glucose 6-phosphate (G6P) will convert into ribulose 5-phosphate (Ru5P) and NADPH; in the non-oxidative branch, fructose 6-phosphate (F6P) and glyceraldehyde 3-phosphate (G3P) are generated through a series of carbon conversion, and then enter the glycolysis pathway(TeSlaa et al. 2023; Kim et al. 2012). Transketolase (TKT) is a critical enzyme in the non-oxidative branch and there are many studies indicated that TKT was activated in tumor cells(Hao et al. 2022). Researches in cervical cancer and gastric cancer have shown that the expression level of TKT was significantly elevated, maintaining a high proliferation state by enhancing the glycolysis of tumor cells to provide energy for cellular(Ahopelto et al. 2020; Zhu et al. 2021). In AML cells, hypoxia activates the non-oxidative branch of the pentose phosphate pathway, leading to resistance to chemotherapy. Therefore, the loss of TKT can impair the hypoxia-induced growth of AML cells(Baptista et al. 2022). Thus, TKT was considered as a tumor biomarker and potential target for cancer treatment. In our study, we aimed to explore the molecular mechanism of TKT involved AML progression.

Results

The expression of RBKS was increased in AML development

To elucidate the role of RBKS in AML pathogenesis. We analyzed RBKS mRNA levels using GEPIA database and found that RBKS was up-regulated in AML patients (Fig. 1A). Furthermore, AML patients with high levels of RBKS have a shorter survival time (Fig. 1B). Then, we examined the RBKS mRNA and protein levels in bone marrow obtained from normal and AML patients. The results of RT-PCR and western blot indicated that RBKS was up-regulated in AML patients when compared to normal population (Figs. 1C-D). Finally, we collected several AML cell lines (HL60, THP-1, KG-1, KY821 and U937) and human CD34 + cell line served as control group. The results showed that the expression levels of RBKS mRNA and protein were higher in AML cells than that in CD34 + cell (Figs. 1E-F). Among these AML cell lines, the RBKS increase in KG-1 cell line is the most significant, therefore, we chose this cell line for further research. Taken together, these data implied an important role of RBKS in AML and indicated a prospective application of using RBKS as s potential biomarker of AML diagnosis.

Fig. 1.

Fig. 1

Open in a new tab

The expression level of RBKS in AML patients and AML cell lines. A: Using the GEPIA database to predict the expression level of RBKS mRNA in AML patients. B: Using the Starbase to predict the survival curve in AML patients with high levels of RBKS. C: RT-PCR detected the expression of RBKS in the bone marrow. D: Western blot detected the expression of RBKS in the bone marrow. E: RT-PCR detected the expression of RBKS in different AML cell lines. F: Western blot detected the expression of RBKS in different AML cell lines. ns: no significance, *P < 0.05, **P < 0.01, ***P < 0.001

RBKS promotes the growth of AML cells in vitro

We next to explore the function of RBKS in AML cells. We knocked down RBKS by shRNA or overexpressed RBKS in KG-1 cells. The knockdown efficiency of RBKS was confirmed at the mRNA and protein levels. We found that RBKS knockdown obviously decreased the mRNA and protein level of RBKS (Figs. 2A-B). At same time, we also observed an increased expression level of RBKS protein after transfecting with OE-RBKS (Fig. 2B). Since the inhibitory effect of sh-RBKS-1 was more obvious, so, we selected sh-RBKS-1 for the next experiments. In summary, these results indicated that we successfully constructed the stable transformation cell line.

Fig. 2.

Fig. 2

Open in a new tab

RBKS promotes the growth of AML cells. A: Using RT-PCR to detect the expression of RBKS in AML cells after transfection of sh-RBKS. B: Using western blot to detect the expression of RBKS in AML cells after RBKS overexpression or knockdown. C: CCK-8 detected the cell viability after RBKS overexpression or knockdown. D: Flow cytometry detected the apoptosis after RBKS overexpression or knockdown. E: Using transwell to detect the cell migration after RBKS overexpression or knockdown. F: Using transwell to detect the cell invasion after RBKS overexpression or knockdown. G: Using EDU to detect the cell proliferation after RBKS overexpression or knockdown. Scale bar: 100 μm (E and F); 50 μm (G). *P < 0.05, **P < 0.01, ***P < 0.001

We used CCK-8 assay to detect the cell viability and found that cell viability was significantly increased after overexpressing RBKS, while the loss of RBKS inhibited cell viability (Fig. 2C). Secondly, we used flow cytometry to detect cell apoptosis. The results showed that overexpression of RBKS inhibited cell apoptosis, while RBKS downregulation promoted it (Fig. 2D). Thirdly, we used the Transwell experiment to detect cell migration and cell invasion, respectively. We observed that the up-regulation of RBKS promoted cell migration and invasion, whereas the down-regulation of RBKS suppressed it (Figs. 2E-F). Finally, we used EDU to detect cell proliferation and found that RBKS overexpression promoted cell proliferation, whereas the loss of RBKS inhibited it (Fig. 2G). Collectively, these findings suggested that RBKS promotes the growth of AML cells in vitro.

RBKS promotes the growth of tumor tissue in vivo

Next, we further to explore whether RBKS plays a similar role in vivo. We injected the stable transformed cell lines with RBKS overexpression or knockdown to the NOD/SCID nude mice, and observed the growth of tumor tissue on the 7th, 14th, 21th, and 28th days after injection (Fig. 3A). We observed that the overexpression of RBKS significantly increased tumor weight and volume, whereas RBKS knockdown had opposite effects (Fig. 3B). In addition, the expression level of RBKS was significantly increased after overexpressing RBKS, however, knocking down RBKS decreased RBKS expression (Fig. 3C). Meanwhile, we used TUNEL and Ki67 to detect the apoptosis and proliferation levels of tumor cells, respectively. The results showed that RBKS overexpression obviously promoted cell proliferation whereas inhibited cell apoptosis (Figs. 3D-E). However, the deficiency of RBKS had opposite results (Figs. 3D-E). In summary, these data are consistent with the results of in vitro experiments and demonstrated that RBKS promotes the growth of AML cells both in vitro and in vivo.

Fig. 3.

Fig. 3

Open in a new tab

RBKS was involved in the growth of tumor cells in vivo. A: Schematic diagram of tumor formation in nude mice. B: The statistical analysis of tumor volume and weight. C: Western blot detected the expression of RBKS in different tumor tissues. D: Using IHC to detect the apoptosis of tumor cells. E: Ki67 detected the proliferation of tumor cells. Scale bar: 50 μm (D and E). *P < 0.05, **P < 0.01, ***P < 0.001

TKT interacts with RBKS and is up-regulated in AML cells

We further investigated the molecular mechanism of RBKS in AML. We used the STRING website to screen for proteins that interact with RBKS. Among these proteins, we focused on transketolase (TKT), as recent studies have revealed its involvement in AML progression (Fig. 4A). Next, we used Co-IP to detect whether TKT binds to RBKS and observed that TKT associates with RBKS in AML cells (Fig. 4B). Therefore, TKT binds to RBKS in AML cells.

Fig. 4.

Fig. 4

Open in a new tab

The expression level of TKT in AML patients and cell lines. A: Using STRING database to predict the interaction proteins with RBKS. B: Co-IP was used to detect the interaction between RBKS and TKT. C: RT-PCR detected the expression of TKT in the bone marrow. D: Western blot detected the expression of TKT in the bone marrow. E: RT-PCR detected the expression of TKT in different AML cell lines. F: Western blot detected the expression of TKT in different AML cell lines. ns: no significance, *P < 0.05, **P < 0.01, ***P < 0.001

We next to detect the expression level of TKT in AML patients and AML cells, respectively. The RT-PCR and western blot results indicated that the expression level of TKT mRNA and protein was significantly increased in AML patients when compared to normal population (Figs. 4C-D). Meanwhile, the increased TKT mRNA and protein expression were also observed in different AML cell lines (Figs. 4E-F). In conclusion, these data indicated that TKT interacts with RBKS and is involved in the progression of AML.

TKT promotes the growth of AML cells in vitro

We next to explore the role of TKT in AML cells. We first constructed AML cells with up-regulation or down-regulation of TKT. The results of RT-PCR shown that sh-TKT-3 had the highest knockdown efficiency of TKT mRNA (Fig. 5A). Thus, we choose sh-TKT-3 for next research. At same time, we also observed that the expression level of TKT protein was increased after overexpressing TKT, whereas knockdown of TKT had opposite results (Fig. 5B). More importantly, we discovered that TKT affects the expression of RBKS, as TKT overexpression enhanced RBKS expression, while the loss of TKT suppressed it (Fig. 5B). In summary, we concluded that TKT was located on the up-stream of RBKS and promoted the expression of RBKS.

Fig. 5.

Fig. 5

Open in a new tab

TKT promotes the growth of AML cells through RBKS. A: Using RT-PCR to detect the expression of TKT in AML cells after transfection of sh-TKT. B: Using western blot to detect the expression level of TKT and RBKS after cell transfection. C: CCK-8 detected the cell viability after cell transfection. D: Flow cytometry detected the cell apoptosis after cell transfection. E: Transwell detected the cell migration after cell transfection. F: Transwell detected the cell invasion after cell transfection. G: EDU detected the cell proliferation after cell transfection. Scale bar: 100 μm (E and F), 50 μm (G). ns: no significance, *P < 0.05, **P < 0.01, ***P < 0.001

Next, we continued to detect the function of TKT in AML cells. We used CCK-8 assay to detect the cell viability and found that the cell viability was increased after TKT overexpression, while the loss of TKT inhibited cell viability (Fig. 5C). Secondly, we used flow cytometry to assess cell apoptosis. The results showed that TKT overexpression inhibited cell apoptosis, whereas TKT knockdown promoted it (Figs. 5D). Thirdly, we used the Transwell experiment to detect cell migration and cell invasion, respectively. We observed that the up-regulation of TKT promoted cell migration and invasion, however, the down-regulation of TKT suppressed it (Figs. 5E-F). Finally, we used EDU to detect cell proliferation and found that TKT overexpression promoted cell proliferation, whereas TKT deficiency inhibited it (Figs. 5G. Taken together, these findings proved that TKT promotes the growth of AML cells.

Since RBKS is a down-stream factor of TKT, so, we next sought to determine whether the loss of RBKS can rescue the phenotype induced by TKT overexpression. Interestingly, the absence of RBKS successfully rescued all the effects caused by TKT overexpression (Figs. 5C-G). In conclusion, these data suggested that TKT promotes the growth of AML cells in a RBKS-dependent manner.

The Pentose phosphate pathway promotes the growth of AML cells

As TKT is a critical enzyme involved in PPP, therefore, we next to examine whether PPP-related indicators were changed, such as ATP, NADP+/NADPH, R5P (ribose 5-phosphate), G3P (glyceraldehyde-3-phosphate), GLU (glucose) and α-KG (α-ketoglutaric acid) after TKT overexpression or knockdown. We found that the content of ATP was increased, whereas the content of NADP+/NADPH, R5P, G3P, GLU and α-KG were decreased after overexpressing TKT (Figs. 6A-F). However, knocking down TKT had opposite results (Figs. 6A-F). At same time, the deficiency of RBKS successfully restored the phenotype caused by TKT overexpression (Figs. 6A-F). Therefore, these data indicated that we can activate or inhibit the pentose phosphate pathway by regulating the expression of TKT.

Fig. 6.

Fig. 6

Open in a new tab

TKT regulates the pentose phosphate pathway through RBKS. A: The content of ATP in cells after cell transfection. B: The ratio of NADP+/NADPH in cells after cell transfection. C: The content of R5P in cells after cell transfection. D: The content of G3P in cells after cell transfection. E: The content of GLU in cells after cell transfection. F: The content of α-KG in cells after cell transfection. G: Western blot detected the expression level of TKT and RBKS after cell transfection with sh-TKT and addition of R5P. H: CCK-8 detected the cell viability after cell transfection with sh-TKT and addition of R5P. I: Flow cytometry detected the cell apoptosis after cell transfection with sh-TKT and addition of R5P. J: Transwell detected the cell migration after cell transfection with sh-TKT and addition of R5P. K: Transwell detected the cell invasion after cell transfection with sh-TKT and addition of R5P. L: EDU detected the cell proliferation after cell transfection with sh-TKT and addition of R5P. M: The content of ATP in cells after cell transfection with sh-TKT and addition of R5P. N: The ration of NADP+/NADPH in cells after after cell transfection with sh-TKT and addition of R5P. O: The content of R5P in cells after cell transfection with sh-TKT and addition of R5P. P: The content of G3P in cells after cell transfection with sh-TKT and addition of R5P. Q: The content of GLU in cells after cell transfection with sh-TKT and addition of R5P. R: The content of α-KG in cells after cell transfection with sh-TKT and addition of R5P. Scale bar: 100 μm (J and K), 50 μm (L). *P < 0.05, **P < 0.01, ***P < 0.001

We next continued to explore whether the pentose phosphate pathway is important for AML cell growth. We knocked down TKT to inhibit PPP or simultaneously added R5P to activate PPP. We found that the loss of TKT decreased the RBKS expression which is consistent with above results (Fig. 6G). At same time, TKT expression was not affected by adding R5P, whereas the expression of RBKS was obviously increased (Fig. 6G). In addition, we found that the addition of R5P successfully restored the phenotype caused by TKT loss, including enhanced cell viability (Fig. 6H), inhibition of cell apoptosis (Fig. 6I), promotion of cell migration and invasion (Figs. 6J-K), increased cell proliferation (Fig. 6L). More importantly, the related indicators of PPP were also rescued, including ATP levels (Fig. 6M), NADP+/NDAPH ratios (Fig. 6N), R5P levels (Fig. 6O), G3P levels (Fig. 6P), GLU levels (Fig. 6Q), α-KG levels (Fig. 6R). In summary, these data highlight the critical role of the pentose phosphate pathway in the growth of AML cells.

TKT promotes EMT program in AML cells

As epithelial mesenchymal transition (EMT) plays an increasing role in AML progression. During EMT, AML cells loss the epithelial phenotype and transform to mesenchymal properties. E-cadherin was decreased while Snail and Vimentin were increased during EMT, and then cells lose their adhesiveness and subsequently migrate to a new location. Interestingly, we found that the expression of Snail and Vimentin were elevated, while E-cadherin was decreased after RBKS overexpression (Fig. 7A). However, the loss of RBKS had opposite effects (Fig. 7A). Next, we used the tumor tissue to detect the expression of Vimentin. We observed that Vimentin expression was also increased after overexpressing RBKS, whereas the loss of RBKS had opposite results (Fig. 7B). We concluded that RBKS promotes EMT in AML both in vitro and in vivo.

Fig. 7.

Fig. 7

Open in a new tab

TKT promotes the EMT in AML cells through RBKS. A: Western blot detected the expression level of EMT-related proteins after cell transfection. B: IHC was used to measure the expression level of Vimentin in tumor cells. C: Western blot detected the expression level of EMT-related proteins after cell transfection. D: Western blot detected the expression level of EMT-related proteins after cell transfection with sh-TKT and addition of R5P. Scale bar: 50 μm (B). *P < 0.05, **P < 0.01, ***P < 0.001

We next further to explore whether TKT and PPP were involved in EMT. We found that TKT overexpression promoted the EMT process, indicated by elevated Snail and Vimentin expression and decreased E-cadherin expression (Fig. 7C). However, the loss of TKT inhibited EMT (Fig. 7C). Importantly, the loss of RBKS successfully suppressed the EMT that caused by TKT overexpression (Fig. 7C). Consistently, the addition of R5P also obviously enhanced EMT that induced by TKT deficiency (Fig. 7D). Taken together, our study revealed that the pentose phosphate pathway is implicated in the EMT of AML cells.

Discussion

Tumor cells typically exhibit metabolic reprogramming, such as enhanced glycolysis (Warburg effect) and increased PPP activity(Hanahan et al. 2011; Hart et al. 2016). Previous studies have shown that the enhanced expression of TKT has been implicated in various cancer, such as hepatocellular carcinoma, ovarian cancer, and esophageal cancer(Costa et al. 2018; Saman et al. 2019; Zheng and Li 2018). Previous study proved that TKT was involved in the proliferation, migration, invasion of gastric cancer cells(Hu et al. 2023). In colorectal cancer, TKT expression was remarkably upregulated and promoted the cancer cell growth and metastasis(Li et al. 2022). A previous study showed that the deficiency of TKT suppressed the growth of ALL cells(Huang 2024). In our study, we found that the expression level of TKT was also significant increased both in AML patients and AML patients, which is consistent with previous study. Overexpression of TKT promoted cell viability, migration, invasion and proliferation, while inhibited cell apoptosis. The results indicated that the high expression of TKT was closely related to AML progression. In addition, we also found that RBKS was located in the down-stream of TKT. Overexpression of RBKS also promoted the growth of AML cells, whereas RBKS knockdown had opposite impacts. More importantly, the loss of RBKS restored the cell growth that caused by TKT overexpression. The results indicated that the high expression levels of TKT was closely related to the progression of AML cells.

The 5-phosphate ribose requires for tumor cells to maintain rapid proliferation is mainly provided by PPP, therefore, PPP activation is crucial for tumor growth(Patra and Hay 2014). A previous study showed that the PPP was up-regulation in Evi-overexpressing AML cells, thus targeting PPP is an effective pathway for inhibiting AML progression(Mizuno et al. 2021). In non-small cell lung cancer, inhibiting PPP through GDNPs significantly inhibited the growth of cells(Yang et al. 2022). Previous study proved that the enriched PI3Kγ in AML cells promoted AML progression by activating PPP(Gu et al. 2024). In our study, we revealed that TKT promotes the growth of AML cells by regulating PPP. At same time, RBKS knockdown successfully inhibited the activated PPP induced by overexpressing TKT. The results indicated that TKT as a crucial regulator of PPP and regulate it through RBKS.

Epithelial to mesenchymal transition (EMT) is defined as the process by which epithelial cells transition into mesenchymal cells, and it plays a crucial in tumor cell migration and invasion. During the progression of AML, many factors and signaling pathway have been reported to involved in EMT process(Guo et al. 2015; Li et al. 2019; Hopkins et al. 2017). In non-small cell lung cancer, inhibiting PPP through GDNPs significantly suppressed the EMT process(Yang et al. 2022). In our research we proved that PPP was involved in the EMT of AML cells. TKT and RBKS function as the regulators of PPP, overexpression of TKT or RBKS significantly increased the expression of Vimentin and Snail, while the loss of TKT or RBKS had opposite effects. These results demonstrated that PPP is crucial for the EMT program in AML cells.

Overall, our research revealed that TKT was involved in the pentose phosphate pathway by regulating RBKS and promoted the EMT of AML cells. However, whether targeting TKT to inhibit PPP can effectively suppress the progression of AML in clinical practice need further studies.

Materials and methods

Patients and specimens

Fifteen bone marrow samples were obtained from AML patients and healthy population in the First Affiliated Hospital of Bengbu Medical University, and these people are all agreed to contribute samples. The study was approved by the Ethics Committee of First Affiliated Hospital of Bengbu Medical University. The samples were stored at -80 °C for further experiment. According to the manufacturer’s instructions, using RT-PCR and western blot to detect the expression level of RBKS and TKT mRNA and protein, respectively. The primers used in this experiment were listed in Key resource table.

Cell culture and transfection

The human CD34+ cell line was obtained by sorting bone marrow samples of normal population and served as control group. The human AML cell lines HL60, U937, KG-1, KY821 and THP-1 were purchased from Wuhan Pricella biotechnology or ATCC. The HL60, U937 and THP-1 cell lines were cultured with RPMI1640 and 10% FBS and, while the KG-1 and KY821 cell lines were supplemented with IMDM and 20% FBS. All the AML cell lines were cultured at 37 °C with 5%CO2.

KG-1 cells were seeded in 6-well cell culture plates (1 × 105 cells/mL), and then cells were transfected with lentivirus sh-RBKS, sh-TKT, OE-RBKS, OE-TKT, OE-TKT + sh-RBKS and their corresponding controls according to the manufacturer’s instructions. Finally, using RT-PCR and western blot to detect the interference.

KG-1 cells were cultured in complete medium with R5P at 10µM.

Tumorigenicity assays in nude mice

The mice were feed in an SPF animal laboratory at 21–23 °C and humidity of 60-65% for 1 week, and then randomly divided into 5 groups (n = 5). The transfected KG-1 cell (106 cells) were injected into the left armpit of the NOD/SCID nude mice. Measure the tumor volume (cm3) and weight (g) at 7, 14, 21, and 28 days after injection. The animal study was approved by Animal Ethics Committee of the First Affiliated Hospital of Bengbu Medical University.

Immunohistochemistry (IHC)

IHC was performed to detect the expression level of Ki67 and Vimentin. After the tumor tissues were fixed with 4% PFA, embedded with resin and sliced at 4 microns for IHC. After dewaxing, hydration, permeabilization and antigen repair, tissue sections were incubated with primary antibody at 4 °C. Next incubated with second antibodies at room temperature for 20 min, and then incubate with hematoxylin for 1 min to detect antigens.

CCK-8 assay kit

The cell counting kit-8 (CCK-8) assay was performed to evaluate cell viability. The KG-1 cells were seeded into 96-well cell culture plates and transfected for 16 h, then replaced the complete medium and continue culturing for 32 h. The CCK-8 reagent (10 µL) was added into the prepared samples for 2 h according to the manufacturer’s instructions. Measure the OD value at 450 nm wave length and analyze the impact on cell viability.

Migration and invasion assay

The Transwell assay was used to detect both the migration and invasion of AML cells. Equal amounts of KG-1 cells (5 × 104 cells/mL for migration experiment; 1 × 105 cells/mL for invasion experiment) were placed in the upper chambers of the well that was uncoated or coated with Matrigel for migration and invasion assays, respectively. At same time, the lower chambers were filled with FBS. After 48 h, collected the cells that were penetrated into the lower chamber, and then fixed with paraformaldehyde, stained with crystal violet. Finally, using the invert microscope (Leica, DMi1) and Image J software to calculate the number of migration and invasion cells.

RT-PCR

RT-PCR was conducted to quantify the expression level of mRNA. Briefly, total RNA from AML cells was extracted using Trizol reagent according to the manufacturer. And then the total RNA was reverse transcribed into cDNA using reverse transcription kit. Then using qPCR reaction kit to detect the expression level of genes. The primers used in this experiment were listed in Key resource table.

Western blot

Western blot was used to detect the expression level of protein. The cell precipitates, tumor tissues or clinical sample was collected according to the experiment. Then using RIPA lysis to obtain total protein. Protein concentrations were determined using the BCA kit. The protein lysates were subjected to the prepared SDS-PAGE gel, then transferred the protein to the PVDF membrane according to the manufacturer’s instructions. The membranes were blocked in 5% BSA for 2 h, followed by incubation with primary antibodies for overnight at 4 °C. The second day, using the HRP-conjugated secondary antibodies to incubate the membrane at room temperature for 1 h. Finally, the expression of proteins was visualized by ECL and the results were quantified using Image J software. The corresponding primary and second antibodies used in this experiment were listed in Key resource table.

ELISA

ELISA was performed to detect the content of different factors in cells supernatant or precipitation. According to the experiment group, the KG-1 cells were seeded in 6-well cell culture plates (1 × 105 cells/mL). After collecting the cell supernatant or precipitate, then according to the manufacturer’s instructions to detect the content of factors. After the operation is completed, measure the OD value at 450 nm wave length and analyze the results.

EDU

EDU was used to detect the cell proliferation. According to the experiment group, the KG-1 cells were seeded in 24-well cell culture plates (4 × 105 cells/mL). The EDU reagent (10 µM) was added into the prepared samples for 2 h according to the manufacturer’s instructions. Finally, using the invert fluorescence microscope (Olympics, IX71) and Image J software to calculate EDU positive cells.

Cell apoptosis assay

Cell apoptosis was detected by flow cytometry or TUNEL. For flow cytometry: according to the experiment group, the KG-1 cells were seeded in 6-well cell culture plates (1 × 105 cells/mL). The Annexin V-FITC/PI reagent (15 µL) was added into the prepared samples for 15 min according to the manufacturer’s instructions. For TUNEL: The tumor tissues were sliced at 4 microns, then the TUNEL reagents were added into the prepared samples according to the manufacturer’s instructions.

Statistical analysis

All the data were analyzed by GraphPad Prism 9.3, and the double-tailed Student’s t test were used for all comparisons. All the values represent the mean values ± SD. ns: no significance. Statistical differences among data were analyzed using one-way analysis of variance followed by Tukey’s tests. *P < 0.05 was considered to be statistically significant.

Key resource table

Reagent or resource Source Identifier
Primary antibodies
Rabbit anti-actin Serivicebio GB11001
Rabbit anti-TKT Proteintech 11039-1-AP
Rabbit anti-RBKS Abcam ab228850
Rabbit anti-Ki67 Abcam ab15580
Rabbit anti-snail Bioss bs-1371R
Rabbit anti-E-Cadherin Proteintech 20874-1-AP
Mouse anti-Vimentin Proteintech 60330-1-Ig
Second antibodies
Goat anti-rabbit IgG-HRP Biosharp BL003A
Mouse anti-rabbit IgG-HRP Biosharp BL001A
Assay kits
CCK-8 kit Biosharp BS350A
EDU Beyotime C0071S
TUNEL Beyotime C1098
RT-PCR kit Kechuangda KCD-M1003
qPCR kit Kechuangda KCD-M1004
Annexin V-FITC/PI Kechuangda KCD-T1004
BCA kit Biosharp BL521A
NADP+/NADPH Kit Elabscience E-BC-K803-M
ATP kit NanjingJiancheng A095-1-1
GLU kit NanjingJiancheng A154-1-1
R5P kit Jianglaibio JL47754
G3P kit Jianglaibio JL19406
α-KG kit Jianglaibio JL-T0709
Oligonucleotides/primer
TKT-human-F TCCACACCATGCGCTACAAG
TKT-human-R CAAGTCGGAGCTGATCTTCCT
RBKS-human-F ATGGTCTGCCAGCTCGAAATA
RBKS-human-R GAGAGGGTGTAGAACTGGGGA
actin-human-F TGTGACGTGGACATCCGCAAAG
actin-human-R TGGAAGGTGGACAGCGAGGC
sh-RBKS-1 TCTTACTTCTCGTTTGCCAAA
sh-RBKS-2 TCCCACAGAGAAAGTCAAGGC
sh-RBKS-3 CATAGTGGCTGGAGCAAATTT
sh-TKT-1 GCCATCATCTATAACAACAAT
sh-TKT-2 GCTGAGCTGCTGAAGATGTTT
sh-TKT-3 GCTGAGCTGCTGAAGATGTTT
Cell lines/mice
CD34 + cell line N/A N/A
HL60 cell line Pricella Bioechnology CL-0110
U937 cell line Pricella Bioechnology CL-0239
THP-1 cell line ATCC TIB-202
KG-1 cell line ATCC CCL-246
NOD/SCID mice Huachuang Sino N/A
Open in a new tab

Author contributions

Feifan Li: Data curation, Writing-Original Draft. Jiaqi Liu: Writing-review & editing, analysis. Yinghua Geng: Data curation, Visualization. Lin Liu: Formal analysis. Jun Li: Methodology. Lianfang Pu: Analysis and Methodology. Zhongli Hu: Data curation. Yanli Yang: Supervision, Writing-review & editing, Funding acquisition, Project administration, Resources.

Funding

This study was supported by Clinical and Translational Research Project of Anhui Province (project No：202427b10020010).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethical approval

All animal experiments were approved by the Laboratory Animal Ethics Committee (2021080) of Bengbu Medical College.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Feifan Li and Jiaqi Liu contributed equally to this work.

References

  1. Ahopelto K et al (2020) Transketolase-like protein 1 and glucose transporter 1 in gastric cancer. Oncology 98(9):643–652 [DOI] [PubMed] [Google Scholar]
  2. Baptista I et al (2022) TKTL1 knockdown impairs Hypoxia-Induced Glucose-6-phosphate dehydrogenase and Glyceraldehyde-3-phosphate dehydrogenase overexpression. Int J Mol Sci 23(7):3574 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen Y et al (2015) Inhibition of Pentose phosphate pathway suppresses acute myelogenous leukemia. Tumor Biology 37(5):6027–6034 [DOI] [PubMed] [Google Scholar]
  4. da Costa IA et al (2018) Transketolase like 1 (TKTL1) expression alterations in prostate cancer tumorigenesis. Urologic oncology: seminars and original investigations. Elsevier [DOI] [PubMed]
  5. Döhner H, Weisdorf DJ, Bloomfield CD (2015) Acute Myeloid Leuk N Engl J Med 373(12):1136–1152 [DOI] [PubMed] [Google Scholar]
  6. Du B, Shim J (2016) Targeting Epithelial–Mesenchymal transition (EMT) to overcome drug resistance in Cancer. Molecules 21(7):965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gu H et al (2024) PI3Kγ maintains the self-renewal of acute myeloid leukemia stem cells by regulating the Pentose phosphate pathway. Blood 143(19):1965–1979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Guo J et al (2015) PRRX1 promotes epithelial–mesenchymal transition through the Wnt/β-catenin pathway in gastric cancer. Med Oncol 32:1–12 [DOI] [PubMed] [Google Scholar]
  9. Hanahan D, Robert A, Weinberg (2011) Hallmarks Cancer: Next Generation Cell 144(5):646–674 [DOI] [PubMed] [Google Scholar]
  10. Hao S et al (2022) The role of transketolase in human cancer progression and therapy, vol 154. Biomedicine & Pharmacotherapy, p 113607 [DOI] [PubMed]
  11. Hart PC et al (2016) Caveolin-1 regulates cancer cell metabolism via scavenging Nrf2 and suppressing MnSOD-driven Glycolysis. Oncotarget 7(1):308 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hope JN et al (1986) Ribokinase from Escherichia coli K12. Nucleotide sequence and overexpression of the RbsK gene and purification of ribokinase. J Biol Chem 261(17):7663–7668 [PubMed] [Google Scholar]
  13. Hopkins A, Coatham ML, Berry FB (2017) FOXC1 regulates FGFR1 isoform switching to promote invasion following TGFβ-Induced EMT. Mol Cancer Res 15(10):1341–1353 [DOI] [PubMed] [Google Scholar]
  14. Hu X et al (2023) FOXA1/MND1/TKT axis regulates gastric cancer progression and oxaliplatin sensitivity via PI3K/AKT signaling pathway. Cancer Cell Int, 23(1) [DOI] [PMC free article] [PubMed]
  15. Huang F-L (2024) Regulating TKT activity inhibits proliferation of human acute lymphoblastic leukemia cells. Am J Cancer Res 14(2):679–695 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jiang T et al (2022) Metformin and histone deacetylase inhibitor based anti-inflammatory nanoplatform for epithelial-mesenchymal transition suppression and metastatic tumor treatment. J Nanobiotechnol, 20(1) [DOI] [PMC free article] [PubMed]
  17. Kim Y et al (2012) Function of the Pentose phosphate pathway and its key enzyme, transketolase, in the regulation of the meiotic cell cycle in oocytes. Clin Experimental Reproductive Med 39(2):58 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Li Q et al (2019) RUNX1 promotes tumour metastasis by activating the Wnt/β-catenin signalling pathway and EMT in colorectal cancer. J Experimental Clin Cancer Res, 38(1) [DOI] [PMC free article] [PubMed]
  19. Li M et al (2022) Transketolase promotes colorectal cancer metastasis through regulating AKT phosphorylation, vol 13. Cell Death & Disease, 2 [DOI] [PMC free article] [PubMed]
  20. Lu J et al (2023) Acute myeloid leukemia (AML)-derived mesenchymal stem cells induce chemoresistance and epithelial–mesenchymal transition‐like program in AML through IL‐6/JAK2/STAT3 signaling. Cancer Sci 114(8):3287–3300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mizuno H et al (2021) Evi1 upregulates Fbp1 and supports progression of acute myeloid leukemia through Pentose phosphate pathway activation. Cancer Sci 112(10):4112–4126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Na T-Y et al (2020) The functional activity of E-cadherin controls tumor cell metastasis at multiple steps. Proc Natl Acad Sci 117(11):5931–5937 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Papaemmanuil E et al (2016) Genomic classification and prognosis in acute myeloid leukemia. N Engl J Med 374(23):2209–2221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Park J, Gupta RS (2008) Adenosine kinase and ribokinase – the RK family of proteins. Cell Mol Life Sci 65(18):2875–2896 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Park J et al (2007) Identification and characterization of human ribokinase and comparison of its properties with E. coli ribokinase and human adenosine kinase. FEBS Lett 581(17):3211–3216 [DOI] [PubMed] [Google Scholar]
  26. Patra KC, Hay N (2014) The Pentose phosphate pathway and cancer. Trends Biochem Sci 39(8):347–354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Quiroga-Roger D, Babul J, Guixé V (2015) Role of monovalent and divalent metal cations in human ribokinase catalysis and regulation. Biometals 28:401–413 [DOI] [PubMed] [Google Scholar]
  28. Riggs JW et al (2016) Identification of the plant ribokinase and discovery of a role for Arabidopsis ribokinase in nucleoside metabolism. J Biol Chem 291(43):22572–22582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Röllig C et al (2011) Long-term prognosis of acute myeloid leukemia according to the new genetic risk classification of the European LeukemiaNet recommendations: evaluation of the proposed reporting system. J Clin Oncol 29(20):2758–2765 [DOI] [PubMed] [Google Scholar]
  30. Saman S et al (2019) Biomarkers Apo10 and TKTL1: Epitope-detection in monocytes (EDIM) as a new diagnostic approach for cholangiocellular, pancreatic and colorectal carcinoma. Cancer Biomarkers 27(1):129–137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Satelli A, Li S (2011) Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci 68(18):3033–3046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. TeSlaa T et al (2023) The Pentose phosphate pathway in health and disease. Nat Metabolism 5(8):1275–1289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tian Y et al (2021) miR-149-3p suppressed epithelial–mesenchymal transition and tumor development in acute myeloid leukemia. Hematology 26(1):840–847 [DOI] [PubMed] [Google Scholar]
  34. Wang Y et al (2013) The role of snail in EMT and tumorigenesis. Curr Cancer Drug Targets 13(9):963–972 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wu Y, Zhou BP (2010) Snail: more than EMT. Cell Adhes Migr 4(2):199–203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yang L et al (2019) Up-regulation of EMT-related gene VCAN by NPM1 mutant-driven TGF-β/cPML signalling promotes leukemia cell invasion. J Cancer 10(26):6570–6583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yang L et al (2022) Ginseng-derived nanoparticles inhibit lung cancer cell epithelial mesenchymal transition by repressing Pentose phosphate pathway activity. Front Oncol, 12 [DOI] [PMC free article] [PubMed]
  38. Zheng X, Li H (2018) TKTL1 modulates the response of Paclitaxel-resistant human ovarian cancer cells to Paclitaxel. Biochem Biophys Res Commun 503(2):572–579 [DOI] [PubMed] [Google Scholar]
  39. Zhu Y, Qiu Y, Zhang X (2021) TKTL1 participated in malignant progression of cervical cancer cells via regulating AKT signal mediated PFKFB3 and thus regulating Glycolysis. Cancer Cell Int, 21(1) [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

No datasets were generated or analysed during the current study.

Articles from Journal of Bioenergetics and Biomembranes are provided here courtesy of Springer

RESOURCES