Skip to main content
NCBI home page
Food Science & Nutrition logoLink to Food Science & Nutrition
. 2025 Sep 26;13(10):e71005. doi: 10.1002/fsn3.71005

Siegesbeckia Glabrescens Extract Ameliorates Immobilization‐Induced Muscle Atrophy by Regulating the Akt/mTOR/FoxO3a Signaling Pathways in Mice

Sungmin Han 1, Jae‐Kwan Hwang 1, Mi‐Bo Kim 1,2,✉
PMCID: PMC12464453  PMID: 41019176

ABSTRACT

Siegesbeckia glabrescens, traditionally used for its anti‐inflammatory properties and potential musculoskeletal benefits. In the present study, we investigated whether a standardized hot water extract of S. glabrescens (SGE), rich in the bioactive compound kirenol, could mitigate muscle atrophy caused by immobilization in a mouse model. Male C57BL/6J mice underwent hindlimb immobilization for 1 week to induce muscle atrophy, followed by 1 week of daily oral treatments with either saline or SGE (150 or 300 mg/kg/day). SGE significantly prevented the decline in muscle mass (5.1%–22.7%, p < 0.05), strength (26.0%–36.6%, p < 0.05), volume, and muscle fiber cross‐sectional area (21.6%–29.8%, p < 0.05) caused by immobilization. In the tibialis anterior muscle, SGE mitigated immobilization‐induced elevations in protein degradation markers, including muscle RING‐finger protein‐1 and muscle atrophy F‐box, by inhibiting the nuclear translocation of forkhead box O3a. Also, SGE countered reductions in protein synthesis indicators, including mammalian target of rapamycin, 70‐kDa ribosomal protein S6 kinase, and 4E binding protein 1, through activation of the phosphatidylinositol 3‐kinase/Akt pathway. Furthermore, kirenol attenuated tumor necrosis factor‐alpha‐driven muscle atrophy in L6 myotubes by modulating both protein synthesis and degradation processes. Collectively, these findings suggest that SGE containing kirenol maintains the equilibrium between protein degradation and protein synthesis, thereby ameliorating immobilization‐induced muscle atrophy.

Keywords: Akt/mTOR/FoxO3a signaling pathway, immobilization, muscle atrophy, Siegesbeckia glabrescens hot water extract

Siegesbeckia glabrescens extract enriched with kirenol alleviates skeletal muscle atrophy by enhancing protein synthesis and decreasing protein degradation via the Akt/mTOR/FoxO3a signaling pathway.

graphic file with name FSN3-13-e71005-g005.jpg

1. Introduction

Skeletal muscle atrophy, marked by a gradual loss of muscle mass and strength, can develop in a range of immobilizing situations such as spinal cord injury, extended bed rest, microgravity exposure, and prolonged intensive care (Ji and Yeo 2019; Zarzhevsky et al. 2001). This condition is marked by reductions in both the size and number of muscle fibers, along with an imbalance between protein synthesis and degradation, which can result in reduced physical capabilities and a diminished quality of life (Barreiro 2018). In the pathogenesis of immobilization, chronic inflammation and oxidative stress play pivotal roles that disturb the equilibrium between protein synthesis and breakdown (Phillips and McGlory 2014; Powers et al. 2011). High levels of reactive oxygen species (ROS) generation and inflammatory cytokines impede protein synthesis by suppressing the mammalian target of rapamycin (mTOR) pathway, while simultaneously accelerating protein breakdown via the ubiquitin‐proteasome system (Phillips and McGlory 2014; Powers et al. 2011). Therefore, it is essential to identify natural bioactive ingredients that possess antioxidant and anti‐inflammatory properties, as they could be valuable resources for mitigating skeletal muscle mass and functional losses associated with muscle atrophy.

Siegesbeckia Herba, a traditional herbal medicine, officially refers to the edible aerial parts of three herbs: Siegesbeckia orientalis L., Siegesbeckia glabrescens Makino, and Siegesbeckia pubescens Makino. These plants are widely distributed across various regions, including China, Republic of Korea, Japan, and Vietnam (Tao et al. 2021). Siegesbeckia Herba, commonly referred to as “Xi‐Xian Cao” has been acknowledged as a significant traditional Chinese medicine since the Tang dynasty (Pradhan et al. 2018). Traditionally, this medicinal herb has been used to manage various inflammatory conditions, including musculoskeletal weakness, quadriplegia, hemiplegia, lower back and knee pain, rubella wet sores, and rheumatism (Wang et al. 2021). Also, studies have demonstrated that Siegesbeckia Herba has anti‐inflammatory (Linghu et al. 2020), antioxidant (Shim et al. 2021), antiadipogenic (Kim, Kim, and Hwang 2020), antibacterial (Yang et al. 2016), antiphotoaging (Kim et al. 2017), and antithrombotic properties (Lv et al. 2023). Furthermore, kirenol, a main active diterpenoid component in Siegesbeckia Herba, possesses anti‐inflammatory (Nasir et al. 2022), antiadipogenic (Kim, Song, Hwang, et al. 2014), antiarthritic (Lu et al. 2012), and osteoblast differentiation‐enhancing properties (Kim, Song, Kim, et al. 2014). In our previous research, an S. orientalis extract standardized to its kirenol content was shown to enhance exercise endurance by stimulating mitochondrial biogenesis in the skeletal muscles of obese mice and L6 myotubes, which suggests that it has a beneficial effect on exercise capacity by promoting mitochondrial biogenesis in skeletal muscle (Kim et al. 2019). In particular, S. glabrescens was known to possess a distinct chemical profile, notably exhibiting higher levels of flavonoids and phenolic acids compared to S. orientalis (Gao et al. 2018). Also, S. glabrescens has been reported to display superior anti‐inflammatory and antioxidant activities in both in vitro and in vivo models (Gao et al. 2018; Kim et al. 2017; Shim et al. 2021). These evidences suggest that S. glabrescens may have greater therapeutic potential for preventing skeletal muscle atrophy compared to other Siegesbeckia species. Nevertheless, whether S. glabrescens can protect against skeletal muscle atrophy remains to be determined. Hence, in this study, we examined whether a standardized hot water extract of S. glabrescens (SGE), containing kirenol, can alleviate immobilization‐induced muscle atrophy in C57BL/6J mice to elucidate its potential role in skeletal muscle deterioration. We hypothesized that SGE mitigates skeletal muscle atrophy by regulating the protein kinase B (Akt)/mTOR/forkhead box O3a (FoxO3a) pathways to enhance protein synthesis and suppress degradation, thereby restoring the balance between these processes in the immobilized muscles of C57BL/6J mice.

2. Materials and Methods

2.1. Preparation of SGE

Dried aerial parts of S. glabrescens were purchased from Biocare (Gyeonggi‐do, Republic of Korea) and taxonomically identified by Prof. Wonku Kang at the College of Pharmacy, Chung‐Ang University, Seoul, Republic of Korea. A voucher specimen (YBT‐SG2015) has been deposited at the Department of Biotechnology, Yonsei University. Dried and ground S. glabrescens (100 g) was extracted with hot water at 95°C for 3 h, as per a previously published method (Kim et al.  2017). The extract was filtrated using filter paper and concentrated using the rotary vacuum evaporator (Laborota 4000 efficient, Heidolph Instruments GmbH and Co. KG., Schwabach, Germany) to obtain the SGE with a yield of 19.4% (w/w). The SGE was standardized for the content of kirenol using high‐performance liquid chromatography analysis, as per a previously published method (Kim, Park, et al. 2014). The amount of kirenol in SGE was determined to be 0.67% (w/w) based on a standard curve using pure kirenol (Institute for Korea Traditional Medical Industry in Daegu, Republic of Korea) (Figure 1).

FIGURE 1.

FIGURE 1

Open in a new tab

HPLC chromatograms. (A) HPLC chromatograms of kirenol standard and (B) SGE.

2.2. Animal Studies

Seven‐week‐old male C57BL/6J mice were obtained from Young Bio (Seongnam, Republic of Korea) and maintained under a 12‐h light/dark cycle at 25°C ± 2°C with 55% ± 5% relative humidity. They had free access to standard chow and water. After 1 week of acclimatization, the mice were randomly assigned to four groups (n = 8 per group): (1) a nonimmobilized control (CON), (2) an immobilization‐only group (IM), (3) an immobilized group treated with SGE at 150 mg/kg/day (IM + SGE150), and (4) an immobilized group treated with SGE at 300 mg/kg/day (IM + SGE300). Sample size was determined based on our previous study investigating skeletal muscle atrophy and pharmacological interventions in mice (Hwang et al. 2024; C. Kim, M.‐B. Kim, and J.‐K. Hwang, 2020; Yoo et al. 2024), which typically used six to eight mice per group to achieve statistically meaningful results. Muscle atrophy was induced by immobilizing the right hindlimb for 1 week, while the left hindlimb served as a nonimmobilized control, as previously described (Kim, Kim, and Hwang 2020). Under anesthesia with 350 mg/kg of 2,2,2‐tribromoethanol (Sigma‐Aldrich, St. Louis, MO, USA), a surgical staple was inserted from the foot into the distal gastrocnemius (GA) of the right hindlimb using a skin stapler (F‐35 W; Unidus, Seoul, Republic of Korea). After the 1‐week immobilization period, the staple was removed while the mice remained anesthetized. On that same day, the IM + SGE150 and IM + SGE300 groups received oral SGE daily for 1 week, while the CON and IM groups were administered saline. Body weight and food intake were measured twice weekly. At the end of the treatment period, grip strength and muscle volumes were assessed before the mice were euthanized via cardiac puncture under anesthesia. Liver and spleen weights were measured at the end of the experiment to assess potential systemic toxicity of SGE treatment. No significant differences in liver and spleen weights were observed between the SGE‐treated and control groups (Figure S1). The GA, soleus (SOL), tibialis anterior (TA), and extensor digitorum longus (EDL) muscles were rapidly harvested and either snap‐frozen in liquid nitrogen for gene expression analyses or fixed in 10% formalin for histological examinations. All animal experiments were conducted in accordance with the guidelines of the Yonsei University Institutional Animal Care and Use Committee (IACUC) and were approved under protocol number IACUC‐A‐201608‐377‐04.

2.3. Grip Strength Test

A grip strength test was performed to assess the forelimb and hindlimb strength of mice using a Chatillon force measurement device (Columbus Instrument, Columbus, OH, USA), following previously published procedures (Kim, Kim, and Hwang 2020).

2.4. Micro‐Computed Tomography (Micro‐CT)

Muscle volume was assessed via micro‐CT imaging using a Siemens Inveon system for PET/CT/SPECT (Knoxville, TN, USA), located at the Center for Evaluation of Biomaterials (Pohang Technopark, Pohang, Republic of Korea).

2.5. Histological Analysis of TA

TA muscle samples preserved in 10% formalin were stained with hematoxylin and eosin (H&E). The stained sections were examined under a CK40 inverted microscope (Olympus, Tokyo, Japan) equipped with a T500 camera (eXcope, Daejeon, Republic of Korea). The cross‐sectional area (CSA) of individual muscle fibers was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA). Measurements were taken from one or two fields per mouse.

2.6. Reverse Transcription–Polymerase Chain Reaction (RT‐PCR)

Total RNA was extracted from TA muscle tissues and L6 myoblasts using TRIzol reagent (Takara Bio, Otsu, Japan). cDNA was synthesized and amplified with the GeneAmp PCR System 2700 (Applied Biosystems, Foster City, CA, USA), employing Reverse Transcriptase Premix and PCR Premix (ELPIS‐Biotech, Daejeon, Korea), following previously published protocols (Kim, Kim, and Hwang 2020). The resulting PCR products were resolved on a 1.5% agarose gel, stained using Loading STAR Dye (Dyne Bio, Seongnam, Republic of Korea), and visualized with a G:BOX EF imaging system (Syngene, Cambridge, UK). The specific primer sequences are listed in Table 1.

TABLE 1.

Primer sequences used in reverse transcription–polymerase chain reaction.

Origin Gene Direction Sequence (5′–3′)
Mouse MuRF1 Forward CCCTCTGCCCACCATTTACA
Reverse TTCTGTCTGCGGCTGTTGTC
Atrogin‐1 Forward CAAGAAGAGAGCAGTATGGGGTC
Reverse TTGAGGGGAAAGTGAGACGGA
β‐Actin Forward GCAGGAGTACGATGAGTCCG
Reverse ACGCAGCTCAGTAACAGTCC
Open in a new tab

2.7. Western Blot Analysis

Western blot analysis was performed to explore the molecular pathways linked to protein breakdown and synthesis, as previously detailed (Kim, Kim, and Hwang 2020). Primary antibodies, diluted 1:1000, included phospho (p)‐FoxO3a, FoxO3a, p‐mTOR, mTOR, p‐70‐kDa ribosomal protein S6 kinase (p70S6K), p70S6K, p‐4E binding protein 1 (p‐4EBP1), 4EBP1, p‐phosphatidylinositol 3‐kinase (p‐PI3K), PI3K, p‐Akt, Akt, and α‐Tubulin (all from Cell Signaling, Beverly, MA, USA). Protein detection and quantification were performed with the G:BOX EF imaging system and the GeneSys software (Syngene).

2.8. Cell Culture

Rat myoblasts L6 cell line (CRL‐1458, American Type Culture Collection, Manassas, VA, USA) were maintained in Dulbecco's Modified Eagle's Medium (DMEM; Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS; Hyclone) and antibiotics (100 U/mL penicillin, 100 μg/mL streptomycin). Cells were grown at 37°C in a 5% CO2 environment until they reached 70%–80% confluence. Myotube differentiation was induced by replacing the growth medium with DMEM containing 2% horse serum (Gibco, Gaithersburg, MD, USA) for 6 days, with medium changes every 2 days. After differentiation, the cells were simultaneously treated with 6 ng/mL tumor necrosis factor‐alpha (TNF‐α) (PeproTech, Rocky Hill, NJ, USA) and kirenol at 10, 20, or 40 μM for 24 h. A concentration of 6 ng/mL TNF‐α was selected to induce muscle atrophy, as serum levels of 1–6 ng/mL observed in patients with inflammatory diseases are sufficient to promote muscle protein loss without significant cytotoxicity (Li and Reid 2000). Kirenol concentrations were determined based on reported levels in Siegesbeckiae Herba (4–49 μmol/g dry weight) and supported by cytotoxicity assays (Wang et al. 2021).

2.9. Cell Viability

Cell viability was assessed using the colorimetric thiazolyl blue tetrazolium bromide (MTT) assay. L6 myoblasts were seeded and treated with various concentrations (10–60 μM) of kirenol for 24 h. Following treatment, MTT solution (0.5 mg/mL) was added to the cells, and the cells were incubated at 37°C for 3 h. After the incubation, the supernatant was removed, and the resulting formazan crystals were dissolved in dimethyl sulfoxide. The absorbance was determined at 540 nm using a VERSAmax tunable microplate reader (Molecular Devices Inc., Sunnyvale, CA, USA).

2.10. Statistical Analysis

Group differences were assessed using one‐way ANOVA, followed by Tukey's post hoc test, or via unpaired t‐tests when necessary. Statistical calculations were performed with GraphPad Prism 10.0 (GraphPad Software, La Jolla, CA, USA). Differences were considered significant when p < 0.05, and data are expressed as mean ± standard error of the mean (SEM).

3. Results

3.1. SGE Prevented Muscle Mass Loss in Mice With Immobilization‐Induced Muscle Atrophy

Since immobilization‐related muscle atrophy is typified by a decrease in muscle mass, we first measured the weights of four different muscle types in immobilized mice. Throughout the experiment, there were no notable differences in body weight across any of the groups (Figure 2A). In the IM group, total muscle weight was significantly reduced by 20% compared with the CON group. However, administration of SGE significantly alleviated the loss in total muscle weight (Cohen's d: 2.0, 3.6 for IM vs. IM + SGE150 or IM + SGE300; Figure 2B). Although GA (Cohen's d: −1.73, −3.07 for IM vs. IM + SGE150 or IM + SGE300), SOL (Cohen's d: −0.56, −1.37 for IM vs. IM + SGE150 or IM + SGE300), TA (Cohen's d: −1.14, −1.71 for IM vs. IM + SGE150 or IM + SGE300), and EDL (Cohen's d: −0.47, 1.52 for IM vs. IM + SGE150 or IM + SGE300) muscles each declined by over 15% in the IM group compared with the CON group; SGE mitigated these decreases in a dose‐dependent manner in all tested muscle types (Figure 2C).

FIGURE 2.

FIGURE 2

Open in a new tab

Protective effects of SGE on muscle mass in mice with immobilization‐induced muscle atrophy. Mice underwent 1 week of hindlimb immobilization to induce skeletal muscle atrophy, followed by 1 week of oral saline or SGE (150 or 300 mg/kg/day). (A) Body weight. (B) Total muscle weight. (C) Individual muscle weights of GA, SOL, TA, and EDL. Data are shown as mean ± SEM. n = 8 per group. Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA with Tukey's post hoc test or an unpaired t‐test. p values for the unpaired t‐test are indicated.

3.2. SGE Alleviated the Reductions in Grip Strength, Muscle Volume, and Muscle Fiber CSA Associated With Immobilization‐Induced Muscle Atrophy

We observed that SGE administration substantially alleviated the immobilization‐induced loss of muscle mass, which can enhance muscle function by providing greater strength, endurance, and overall physical performance. Therefore, we performed a grip strength test to further examine the effect of SGE on muscle function. The IM group showed a significant decrease in both forelimb and hindlimb grip strength, whereas SGE increased grip strength by over 24% relative to the IM group (Cohen's d; −3.70, −5.22 for IM vs. IM + SGE150 or IM + SGE300; Figure 3A). As muscle function closely correlates with density, size, and fiber CSA, we utilized micro‐CT to measure the volume of right hindlimb muscles and performed histological analysis via H&E staining. Compared with the CON group, the IM group exhibited a 22.6% reduction in muscle volume; however, administration of SGE in the IM + SGE150 and IM + SGE300 groups restored muscle volume in a dose‐dependent manner (Figure 3B). Similarly, TA muscle CSA was significantly reduced in the IM group relative to the CON group, but was elevated by 18.7% and 28.2% in the IM + SGE150 and IM + SGE300 groups, respectively (Cohen's d; −3.64, −5.02 for IM vs. IM + SGE150 or IM + SGE300; Figure 3C).

FIGURE 3.

FIGURE 3

Open in a new tab

Effects of SGE on grip strength, muscle volume, and CSA myofibers in immobilization‐induced muscle atrophy. Mice underwent 1 week of hindlimb immobilization to induce skeletal muscle atrophy, followed by 1 week of oral saline or SGE (150 or 300 mg/kg/day). (A) Grip strength measurements. n = 6 per group. (B) Representative micro‐CT images of hindlimb skeletal muscle. (C) Representative H&E‐stained sections of the TA muscle (magnification, × 200) and quantification of CSA in the TA muscle fibers. Data are shown as mean ± SEM. n = 3 per group. Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA with Tukey's post hoc test.

3.3. SGE Suppressed Protein Degradation Markers in the TA Muscle Under Immobilization‐Induced Muscle Atrophy

During immobilization‐induced muscle atrophy, muscle‐specific E3 ubiquitin ligases, including muscle ring finger 1 (MuRF1) and muscle atrophy F‐box (Atrogin‐1), are tightly regulated by the transcription factor FoxO3a and become highly expressed (Jackman and Kandarian 2004; Kandarian and Jackman 2006; Kim, Kim, and Hwang 2020). Thus, we next assessed whether SGE can inhibit the elevated protein degradation‐related marker expression in immobilized TA muscles. MuRF1 and Atrogin‐1 mRNA levels were significantly elevated in the IM group but were substantially reduced by SGE administration to near CON levels (Figure 4A). Phosphorylated FoxO3a expression was notably lower in the IM group compared with the CON group, yet significantly recovered following SGE administration (Figure 4B).

FIGURE 4.

FIGURE 4

Open in a new tab

SGE mediated inhibition of protein degradation markers in the TA muscle of mice with immobilization‐induced muscle atrophy. Mice underwent 1 week of hindlimb immobilization to induce skeletal muscle atrophy, followed by 1 week of oral saline or SGE (150 or 300 mg/kg/day). (A) RT‐PCR analysis of MuRF1 and Atrogin‐1 mRNA expression in the TA muscle. (B) Western blot analysis of total and phosphorylated FoxO3a protein levels in the TA muscle. β‐Actin and α‐tubulin served as loading controls. Data are shown as mean ± SEM. n = 3 per group. Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA.

3.4. SGE Elevated Protein Synthesis Markers in the TA Muscle During Immobilization‐Induced Muscle Atrophy

The mTOR/p70S6K/4EBP1 and PI3K/Akt signaling pathways are pivotal in governing muscle protein synthesis, a process that becomes impaired under immobilization‐induced muscle atrophy (Zhang et al. 2007). Therefore, we evaluated these pathways in the TA muscle of immobilized mice. In comparison with the CON group, the IM group exhibited decreased phosphorylation levels of mTOR, accompanied by diminished phosphorylation of p70S6K and 4EBP1. However, SGE administration completely restored phosphorylated mTOR, p70S6K, and 4EBP1 in the IM + SGE150 and IM + SGE300 groups (Figure 5A). Also, the protein expression levels of PI3K and Akt phosphorylation were significantly suppressed in the IM group compared to the CON group, but were significantly rescued by SGE treatment in the IM + SGE150 and IM + SGE300 groups (Figure 5B).

FIGURE 5.

FIGURE 5

Open in a new tab

SGE induced enhancement of protein synthesis pathway markers in the TA muscle of mice with immobilization‐induced muscle atrophy. Mice underwent 1 week of hindlimb immobilization to induce skeletal muscle atrophy, followed by 1 week of oral saline or SGE (150 or 300 mg/kg/day). (A) Western blot analysis of total and phosphorylated mTOR, p70S6K, and 4EBP1 in the TA muscle. (B) Western blot analysis of total and phosphorylated Akt and PI3K in the TA muscle. α‐Tubulin was served as loading controls. Data are shown as mean ± SEM. n = 3 per group. Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA with Tukey's post hoc test or an unpaired t‐test.

3.5. Kirenol Alleviated TNF‐α‐Triggered Muscle Atrophy in L6 Myotubes

Having observed that SGE effectively countered muscle atrophy caused by immobilization in mice, we further explored whether kirenol (Figure 6A), a main active diterpenoid component in SGE, can inhibit TNF‐α‐induced muscle atrophy in L6 myotubes. When kirenol was treated in L6 myotubes at concentrations ranging 0–60 μM, cell viability at 40 μM of kirenol was approximately 98% (Figure 6B). Consequently, we decided to use kirenol concentrations below 40 μM for the following experiments. The expression of MuRF1 and Atrogin‐1 mRNA was significantly increased by TNF‐α, but it decreased in a dose‐dependent manner with kirenol treatment (Figure 6C). Also, TNF‐α noticeably lowered phosphorylation levels of mTOR, p70S6K, and 4EBP1, whereas kirenol treatment largely restored these phosphorylated proteins (Figure 6D).

FIGURE 6.

FIGURE 6

Open in a new tab

Alleviation of TNF‐α‐induced muscle atrophy by kirenol in L6 myotubes. L6 myotubes were treated with TNF‐α (6 ng/mL) and kirenol (10, 20, and 40 μM) for 24 h. (A) Chemical structure of kirenol. (B) Cell viability. (C) RT‐PCR analysis of MuRF1 and Atrogin‐1 mRNA expression. (D) Western blot analysis of total and phosphorylated mTOR, p70S6K, and 4EBP1. β‐Actin and α‐tubulin were employed as loading controls. Data are shown as mean ± SEM. Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA with Tukey's post hoc test.

4. Discussion

During immobilization‐induced muscle atrophy, inflammation and oxidative stress exacerbate muscle loss by disrupting the equilibrium between protein synthesis and degradation (Y. Ji et al. 2022; Lee et al. 2021). Natural products with anti‐inflammatory and antioxidant properties offer promising potential for preventing and treating muscle atrophy. Siegesbeckia Herba and its key bioactive constituent, kirenol, have demonstrated potent anti‐inflammatory and antioxidant effects through inhibition of nuclear factor‐κB (NF‐κB) and mitogen‐activated protein kinases (MAPKs), while activating the nuclear factor erythroid 2‐related factor 2 (Nrf2) via the PI3K/Akt signaling pathway (Linghu et al. 2020; Nasir et al. 2022). This observation implies that Siegesbeckia Herba and kirenol hold potential for the mitigation of muscle atrophy. However, despite these known properties, further exploration of their effects remains necessary. In this study, we demonstrated that SGE enriched with kirenol alleviates immobilization‐induced skeletal muscle atrophy in C57BL/6J mice by modulating the Akt/mTOR/FoxO3a signaling pathways. Importantly, we also provided the first evidence that kirenol, the diterpenoid of SGE, counters TNF‐α‐induced muscle atrophy in L6 myotubes.

Immobilizing skeletal muscle triggers two primary processes: A suppression of protein synthesis and an upregulation of protein degradation (Ji and Yeo 2019). Protein synthesis is decreased by inhibiting the insulin‐like growth factor 1 (IGF‐1)–Akt–mTOR pathway, while protein degradation is increased by activating the ubiquitin–protein degradation pathway, which is mainly regulated by FoxO subfamily transcription factors (Jackman and Kandarian 2004; Ji and Yeo 2019). Impairment of the equilibrium between protein synthesis and degradation, under conditions where proteolytic activity surpasses anabolic processes, constitutes a principal mechanism underlying the development of muscle atrophy. Akt‐mediated signaling stimulates anabolic processes via the mTOR/p70S6K/4EBP1 axis and concomitantly suppresses proteolysis through FoxO3a phosphorylation, which blocks nuclear translocation and subsequent transactivation of atrogenes encoding ubiquitin ligases, including MuRF1 and Atrogin‐1 (Bodine and Baehr 2014; Sandri et al. 2004). In this study, we observed that SGE promoted the PI3K/Akt/mTOR pathway, increasing the phosphorylation of key downstream substrates p70S6K and 4EBP1 in the TA muscle, which enhances muscle protein synthesis. Continually, SGE reduced the gene expression of MuRF1 and Atrogin‐1 by suppressing FoxO3a phosphorylation, ultimately preventing protein degradation in the TA muscle. Increased protein synthesis coupled with reduced protein degradation promotes the accumulation of total muscle protein and organelles, thereby precipitating greater muscle mass and hypertrophy (Vainshtein and Sandri 2020). Importantly, multiple lines of evidence indicate that kirenol exerts both anti‐inflammatory and antioxidant effects by activating the PI3K/Akt signaling pathway (Nasir et al. 2022). This pathway plays a pivotal role in regulating skeletal muscle mass by promoting protein synthesis and inhibiting protein degradation. In our study, we observed that kirenol enhanced mTOR‐mediated protein synthesis and concurrently suppressed FoxO3a‐driven transcription of MuRF1 and Atrogin‐1, effects that may be mediated by the PI3K/Akt pathway in L6 myotubes. These dual regulatory effects suggest that the beneficial actions of SGE on muscle mass and function are mechanistically linked to these specific signaling cascades. Therefore, the protective effects of SGE against immobilization‐induced skeletal muscle loss are likely attributed to its ability to enhance protein synthesis and decrease protein degradation through the Akt/mTOR/FoxO3a signaling pathway, ultimately increasing muscle mass and volume in mice. However, further research with prolonged treatment and follow‐up is needed to determine whether the beneficial effects of SGE observed in short‐term immobilization are sustained during long‐term disuse conditions.

In this study, SGE administration markedly mitigated the detrimental effects of immobilization, including reductions in TA muscle fiber CSA, decreased muscle weights across four muscle types, and reduced total muscle volume. The decrease in muscle fiber CSA is a well‐established indicator of immobilization‐induced muscle atrophy, reflecting a disruption in the delicate balance between protein synthesis and degradation crucial for maintaining muscle mass (Jackman and Kandarian 2004; Kandarian and Jackman 2006). The protective effect of SGE against muscle atrophy stems from its ability to modulate this balance, primarily through the regulation of the Akt/mTOR/FoxO3a signaling pathways. In particular, kirenol, an active compound of SGE, attenuated TNF‐α‐induced muscle atrophy in L6 myotubes by regulating these same pathways. This observation provides a mechanistic link between kirenol effects at the cellular level and its ability of SGE to maintain muscle mass during immobilization in mice. The preservation of muscle mass and CSA by SGE is particularly important, as muscle mass plays a crucial role in maintaining function and strength. This was evidenced by the substantial alleviation of grip strength loss in mice subjected to immobilization‐induced muscle atrophy following SGE administration. It has been shown that reduced muscle fiber CSA is directly linked to decreased force generation capacity (Kristiansen et al. 2014). The preservation of muscle CSA through SGE administration likely contributes to maintaining muscle function during periods of immobilization. Thus, these findings demonstrate that SGE effectively protects skeletal muscle physiological functions against immobilization stress. This suggests that preserving muscle strength and promoting muscle mass is primarily accomplished through regulation of the Akt/mTOR/FoxO3a signaling pathway. Recent studies have shown that mitochondrial dysfunction, impaired autophagy, and fibrosis are important contributors to muscle wasting (Egerman and Glass 2014; Mahdy 2019; Romanello and Sandri 2016). Although our study focused on the Akt/mTOR/FoxO3a pathway, future research should examine whether SGE and kirenol also influence these pathways, which could provide a more comprehensive understanding of their therapeutic effects in skeletal muscle atrophy.

Immobilization‐induced skeletal muscle atrophy is driven by a combination of chronic inflammation and oxidative stress (Xu et al. 2022). Pro‐inflammatory cytokines are key factors that promote the breakdown of muscle proteins (Sishi and Engelbrecht 2011; Wang et al. 2014). The activation of NF‐κB triggers an increase in the expression of muscle‐specific E3 ubiquitin ligases, which play a crucial role in facilitating protein breakdown within skeletal muscle tissue (Xu et al. 2022). In this study, we found that kirenol attenuated TNFα‐induced muscle atrophy in L6 myotubes by stimulating muscle protein synthesis and inhibiting protein degradation through the Akt/mTOR/FoxO3a signaling pathway. This dual action highlights the ability of kirenol to restore the balance between anabolic and catabolic processes in skeletal muscle. Also, the preventive effect of kirenol on muscle atrophy in L6 myotubes is partly attributed to a reducing proinflammatory cytokines in TNF‐α‐treated L6 myotubes. Furthermore, SGE has been shown to suppress pro‐inflammatory cytokine expression by inhibiting NF‐κB and MAPK signaling pathways, while kirenol enhances antioxidant defenses by activating Nrf2 via PI3K/Akt signaling, reducing intracellular ROS levels (Linghu et al. 2020; Nasir et al. 2022). These protective actions of SGE and kirenol against inflammation and oxidative stress are likely to contribute to their anti‐muscle atrophy effects, which is consistent with previous research showing that natural compounds targeting NF‐κB and oxidative stress pathways can prevent muscle wasting (Nikawa et al. 2021). Hydrogen sulfide donors have been shown to alleviate immobilization‐induced muscle atrophy by reducing inflammation, oxidative stress, and fibrosis (Xu et al. 2022). The ability of SGE to inhibit NF‐κB and MAPK signaling pathways, coupled with the antioxidant properties of kirenol, offers a multi‐faceted approach to combating muscle atrophy. Thus, these results indicate that the anti‐inflammatory and antioxidant properties of SGE and kirenol play a pivotal role in their preventive effects on skeletal muscle atrophy. By targeting key molecular pathways involved in inflammation (NF‐κB) and oxidative stress (Nrf2), SGE and kirenol offer a promising therapeutic approach for managing immobilization‐induced muscle wasting. However, further research is needed to ascertain whether SGE and kirenol exert their effects against muscle atrophy by modulating the NF‐κB and Nrf2 pathways under conditions of immobilization and in TNFα‐induced L6 myotubes.

5. Conclusion

In conclusion, this study reveals the novel protective effects of SGE containing kirenol against skeletal muscle atrophy. In mice subjected to immobilization, SGE mitigated the decline in muscle strength, mass, volume, and muscle fiber CSA by inhibiting muscle‐specific E3 ubiquitin ligases and promoting protein synthesis markers through modulation of the Akt/mTOR/FoxO3a pathway. Similarly, kirenol attenuated TNFα‐induced atrophy in L6 myotubes through the same signaling cascade, balancing protein synthesis and degradation. These findings suggest that SGE containing kirenol holds potential for preventing muscle atrophy and may serve as a basis for future development of functional interventions aimed at supporting muscle health.

Author Contributions

Sungmin Han: formal analysis (equal), investigation (equal), methodology (equal), software (equal), visualization (equal), writing – original draft (equal), writing – review and editing (equal). Jae‐Kwan Hwang: conceptualization (equal), project administration (equal), resources (equal), supervision (equal), writing – original draft (equal), writing – review and editing (equal). Mi‐Bo Kim: conceptualization (equal), data curation (equal), formal analysis (equal), investigation (equal), methodology (equal), software (equal), supervision (equal), visualization (equal), writing – original draft (equal), writing – review and editing (equal).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1. Liver and spleen weight. Mice underwent 1 week of hindlimb immobilization to induce skeletal muscle atrophy, followed by 1 week of oral saline or SGE (150 or 300 mg/kg/day). (A) Liver weight. (B) Spleen weight. Data are shown as mean ± SEM (n = 8 per each group). Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA with Tukey's post hoc test. p values for the unpaired t‐test are indicated.

FSN3-13-e71005-s001.docx (39.3KB, docx)

Han, S. , Hwang J.‐K., and Kim M.‐B.. 2025. “ Siegesbeckia Glabrescens Extract Ameliorates Immobilization‐Induced Muscle Atrophy by Regulating the Akt/mTOR/FoxO3a Signaling Pathways in Mice.” Food Science & Nutrition 13, no. 10: e71005. 10.1002/fsn3.71005.

Funding: This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (RS202300247455).

Data Availability Statement

This study is available from the corresponding author upon reasonable request.

References

  1. Barreiro, E. 2018. “Models of Disuse Muscle Atrophy: Therapeutic Implications in Critically Ill Patients.” Annals of Translational Medicine 6, no. 2: 29. 10.21037/atm.2017.12.12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bodine, S. C. , and Baehr L. M.. 2014. “Skeletal Muscle Atrophy and the E3 Ubiquitin Ligases MuRF1 and MAFbx/Atrogin‐1.” American Journal of Physiology. Endocrinology and Metabolism 307, no. 6: E469–E484. 10.1152/ajpendo.00204.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Egerman, M. A. , and Glass D. J.. 2014. “Signaling Pathways Controlling Skeletal Muscle Mass.” Critical Reviews in Biochemistry and Molecular Biology 49, no. 1: 59–68. 10.3109/10409238.2013.857291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Gao, X. , Wei J., Hong L., Fan S., Hu G., and Jia J.. 2018. “Comparative Analysis of Chemical Composition, Anti‐Inflammatory Activity and Antitumor Activity in Essential Oils From Siegesbeckia Orientalis, S. Glabrescens and S. Pubescens With an ITS Sequence Analysis.” Molecules 23, no. 9: 2185. 10.3390/molecules23092185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hwang, J. , Kim M.‐B., Lee S., and Hwang J.‐K.. 2024. “Fucosterol, a Phytosterol of Marine Algae, Attenuates Immobilization‐Induced Skeletal Muscle Atrophy in C57BL/6J Mice.” Marine Drugs 22, no. 12: 557. 10.3390/md22120557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Jackman, R. W. , and Kandarian S. C.. 2004. “The Molecular Basis of Skeletal Muscle Atrophy.” American Journal of Physiology‐Cell Physiology 287, no. 4: C834–C843. 10.1152/apjcell.00579.2003. [DOI] [PubMed] [Google Scholar]
  7. Ji, L. L. , and Yeo D.. 2019. “Cellular Mechanism of Immobilization‐Induced Muscle Atrophy: A Mini Review.” Sports Medicine and Health Science 1, no. 1: 19–23. 10.1016/j.smhs.2019.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ji, Y. , Li M., Chang M., et al. 2022. “Inflammation: Roles in Skeletal Muscle Atrophy.” Antioxidants (Basel) 11, no. 9: 1686. 10.3390/antiox11091686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kandarian, S. C. , and Jackman R. W.. 2006. “Intracellular Signaling During Skeletal Muscle Atrophy.” Muscle and Nerve 33, no. 2: 155–165. 10.1002/mus.20442. [DOI] [PubMed] [Google Scholar]
  10. Kim, C. , Kim M.‐B., and Hwang J.‐K.. 2020. “Red Bean Extract Inhibits Immobilization‐Induced Muscle Atrophy in C57BL/6N Mice.” Journal of Medicinal Food 23, no. 1: 29–36. 10.1089/jmf.2019.4426. [DOI] [PubMed] [Google Scholar]
  11. Kim, J. , Kim M.‐B., Yun J. G., and Hwang J. K.. 2017. “Protective Effects of Standardized Siegesbeckia Glabrescens Extract and Its Active Compound Kirenol Against UVB‐Induced Photoaging Through Inhibition of MAPK/NF‐κB Pathways.” Journal of Microbiology and Biotechnology 27, no. 2: 242–250. 10.4014/jmb.1610.10050. [DOI] [PubMed] [Google Scholar]
  12. Kim, M. B. , Kim C., and Hwang J. K.. 2019. “Standardized Siegesbeckia Orientalis L. Extract Increases Exercise Endurance Through Stimulation of Mitochondrial Biogenesis.” Journal of Medicinal Food 22, no. 11: 1159–1167. 10.1089/jmf.2019.4485. [DOI] [PubMed] [Google Scholar]
  13. Kim, M. B. , Kim C., and Hwang J. K.. 2020. “High Hydrostatic Pressure Extract of Siegesbeckia Orientalis Inhibits Adipogenesis Through the Activation of the Wnt/Beta‐Catenin Signaling Pathway.” Food Science and Biotechnology 29, no. 7: 977–985. 10.1007/s10068-020-00733-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kim, M. B. , Song Y., and Hwang J. K.. 2014. “Kirenol Stimulates Osteoblast Differentiation Through Activation of the BMP and Wnt/Beta‐Catenin Signaling Pathways in MC3T3‐E1 Cells.” Fitoterapia 98: 59–65. 10.1016/j.fitote.2014.07.013. [DOI] [PubMed] [Google Scholar]
  15. Kim, M. B. , Song Y., Kim C., and Hwang J. K.. 2014. “Kirenol Inhibits Adipogenesis Through Activation of the Wnt/Beta‐Catenin Signaling Pathway in 3T3‐L1 Adipocytes.” Biochemical and Biophysical Research Communications 445, no. 2: 433–438. 10.1016/j.bbrc.2014.02.017. [DOI] [PubMed] [Google Scholar]
  16. Kim, M.‐B. , Park J.‐E., Woo S. W., Lim S.‐B., and Hwang J.‐K.. 2014. “Optimization of High Hydrostatic Pressure Process for the Extraction of Kirenol From Siegesbeckia Orientalis L. Using Response Surface Methodology.” Food Science and Biotechnology 23: 731–738. 10.1007/s10068-014-0099-z. [DOI] [Google Scholar]
  17. Kristiansen, M. S. , Uhrbrand A., Hansen M., et al. 2014. “Concomitant Changes in Cross‐Sectional Area and Water Content in Skeletal Muscle After Resistance Exercise.” Scandinavian Journal of Medicine and Science in Sports 24, no. 4: e260–e268. 10.1111/sms.12160. [DOI] [PubMed] [Google Scholar]
  18. Lee, D. Y. , Chun Y. S., Kim J. K., et al. 2021. “Curcumin Ameliorated Oxidative Stress and Inflammation‐Related Muscle Disorders in C2C12 Myoblast Cells.” Antioxidants (Basel) 10, no. 3: 476. 10.3390/antiox10030476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Li, Y.‐P. , and Reid M. B.. 2000. “NF‐κB Mediates the Protein Loss Induced by TNF‐α in Differentiated Skeletal Muscle Myotubes.” American Journal of Physiology. Regulatory, Integrative and Comparative Physiology 279, no. 4: R1165–R1170. 10.1152/ajpregu.2000.279.4.R1165. [DOI] [PubMed] [Google Scholar]
  20. Linghu, K. G. , Zhao G. D., Xiong W., et al. 2020. “Comprehensive Comparison on the Anti‐Inflammatory Effects of Three Species of Sigesbeckia Plants Based on NF‐kappaB and MAPKs Signal Pathways in Vitro.” Journal of Ethnopharmacology 250: 112530. 10.1016/j.jep.2019.112530. [DOI] [PubMed] [Google Scholar]
  21. Lu, Y. , Xiao J., Wu Z. W., et al. 2012. “Kirenol Exerts a Potent Anti‐Arthritic Effect in Collagen‐Induced Arthritis by Modifying the T Cells Balance.” Phytomedicine 19, no. 10: 882–889. 10.1016/j.phymed.2012.04.010. [DOI] [PubMed] [Google Scholar]
  22. Lv, X. , Wang X., Wang X., et al. 2023. “Research Progress in Arthritis Treatment With the Active Components of Herba Siegesbeckiae.” Biomedicine and Pharmacotherapy 169: 115939. 10.1016/j.biopha.2023.115939. [DOI] [PubMed] [Google Scholar]
  23. Mahdy, M. A. 2019. “Skeletal Muscle Fibrosis: An Overview.” Cell and Tissue Research 375, no. 3: 575–588. 10.1007/s00441-018-2955-2. [DOI] [PubMed] [Google Scholar]
  24. Nasir, N. N. , Sekar M., Fuloria S., et al. 2022. “Kirenol: A Potential Natural Lead Molecule for a New Drug Design, Development, and Therapy for Inflammation.” Molecules 27, no. 3: 734. 10.3390/molecules27030734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nikawa, T. , Ulla A., and Sakakibara I.. 2021. “Polyphenols and Their Effects on Muscle Atrophy and Muscle Health.” Molecules 26, no. 16: 4887. 10.3390/molecules26164887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Phillips, S. M. , and McGlory C.. 2014. “CrossTalk Proposal: The Dominant Mechanism Causing Disuse Muscle Atrophy Is Decreased Protein Synthesis.” Journal of Physiology 592, no. 24: 5341–5343. 10.1113/jphysiol.2014.273615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Powers, S. K. , Smuder A. J., and Criswell D. S.. 2011. “Mechanistic Links Between Oxidative Stress and Disuse Muscle Atrophy.” Antioxidants and Redox Signaling 15, no. 9: 2519–2528. 10.1089/ars.2011.3973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Pradhan, S. K. , Gupta R. C., and Goel R. K.. 2018. “Differential Content of Secondary Metabolites in Diploid and Tetraploid Cytotypes of Siegesbeckia Orientalis L.” Natural Product Research 32, no. 20: 2476–2482. 10.1080/14786419.2017.1423298. [DOI] [PubMed] [Google Scholar]
  29. Romanello, V. , and Sandri M.. 2016. “Mitochondrial Quality Control and Muscle Mass Maintenance.” Frontiers in Physiology 6: 422. 10.3389/fphys.2015.00422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sandri, M. , Sandri C., Gilbert A., et al. 2004. “Foxo Transcription Factors Induce the Atrophy‐Related Ubiquitin Ligase Atrogin‐1 and Cause Skeletal Muscle Atrophy.” Cell 117, no. 3: 399–412. 10.1016/S0092-8674(04)00400-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Shim, S.‐Y. , Lee Y. E., and Lee M.. 2021. “Antioxidant Compounds, Kirenol and Methyl Ent‐16α, 17‐Dihydroxy‐Kauran‐19‐Oate Bioactivity‐Guided Isolated From Siegesbeckia Glabrescens Attenuates MITF‐Mediated Melanogenesis via Inhibition of Intracellular ROS Production.” Molecules 26, no. 7: 1940. 10.3390/molecules26071940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sishi, B. J. , and Engelbrecht A. M.. 2011. “Tumor Necrosis Factor Alpha (TNF‐Alpha) Inactivates the PI3‐Kinase/PKB Pathway and Induces Atrophy and Apoptosis in L6 Myotubes.” Cytokine 54, no. 2: 173–184. 10.1016/j.cyto.2011.01.009. [DOI] [PubMed] [Google Scholar]
  33. Tao, H. X. , Zhao G. D., Linghu K. G., et al. 2021. “Botany, Traditional Use, Phytochemistry, Pharmacology and Toxicology of Sigesbeckiae Herba (Xixiancao): A Review.” Phytochemistry Reviews 20, no. 3: 569–587. 10.1007/s11101-020-09714-4. [DOI] [Google Scholar]
  34. Vainshtein, A. , and Sandri M.. 2020. “Signaling Pathways That Control Muscle Mass.” International Journal of Molecular Sciences 21, no. 13: 4759. 10.3390/ijms21134759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang, D. T. , Yin Y., Yang Y. J., et al. 2014. “Resveratrol Prevents TNF‐Alpha‐Induced Muscle Atrophy via Regulation of Akt/mTOR/FoxO1 Signaling in C2C12 Myotubes.” International Immunopharmacology 19, no. 2: 206–213. 10.1016/j.intimp.2014.02.002. [DOI] [PubMed] [Google Scholar]
  36. Wang, Q. , Liang Y. Y., Li K. W., et al. 2021. “Herba Siegesbeckiae: A Review on Its Traditional Uses, Chemical Constituents, Pharmacological Activities and Clinical Studies.” Journal of Ethnopharmacology 275: 114117. 10.1016/j.jep.2021.114117. [DOI] [PubMed] [Google Scholar]
  37. Xu, M. , Liu X., Bao P., Wang Y. J., Lu J., and Liu Y. J.. 2022. “H2S Protects Against Immobilization‐Induced Muscle Atrophy via Reducing Oxidative Stress and Inflammation.” Frontiers in Physiology 13: 844539. 10.3389/fphys.2022.844539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yang, Y. , Chen H., Lei J., and Yu J.. 2016. “Biological Activity of Extracts and Active Compounds Isolated From Siegesbeckia Orientalis L.” Industrial Crops and Products 94: 288–293. 10.1016/j.indcrop.2016.08.023. [DOI] [Google Scholar]
  39. Yoo, J. , Kim C., Lee H., Ko B. S., Lee D.‐W., and Hwang J.‐K.. 2024. “Fermented Antler Extract Attenuates Muscle Atrophy by Regulating the PI3K/Akt Pathway and Inflammatory Response in Immobilization‐Treated C57BL/6J Mice.” Food Science and Biotechnology 33, no. 15: 3617–3628. 10.1007/s10068-024-01606-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zarzhevsky, N. , Carmeli E., Fuchs D. C. R., Stein H., and Reznick A. Z.. 2001. “Recovery of Muscles of Old Rats After Hindlimb Immobilisation by External Fixation Is Impaired Compared With Those of Young Rats.” Experimental Gerontology 36, no. 1: 125–140. 10.1016/S0531-5565(00)00189-3. [DOI] [PubMed] [Google Scholar]
  41. Zhang, P. , Chen X., and Fan M.. 2007. “Signaling Mechanisms Involved in Disuse Muscle Atrophy.” Medical Hypotheses 69, no. 2: 310–321. 10.1016/j.mehy.2006.11.043. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. Liver and spleen weight. Mice underwent 1 week of hindlimb immobilization to induce skeletal muscle atrophy, followed by 1 week of oral saline or SGE (150 or 300 mg/kg/day). (A) Liver weight. (B) Spleen weight. Data are shown as mean ± SEM (n = 8 per each group). Bars sharing the same letter do not differ significantly (p < 0.05) based on one‐way ANOVA with Tukey's post hoc test. p values for the unpaired t‐test are indicated.

FSN3-13-e71005-s001.docx (39.3KB, docx)

Data Availability Statement

This study is available from the corresponding author upon reasonable request.

Articles from Food Science & Nutrition are provided here courtesy of Wiley

RESOURCES