Skip to main content
NCBI home page
Animal Models and Experimental Medicine logoLink to Animal Models and Experimental Medicine
. 2025 Jul 20;8(8):1524–1531. doi: 10.1002/ame2.70056

A comparative study of human ovarian tissue xenotransplantation in two different strains of rats

Mohammad Ayoubipour 1,2, Hussein Eimani 2,✉, Rouhollah Fathi 2, Mohammad Kazemi Ashtiani 3, Ashraf Moinie 2,4,5, Parviz Golmohammadi Gerdkohi 2
PMCID: PMC12464865  PMID: 40878960

Abstract

This study aims to conduct a comparative study of two strains of laboratory rats, hooded and Wistar, to select a suitable alternative to nude rats for ovarian tissue xenotransplantation. The study investigated the effects of ovarian tissue transplantation using three experimental groups: (1) the control group receiving vitrified‐warmed human ovarian tissue, (2) the OTW (ovarian tissue transplantation in Wistar) group with human ovarian tissues in Wistar rats, and (3) the OTH (ovarian tissue transplantation in hooded) group with ovarian tissues transplanted into hooded rats. A total of 12 rats (6 each from the two transplantation groups) were used, with tissue samples implanted in the dorsal neck muscles. Outcomes were evaluated using histological analyses, including hematoxylin and eosin and Masson's trichrome staining, as well as immunohistochemical assessments of CD31 for angiogenesis, fibrosis, and necrosis. The OTH group exhibited more blood vessel numbers and the Vegf gene expression than both the OTW and control groups, with significantly lower levels of fibrosis and necrosis compared to the OTW and control groups. The study indicates that hooded rats could serve as a valuable alternative for specific research when nude mice are not available. Their immune systems are more compatible with human ovarian tissue transplants than Wistar rats, and they exhibit calmer behaviors, making them better suited for laboratory work.

Keywords: angiogenesis, hooded rat, human ovarian tissue, Wistar rat, xenotransplantation

The study involved performing ovariectomy on female Hooded and Wistar rats 14 days prior to transplantation. Following ovariectomy, the rats received cyclosporine starting five days before surgery to suppress the immune response and prevent graft rejection. On the day of the operation, previously collected and frozen human ovarian tissue samples were thawed and transplanted into the back neck muscle of the rats. Cyclosporine treatment was continued throughout the postoperative period. One week after transplantation, tissue samples were collected for various analyses, including hematoxylin and eosin (H&E) histology, evaluation of fibrosis and necrosis, and measurement of Vegf gene expression.

graphic file with name AME2-8-1524-g001.jpg

1. INTRODUCTION

Cancer remains a major global health challenge, yet advancements in early detection and treatment have led to improved survival rates, with approximately 65% for adults and 85% for children. 1 , 2 Due to the impact of cancer treatments on reproductive health, research into strategies for preserving fertility in cancer survivors has become increasingly important. One innovative approach in this area is xenotransplantation, particularly the transplantation of ovarian tissue (OT) from one species to another. Various animals, including mice, rats, goats, sheep and primates, have been used in ovarian xenograft studies. 3

Preventing cancer recurrence is crucial for the success of ovarian transplantation. 4 A significant landmark in this field occurred in 1996 when Hovatta and colleagues successfully demonstrated the freezing of human ovaries. 5 The practice of human ovarian transplantation has a long history, with early documented cases dating back over a century, including a significant xenograft performed by Bomsa and his team in 1983. 6 Since then, extensive research has focused on the transplantation of human OT using xenografting.

Research by Cacciottola et al. found that using stem cells to modulate the PI3K/AKT signaling pathway can enhance the survival of human OT transplanted into severe combined immunodeficiency (SCID) mice. 7

Similarly, another study involving human OT transplanted into nude mice reported increased levels of immune‐related factors, such as interleukin 8, matrix metalloproteinase 14, and CXCR4. 8 , 9 In contrast, Agca et al. observed that transplanting rat OT into nude mice led to a decrease in genes involved in ovarian metabolism and function and an increase in genes associated with transplant rejection. These findings underscore the challenge of immune rejection when OTs from different species are transplanted into host animals. One potential solution is to select host species and strains that are more effective at minimizing rejection and immune responses.

In addition to selecting the appropriate host species, which is essential for successful xenotransplantation, several other factors play a vital role in improving outcomes. These include the techniques used for tissue preservation through freezing, the selection of antifreeze agents incorporated into cryoprotectant solutions, the choice of graft site, and the hormone therapy protocols applied, as well as the use of scaffolds. Collectively, these elements help promote enhanced blood vessel formation (angiogenesis) and strengthen the adhesion of the graft, leading to better overall success rates. 4 , 10 , 11

As mentioned earlier, one of the primary challenges in xenograft transplantation is the rejection of the graft by the host's immune system. To address this issue, researchers often utilize immunodeficient mouse models, such as nonobese diabetic (NOD) and SCID mice. Although these models are valuable for understanding certain aspects of transplantation, they do not completely replicate the complexities involved in human transplantation. 12 Athymic (nude) mice lack a thymus, which prevents them from producing mature T cells and leads to a reduced immune response. 13 SCID mice, which are deficient in both B and T lymphocytes, were among the first models employed in transplantation research. When bred with a NOD background, these mice exhibited decreased activity of natural killer cells, making them more suitable for xenograft studies. 14 , 15

In laboratory settings, rat strains such as Lister‐Hodde, Lewis, Fisher 344, and Wistar have been used as host models for OT transplantation across different species, yielding significant findings. 16 , 17 However, the use of nude and SCID mice can pose challenges, including high costs and specific environmental requirements, which may limit their accessibility to all research facilities.

Our study aimed to explore a more suitable alternative for OT xenotransplantation by focusing on manual immunosuppression, thereby better mimicking human conditions while ensuring robustness in the face of challenging surgical and postoperative situations. This study is the first to select hooded and Wistar rat strains for a comparative analysis of transplantation outcomes. Human OT samples were transplanted into these rat strains and collected after 1 week for histological and immunological evaluation and gene expression. This investigation provided valuable new insights, offering both quantitative and qualitative results, particularly about angiogenesis and levels of tissue necrosis.

2. MATERIALS AND METHODS

2.1. Human OT manipulation and cryopreservation

OT samples were retrieved from 20 transsexual patients, aged 30–35, who had not undergone hormone therapy or at least 4 months had passed since their last hormone therapy. These samples were obtained at Arash Gynecology Hospital and transported to the laboratory within less than an hour in a DMEM‐F12 culture medium (Gibco, UK), enriched with fetal bovine serum, penicillin G, and streptomycin on ice. After the removal of the medulla, the cortex was sectioned into 3 × 3 × 3‐mm fragments. 18

The OTs were subjected to a carefully managed two‐step freezing process. First, during the equilibration phase, the tissues were soaked in a solution containing heuman tissue culture medium (HTCM), 7.5% thylene glycol (EG), and 7.5% dimethyle sulfoxide (DMSO) (Sigma‐Aldrich, Germany) along with 20% human serum albumin (HSA) (Biotestpharma, Germany) for 15 min at 4°C, and then washed. Then, during the vitrification step, the cortical tissue segments were exposed to a solution containing HTCM, 15% EG, 15% DMSO, 0.25 M sucrose (Sigma‐Aldrich), and 20% HSA for 10 min at 4°C before washing. Finally, all excess solution was removed before the tissues were directly transferred into liquid nitrogen for storage. The strips were warmed using a four‐stage process that involved lowering sucrose concentrations to 1, 0.5, 0.25, and 0.125 M. During this process, the basic medium used was HTCM and 20% HSA. 19

2.2. Surgical procedure and OT transplantation

Adult female hooded and Wistar rats (240–280 g) obtained from Helijard Karaj, Iran, were housed in temperature‐controlled environments with a 12‐h light–dark cycle and 50%–55% humidity, with sufficient access to food and water. 20 Cyclosporine‐A (210 mg/L) (Sandimmune, Novartis Pharmaceutical, East Hanover, NJ, USA) was mixed in their drinking water 2 days before transplantation for immunosuppression. 21 Xenograft of the ovarian cortex was performed 14 days after oophorectomy. 22 Rats were randomly allocated into three groups for xenotransplantation and then anesthetized. The area was shaved and sterilized with iodine solution, and then a 1‐cm‐long incision was made. OTs were warmed and transplanted into the back of the neck muscle. Three groups were considered: (1) control: vitrified‐warmed OT, (2) OTW (ovarian tissue transplantation in Wistar rat), and (3) OTD (ovarian tissue transplantation in hooded rat). Groups 2 and 3 consisted of six rats each, which received cyclosporine in a water‐soluble form daily and were treated with 5 IU of human menopausal gonadotropin (PDHOMOG 75 IU, Iran). 23 Each vial was aliquoted into 1.5 cc of distilled water, and 100 μL was injected into each animal. Hormone was injected 1 day after transplantation, once every 2 days for a week. Serum levels of cyclosporine with an average concentration of 1750 ± 34 ng/mL were measured in a random sample of rats. 20

2.3. Histological studies

One week after transplantation, the rats were administered anesthesia to retrieve the OT samples. These samples were then fixed in formalin and embedded in paraffin; 5‐μm sections were stained with hematoxylin and eosin (H&E). We used Image J software to count the number and measure the diameter and area of blood vessels in H&E sections from the control, OTW, and OTH groups. The blood vessel count was conducted at five randomly selected fields in every fifth section of each tissue sample. Moreover, we used Image J software to measure the diameter and area of the vessels. 24

2.4. Immunohistochemistry studies

The tissue samples underwent immunohistochemical analysis using antibodies against CD31 to assess angiogenesis. 25 The formalin‐fixed paraffin‐embedded tissue sections were placed on poly‐l‐lysine‐coated slides, and endogenous peroxidase was inhibited by incubating with 10% hydrogen peroxide in phosphate‐buffered saline (PBS) for 10 min after deparaffinization. Heat antigen retrieval was achieved by heating the tissue sections at 95°C with sodium citrate buffer (10 mM, pH 6) for 30 min. After having washed with PBS, the sections were incubated with anti‐CD31 (ab28364, Abcam, USA) for 50 min at room temperature (RT). The slides were washed twice in PBS and immersed with secondary antibodies Anti‐CD31 (ab97051, Abcam) for 45 min at RT. After the slides were washed twice in PBS, the sections were incubated with the chromogen 3,3′‐diaminobenzidine for 10 min at RT and washed with tap water. Mayer's hematoxylin dye was employed to stain the nuclei. The slides were mounted and examined under a light microscope.

2.5. Analysis of fibrosis and necrosis

The H&E‐stained sections were also used to observe the fibrotic and necrotic regions in different xenotransplanted tissues. The fibrotic regions were recognized by reduced cell density, fewer cell nuclei, and the buildup of collagen, and the necrotic regions were characterized by condensed nuclei and stromal cells showing signs of cellular breakdown, such as residual cell fragments and empty cytoplasmic spaces. Additionally, to show the fibrotic areas, Mason's trichrome staining confirmed the presence of collagen in blue. 26

2.6. Gene expression analysis

To explore angiogenesis, Vegf gene expression was examined across different groups. Total RNA was extracted using the column method (Biotchrabbit, Germany), and reverse transcription was performed using a cDNA synthesis kit (Add Script, Korea). Amplification was conducted in an Azure Cielo system (USA) using SYBR Green Real‐Time PCR master mix and the following primers: forward: AGGGCAGAATCATCACGAAGT, reverse: AGGGTCTCGATTGGATGGCA, along with 50 ng of cDNA. The analysis included three to five independent biological replicates with two technical repeats, normalizing Ct values to GAPDH expression and using a standard curve for 2^‐Ct calculations. 27

2.7. Statistical analysis

Statistical analysis was performed using SPSS 11 for Windows software (version 16). The normality of parameters was tested using the Kolmogorov–Smirnov test. The nonparametric Kruskal–Wallis test, followed by Dunn's multiple comparisons tests, was applied for the follicular count. The vessel counts, diameter, areas, and necrosis area percentage were analyzed using one‐way analysis of variance (ANOVA) followed by Tukey's test. The significance of the difference was determined at p < 0.05. Data were reported as mean ± standard error of the mean (SEM).

3. RESULTS

3.1. Revascularizations and angiogenesis of human ovarian grafts

The OTH group had a significantly (p < 0.0133, p < 0.0001) greater number of blood vessels than both the OTW and control groups, and the OTW group also demonstrated a significant increase (p < 0.0026) over the control group, as shown in Figure 1A. However, for diameter and area of the blood vessels, no significant differences were found among the groups, as shown in Figure 1B,C.

FIGURE 1.

FIGURE 1

Open in a new tab

Angiogenesis and fibrotic necrosis surface in three different groups. (A) Mean number of vessels, (B) vessel diameters (μm), (C) vessel area (µm2), and (D) fibrotic and necrosis surface percentage. Comparing the grafted groups to the control group. To determine statistical significance, we considered a threshold of p < 0.05. Data were presented as mean ± SEM (standard error of the mean). In the graph A) *p < 0.0133, **p < 0.0026, ****p < .0001. and in D) * p < 0.0433, **p < 0.0029.

3.2. Immunohistology staining for CD31

The qualitative analysis of the CD31 marker was used to observe blood vessel formation and tissue blood supply after xenotransplantation. The results showed successful blood vessel formation in the OT, OTW, and OTH groups 7 days after transplantation (Figure 2A–C).

FIGURE 2.

FIGURE 2

Open in a new tab

Qualitative analysis of immunohistochemical staining of the CD31 marker. The CD31 marker was used to observe blood vessel formation and tissue blood supply in different groups: (A) control group, (B) OTW (ovarian tissue transplantation in Wistar rat) group, and (C) OTH (ovarian tissue transplantation in hooded rat) group. The arrows indicate the vessels. Scale bar: 20 μm.

3.3. Stromal tissue necrosis and fibrosis

The analysis of fibrosis and necrosis areas revealed that the OTW group exhibited the highest levels (p < 0.0029) of tissue fibrosis, significantly more than the OTH group. In contrast, the OTH group exhibited the lowest levels (p < 0.0026, p < 0.0433) of both tissue fibrosis and necrosis (see Figures 1D and 3A–C).

FIGURE 3.

FIGURE 3

Open in a new tab

The quantitative analysis of Masson's trichrome staining. The presence of fibrosis/necrosis is a common issue observed in all transplant groups after tissue transplantation. (A) Control group, (B) OTW (ovarian tissue transplantation in Wistar rat) group, and (C) OTH (ovarian tissue transplantation in hooded rat) group. The arrows indicate collagen deposition. Circles denote areas of fibrosis and necrosis, characterized by compacted nuclei, collagen accumulation, and reduced cell density. Scale bar: 100 μm.

3.4. Quantitative gene expression

To assess the level of angiogenesis in the transplanted tissues, the expression of the Vegf gene was analyzed. The results indicated a higher expression level (p < 0.0001) of this gene in the OTH and OTW groups compared to the control. The expression of the Vegf gene was significantly enhanced (p < 0.0001) in the OTH group compared to the OTW and control groups (Figure 4).

FIGURE 4.

FIGURE 4

Open in a new tab

The gene expression in three different groups. Vegf gene expression across these groups. To determine statistical significance, we considered a threshold of p < 0.05. The Vegf gene was significantly enhanced (p < 0.0001) in the OTH (ovarian tissue transplantation in hooded rat) group compared to the OTW (ovarian tissue transplantation in Wistar rat) and control groups. Data were presented as mean percentages ± SEM (standard error of the mean). ****p < 0.0001.

4. DISCUSSION

The recurrence of cancer is considered a primary risk of treating infertility and performing OT transplantation in patients. To mitigate this risk, experts have implemented various strategies, such as xenograft transplantation. 4 This study was the first to select the optimal option for OT xenotransplantation and to increase the likelihood of its success.

Evaluation of angiogenesis and histology provides insights into tissue health posttransplantation.

In this study, we observed that the number of blood vessels in the OTH group, which received OT transplants in hooded rats, was significantly higher than that in the other groups. This finding indicates a significant increase in angiogenesis within the OTH group. In 2011, Soleimani et al. successfully enhanced angiogenesis and reduced tissue ischemia by transplanting human OT xenografts into SCID mice, using sphingosine‐1‐phosphate (S1P) as both an angiogenesis‐promoting agent and an antiapoptotic drug shortly after transplantation. 28 Unlike the aforementioned study, which was conducted using SCID mice, our research demonstrated an increase in angiogenesis through OT transplantation in hooded rats.

A recent study investigated the effects of mesenchymal stem cells (MSC) on blood vessel formation and the survival of ovarian follicles using human OT transplanted into SCID mice. This subcutaneous procedure lasted 1 week and significantly improved vascularization and follicle survival. 29 Similarly, our findings demonstrated a significant enhancement in angiogenesis in the OTH groups that received the transplanted OT within the same 1‐week period in the back neck muscle.

In a 2019 study by Manavella et al., researchers found that transplanting human OT along with adipose‐derived stem cells (ASC) into SCID mice for a week significantly improved vascularization of the transplanted tissues. This enhancement is thought to result from the growth factors secreted by the ASCs, as well as their ability to differentiate into endothelial cells. 30 The findings align with those observed in the OTH group, suggesting that manual immunosuppression in hooded rats may play a key role in fostering better compatibility between the transplanted tissues and the host. This compatibility likely explains why there is a lower rate of tissue rejection in the OTH compared to the OTW strain.

Building upon previous research by Damous which found that thawed and frozen rat OTs autografted into Wistar rats alongside ASCs exhibited increased expression of genes related to apoptosis and inflammation but still maintained tissue viability, our study extends these findings to human OT transplantation. 31 We transplanted human OT into both Wistar and hooded rat models. Particularly, in the hooded rat group, the transplanted tissue remained healthier and exhibited less necrosis, even without additional treatments. This suggests that hooded rats may have a more adaptable immune response compared to Wistar rats. Additionally, unlike the previous study, we observed a significant increase in Vegf gene expression in the hooded rats, indicating enhanced angiogenic activity and improved vascularization. These results underscore the differences in immune and regenerative responses between rat strains and suggest that hooded rats could serve as a more suitable model for human OT transplantation, due to their superior capacity for tissue integration and vascular development.

Another study conducted by Cheng and colleagues in 2020 involved transplanting human OT fragments combined with human umbilical cord stem cells (HUC MSC) into nude mice. The findings demonstrated a significant reduction in apoptosis within these transplants, along with elevated levels of angiogenic markers such as CD31, CD34, and VEGF. 32

HUC MSCs present unique advantages over other MSCs, such as their ability to activate the immune system mildly due to low expression of human white blood cell antigens, especially Major Histocompatibility Complex I (MHC I), and the absence of Major Histocompatibility Complex II (MHC II) expression. They inhibit the proliferation of immune cells, promote the development of anti‐inflammatory macrophages, and secrete interleukin‐4 and interleukin‐10, which help reduce inflammation while supporting tissue repair. 33 Moreover, HUC MSCs exhibit anti‐inflammatory properties by inhibiting the secretion of interleukin β1, TNF‐α, and γ interleukin, thereby alleviating inflammation and reducing oxidative stress levels, which can lead to cellular apoptosis. Their role in repairing damaged ovarian function and tissue is further reinforced by their secretion of various paracrine molecules and growth factors such as VEGF, transforming growth factor beta (TGFβ), hepatocyte growth factor (HGF), and placental growth factor (PGF). 34

These improvements, namely decreased cell death and increased angiogenesis, were attributed to the presence of stem cells alongside human OT in the nude mouse model. Consistent with the aforementioned research, our observations revealed enhanced angiogenesis and higher Vegf expression in human OT transplants within the hooded strain. Additionally, there was a significant decrease in necrosis and tissue degeneration, even without external interventions, highlighting the effectiveness of this transplant model and the suitability of the hooded strain as a host for such procedures.

The pattern of fibrosis observed in stromal cells shortly after transplantation closely resembles the changes seen during the freezing process and the subsequent ischemic conditions. 35 This fibrosis in stromal cells is likely a consequence of ischemia–reperfusion injury. Furthermore, Callejo et al. reported a significant presence of cortical fibrosis in Lewis rats after the transplantation of fresh OT. 36 This detrimental process is likely associated with ischemic stress and the time required for angiogenesis, or the formation of new blood vessels, to occur after transplantation. 37 , 38

In our study, we found that the level of stromal fibrosis in the OT was higher in the OTW group compared to the other groups. In contrast, the OTH group exhibited significantly lower levels of fibrosis than the OTW and control groups. This suggests that the hooded strain may have enhanced angiogenesis and better blood supply to the tissues. These benefits could stem from effective tissue acceptance and communication, likely due to the hooded strain's well‐adapted immune system. In contrast, the Wistar rats did not demonstrate this level of adaptation. Our findings regarding the Wistar rats align with the study conducted by Callejo and colleagues, who performed transplants in Lewis rats.

One of the critical aspects highlighted in transplantation research is the selection of the transplantation site. Evidence from previous studies indicates that choosing the optimal location for transplantation can significantly enhance the revascularization of OT, thereby mitigating the adverse effects of prolonged ischemia after the procedure. This improvement is essential for preventing additional damage to the ovaries. 35 , 36 , 39

In the C‐Dath study, the intramuscular site exhibited the least amount of fibrosis among the various transplantation sites assessed after 3 weeks. This finding suggests that this location provided the most effective blood supply to the graft. By examining the vascular and angiogenic processes within grafts, we can gain valuable insights into the interplay between fibrosis and angiogenesis, especially concerning the selected transplantation site. 26

Our group's findings, which focus on the muscle at the back of the animal's neck, support the previously mentioned results. However, it is important to note that this specific site may not be the only factor influencing attractiveness. Other factors, such as the strain of the host and the condition of its immune system, could play a more significant role. In the OTH group, we observed a high density of blood vessels and significant angiogenesis. This enhanced oxygenation contributed to a reduction in detrimental factors, resulting in minimal fibrosis within the graft tissue. In contrast, the OT with lower vascularity (OTW group) experienced reduced oxygenation, an increase in harmful factors, and a corresponding rise in fibrosis.

5. CONCLUSION

The findings of this study suggest that hooded rats could be a valuable alternative for certain research tasks, especially when nude mice are not available. Their immune systems show a greater compatibility with human OT transplants than those of Wistar rats. Also, the hooded strain exhibits calmer behaviors than the Wistar strain, making it more suitable for laboratory work. Furthermore, this research lays the groundwork for future studies on organoid transplants using this strain, as well as genetic investigations to explore the mechanisms that contribute to the resilience of hooded rats compared to other rat strains.

AUTHOR CONTRIBUTIONS

Mohammad Ayoubipour: Conceptualization; data curation; formal analysis; funding acquisition; investigation; software; writing – review and editing. Hussein Eimani: Conceptualization; supervision; validation; visualization; writing – review and editing. Rouhollah Fathi: Data curation; project administration; writing – review and editing. Mohammad Kazemi Ashtiani: Investigation; validation. Ashraf Moinie: Methodology; project administration; resources. Parviz Golmohammadi Gerdkohi: Validation; visualization; writing – original draft.

FUNDING INFORMATION

This research was supported by the Royan Lotus Charity Foundation 1400/2450.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflicts of interest to disclose.

ETHICAL APPROVAL

We obtained ethical approval from the Royan Research Institute's ethics committee (IR.ACECR.ROYAN.REC.1400.038) to use human OT and laboratory animals. We obtained written consent from the transsexual patients who provided the OT.

CONSENT FOR PUBLICATION

Not applicable.

ACKNOWLEDGMENTS

We express our heartfelt gratitude to Mrs. Dr. Mozafari, the technical manager of Shafayab. This research received financial support from the Royan Lotus charity fund.

Ayoubipour M, Eimani H, Fathi R, Ashtiani MK, Moinie A, Gerdkohi PG. A comparative study of human ovarian tissue xenotransplantation in two different strains of rats. Anim Models Exp Med. 2025;8:1524‐1531. doi: 10.1002/ame2.70056

REFERENCES

  • 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin. 2018;68(1):7‐30. [DOI] [PubMed] [Google Scholar]
  • 2. Dolmans M‐M, Amorim CA. Fertility preservation: construction and use of artificial ovaries. Reproduction. 2019;158(5):F15‐F25. [DOI] [PubMed] [Google Scholar]
  • 3. Donfack N, Alves K, Araújo V, et al. Expectations and limitations of ovarian tissue transplantation. Zygote. 2017;25(4):391‐403. [DOI] [PubMed] [Google Scholar]
  • 4. Fathi R, Rezazadeh Valojerdi M, Salehnia M, Ebrahimi B, SalmanYazdi R. Ovarian tissue transplantation: advantages, disadvantages and upcoming challenges (a review article). J Mazandaran Univ Med Sci. 2014;24(113):253‐265. [Google Scholar]
  • 5. Hovatta O, Silye R, Krausz T, et al. Cryopreservation of human ovarian tissue using dimethylsulphoxide and propanediol‐sucrose as cryoprotectants. Hum Reprod. 1996;11(6):1268‐1272. [DOI] [PubMed] [Google Scholar]
  • 6. Bosma GC, Custer RP, Bosma MJ. A severe combined immunodeficiency mutation in the mouse. Nature. 1983;301(5900):527‐530. [DOI] [PubMed] [Google Scholar]
  • 7. Cacciottola L, Nguyen TYT, Chiti MC, et al. Long‐term advantages of ovarian reserve maintenance and follicle development using adipose tissue‐derived stem cells in ovarian tissue transplantation. J Clin Med. 2020;9(9):2980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Van Langendonckt A, Romeu L, Ambroise J, et al. Gene expression in human ovarian tissue after xenografting. Mol Hum Reprod. 2014;20(6):514‐525. [DOI] [PubMed] [Google Scholar]
  • 9. Agca C, Lucy MC, Agca Y. Gene expression profile of rat ovarian tissue following xenotransplantation into immune‐deficient mice. Reproduction. 2009;137(6):957‐967. [DOI] [PubMed] [Google Scholar]
  • 10. Fathi R, Valojerdi MR, Eimani H, et al. Sheep ovarian tissue vitrification by two different dehydration protocols and needle immersing methods. Cryo Letters. 2011;32(1):51‐56. [PubMed] [Google Scholar]
  • 11. Fathi R, Valojerdi MR, Salehnia M. Effects of different cryoprotectant combinations on primordial follicle survivability and apoptosis incidence after vitrification of whole rat ovary. Cryo Letters. 2013;34(3):228‐238. [PubMed] [Google Scholar]
  • 12. Thuwanut P, Leonel ECR, Rocha Ruiz TF, Sirayapiwat P, Kristensen SG, Amorim CA. Human ovarian tissue xenotransplantation: advancements, challenges, and future perspectives. Hum Reprod. 2025;40(3):410‐419. [DOI] [PubMed] [Google Scholar]
  • 13. Fransolet M, Henry L, Labied S, et al. Influence of mouse strain on ovarian tissue recovery after engraftment with angiogenic factor. J Ovarian Res. 2015;8:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Aubard Y. Ovarian tissue xenografting. Eur J Obstet Gynecol Reprod Biol. 2003;108(1):14‐18. [DOI] [PubMed] [Google Scholar]
  • 15. Custer RP, Bosma GC, Bosma MJ. Severe combined immunodeficiency (SCID) in the mouse. Pathology, reconstitution, neoplasms. Am J Pathol. 1985;120(3):464‐477. [PMC free article] [PubMed] [Google Scholar]
  • 16. Clemens LE, Jansson EK, Portal E, Riess O, Nguyen HP. A behavioral comparison of the common laboratory rat strains Lister Hooded, Lewis, Fischer 344 and Wistar in an automated homecage system. Genes Brain Behav. 2014;13(3):305‐321. [DOI] [PubMed] [Google Scholar]
  • 17. Takae S, Suzuki N. Current state and future possibilities of ovarian tissue transplantation. Reprod Med Biol. 2019;18(3):217‐224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wang L, Ying Y‐f, Ouyang Y‐l, Wang J‐f, Xu J. VEGF and bFGF increase survival of xenografted human ovarian tissue in an experimental rabbit model. J Assist Reprod Genet. 2013;30:1301‐1311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Tafti D, Fathi R, Tahaei L, et al. Vitrified xenograft survived human ovarian follicles using erythropoietin. J Gynecol Obstet Forecast. 2018;1(1):1‐3. [Google Scholar]
  • 20. Tahaei LS, Eimani H, Hajmusa G, et al. Follicle development of xenotransplanted sheep ovarian tissue into male and female immunodeficient rats. Int J Fertil Steril. 2015;9(3):354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bedaiwy MA, Shahin AY, Falcone T. Reproductive organ transplantation: advances and controversies. Fertil Steril. 2008;90(6):2031‐2055. [DOI] [PubMed] [Google Scholar]
  • 22. Zhao J, Ge Y, Li J, et al. Experimental study on the vitrification and xenotransplantation of human ovarian tissue. Gynecol Obstetr Clin Med. 2022;2(1):38‐42. [Google Scholar]
  • 23. Wall MA, Padmanabhan V, Shikanov A. Hormonal stimulation of human ovarian xenografts in mice: studying folliculogenesis, activation, and oocyte maturation. Endocrinology. 2020;161(12):bqaa194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Soleimani R, Heytens E, Van den Broecke R, et al. Xenotransplantation of cryopreserved human ovarian tissue into murine back muscle. Hum Reprod. 2010;25(6):1458‐1470. [DOI] [PubMed] [Google Scholar]
  • 25. Lee S, Ryu K‐J, Kim B, Kang D, Kim YY, Kim T. Comparison between slow freezing and vitrification for human ovarian tissue cryopreservation and xenotransplantation. Int J Mol Sci. 2019;20(13):3346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Dath C, Van Eyck A‐S, Dolmans M‐M, et al. Xenotransplantation of human ovarian tissue to nude mice: comparison between four grafting sites. Hum Reprod. 2010;25(7):1734‐1743. [DOI] [PubMed] [Google Scholar]
  • 27. Kawashima I, Kawamura K. Regulation of follicle growth through hormonal factors and mechanical cues mediated by Hippo signaling pathway. Syst Biol Reprod Med. 2018;64(1):3‐11. [DOI] [PubMed] [Google Scholar]
  • 28. Soleimani R, Heytens E, Oktay K. Enhancement of neoangiogenesis and follicle survival by sphingosine‐1‐phosphate in human ovarian tissue xenotransplants. PLoS One. 2011;6(4):e19475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zhang Y, Xia X, Yan J, et al. Mesenchymal stem cell‐derived angiogenin promotes primordial follicle survival and angiogenesis in transplanted human ovarian tissue. Reprod Biol Endocrinol. 2017;15(1):18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Manavella DD, Cacciottola L, Payen VL, Amorim CA, Donnez J, Dolmans MM. Adipose tissue‐derived stem cells boost vascularization in grafted ovarian tissue by growth factor secretion and differentiation into endothelial cell lineages. Mol Hum Reprod. 2019;25(4):184‐193. [DOI] [PubMed] [Google Scholar]
  • 31. Damous LL, Shiroma ME, Carvalho AETS, Soares‐Jr JM, Krieger JE, Baracat EC. Gene expression profile in experimental frozen‐thawed ovarian grafts treated with scaffold‐base delivery of adipose tissue‐derived stem cells. Clinics. 2022;77:100066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Cheng J, Ruan X, Li Y, et al. Effects of hypoxia‐preconditioned HucMSCs on neovascularization and follicle survival in frozen/thawed human ovarian cortex transplanted to immunodeficient mice. Stem Cell Res Ther. 2022;13(1):474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Liu Y, Mu R, Wang S, et al. Therapeutic potential of human umbilical cord mesenchymal stem cells in the treatment of rheumatoid arthritis. Arthritis Res Ther. 2010;12:1‐13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Abd‐Allah SH, Shalaby SM, Pasha HF, et al. Mechanistic action of mesenchymal stem cell injection in the treatment of chemically induced ovarian failure in rabbits. Cytotherapy. 2013;15(1):64‐75. [DOI] [PubMed] [Google Scholar]
  • 35. Nisolle M, Casanas‐Roux F, Qu J, Motta P, Donnez J. Histologic and ultrastructural evaluation of fresh and frozen‐thawed human ovarian xenografts in nude mice. Fertil Steril. 2000;74(1):122‐129. [DOI] [PubMed] [Google Scholar]
  • 36. Callejo J, Vilaseca S, Ordi J, Cabré S, Lailla JM, Balasch J. Heterotopic ovarian transplantation without vascular pedicle in syngeneic Lewis rats: long‐term evaluation of effects on ovarian structure and function. Fertil Steril. 2002;77(2):396‐402. [DOI] [PubMed] [Google Scholar]
  • 37. Kim SS, Yang HW, Kang HG, et al. Quantitative assessment of ischemic tissue damage in ovarian cortical tissue with or without antioxidant (ascorbic acid) treatment. Fertil Steril. 2004;82(3):679‐685. [DOI] [PubMed] [Google Scholar]
  • 38. Van Eyck A‐S, Jordan BF, Gallez B, Heilier J‐F, Van Langendonckt A, Donnez J. Electron paramagnetic resonance as a tool to evaluate human ovarian tissue reoxygenation after xenografting. Fertil Steril. 2009;92(1):374‐381. [DOI] [PubMed] [Google Scholar]
  • 39. Israely T, Nevo N, Harmelin A, Neeman M, Tsafriri A. Reducing ischaemic damage in rodent ovarian xenografts transplanted into granulation tissue. Hum Reprod. 2006;21(6):1368‐1379. [DOI] [PubMed] [Google Scholar]

Articles from Animal Models and Experimental Medicine are provided here courtesy of Wiley

RESOURCES