Cistanche tubulosa improves peripheral neuropathy in MPTP‐induced PD mice based on regulation of m6A methylation

Yatan Li; Wei Jia; Junhua Hu; Borui Zhang; Xinxin Qi; Jianhua Yang; Xinling Yang

doi:10.1002/ame2.70039

. 2025 Jul 11;8(8):1441–1455. doi: 10.1002/ame2.70039

Cistanche tubulosa improves peripheral neuropathy in MPTP‐induced PD mice based on regulation of m6A methylation

Yatan Li ¹, Wei Jia ², Junhua Hu ¹, Borui Zhang ¹, Xinxin Qi ³, Jianhua Yang ⁴, Xinling Yang ^3,^✉

PMCID: PMC12464879 PMID: 40641367

Abstract

Background

This study aimed to discover whether Cistanche tubulosa affects the AKT/CASP3 pathway by regulating m6A methylation, to exert a protective effect against peripheral nerve injury in a Parkinson's Disease (PD) mouse model.

Methods

In this study, network pharmacology analysis and the molecular docking virtual screening technique was used to filter Acteoside (Act), a potential neuroprotective agent of active components in Cistanche tubulosa. A PD‐related peripheral neuropathy mouse model was established by MPTP induction, followed by 21 days treatment of oral Act (25, 50, and 100 mg kg⁻¹). Pole climbing, automatic avoidance ability and hot plate sensory tests were evaluated to determine behavioral changes caused by central and peripheral nerve injury. The pathological alterations of dorsal root ganglion tissue and the protein levels of IL‐6, AKT, and CASP3 under Act intervention, as well as the dynamic changes of FTO, METTL3, and YTHDF2 which are closely related to m6A methylation, were comprehensively analyzed to observe the peripheral nerve protective efficacy of Act.

Results

The results showed that peripheral neuropathy occurring with PD in the mouse model, which could be verified by behavioral tests and pathological histological changes. In addition to the previously established protective effect of Act on dopaminergic neurons in substantia nigra (SN), extensive follow‐up studies demonstrated that Act effectively induced m6A methylation, which could further regulate the AKT/CASP3 pathway to play a therapeutic role. In this study, medium and high doses of Act played more obvious therapeutic roles.

Conclusion

These findings suggest that Act may regulate the severity of peripheral nerve injury under the activation of the AKT/CASP3 signaling pathway by balancing the methylation level of m6A. These results provide a theoretical basis and experimental evidence for further research on the protective effect of Cistanche tubulosa on both the central and peripheral nerves in the treatment of PD.

Keywords: Cistanche tubulosa, m6A methylation, Parkinson's disease, peripheral neuropathy

At steady state, DRG ensures low‐level expression of TH+ neurons under the protection of AKT. However, the DRG level of PD mouse model under MPTP toxicity increased significantly, and the expression of IL‐6 and CASP3 increased. This process was accompanied by the occurrence of m6A demethylation, with a significant increase in FTO as the main manifestation and a decrease in METTL3 and YTHDF2. The oral therapeutic effect of Act showed a trend of toxic reactions above returning to a steady state in this experiment.

graphic file with name AME2-8-1441-g008.jpg

1. INTRODUCTION

Parkinson's Disease (PD) results in progressive neurodegeneration associated with injury to dopaminergic neurons and deposition of aggregated α‐synuclein. In the course of PD, the pathology begins in the peripheral nerves, and the resulting damage affects the central and peripheral nervous systems in a vicious cycle. ¹ Novel biomarkers for preclinical PD need to be developed and potential drug treatments for PD are still being explored. ² Both the motor dysfunction and non‐motor features of PD provide important clues about the tight relationship between the CNS and the peripheral neuropathy (PN) in the underlying disease pathogenesis. ³ The main drug intervention for PD is levodopa but it is not an ideal medication due to adverse effects of the drug on motor function. While treatment for PN currently employs drugs to relieve or nourish peripheral nerves, such as mecobalamin, duloxetine or gabapentin, ⁴ there is an urgent need for a drug that can both treat dopaminergic neurons and protect peripheral nerves. Growing evidence suggests a key role for m6A methylation in CNS and PN. Inhibition of m6A demethylase can inhibit axon regeneration and stabilize neuronal activity. ⁵ Epitranscriptomics suggests that m6A methylation plays a role in regulating the mRNA life cycle and neural development in both central and peripheral nerve damage in mammals. ⁶ , ⁷ On the other hand, changes in gene expression in dorsal root ganglia (DRG) induced by nerve injury are crucial for the degeneration of CNS and PN. This indicates that DRG is an important substance for connecting neural circuits. ⁸

Our previous studies showed that Cistanche tubulosa (CT) plays a role in slowing cognitive dysfunction in MPTP‐induced PD mice through the IL‐6/JAK2/STAT3 pathway, and alleviates the effects of ischemic stroke‐induced blood–brain barrier damage (Figure S1). ⁹ , ¹⁰ The downregulation of PI3K and AKT expression can be seen in our preliminary results from mouse liver fibrosis tissue. ¹¹ In the MPTP‐induced PD model, the morphology of the mitochondrial structure and chromatin of dopaminergic neurons in substantia nigra (SN) was protected by Acteoside (Act), which is one of the main effective compounds extracted from CT. Act has also been shown to be an effective regulator of the protein expression of Nrf2, HO‐1 and GPX4. ¹² These preliminary studies provided the motivation for us to further study whether Act can work on PN injury in the PD model.

Based on multiple studies of the effects of CT extract on neurodegeneration, our current research aimed to establish an MPTP‐mediated PD‐related peripheral neuropathy mouse model (PDPN model), and focus on the critical protective role of CT extract both in CNS and PN in motor and non‐motor function, potentially providing valuable therapy for PD patients for peripheral nerve impairment in the future, and protection against further neurodegeneration.

2. MATERIALS AND METHODS

2.1. Screening of active compounds in CT for PD‐related peripheral nerve impairment

2.1.1. Network pharmacologic analysis of CT extracts

The chemical composition of CT was provided by a traditional Chinese medicine bioinformatics evaluation tool (http://bionet.ncpsb.org/batman‐tcm/) (Figure S1). The proteins of Cistanch species identified with high reliability (score cutoff = 20, adjusted p‐value = 0.05) were chosen as key targets. The gene names which related to the drug's active ingredients were collected only after importing all targets into the UniProt database and filtering out non‐human ones. Disease‐related target genes were identified using the NCBI Gene (https://www.ncbi.nlm.nih.gov/gene/), GeneCards (https://www.genecards.org/), DrugBank (https://go.drugbank.com/), OMIM (https://omim.org/), TTD (http://db.idrblab.net/ttd/) and CTD (http://ctdbase.org/) databases using the terms “parkinson” or “peripheral neuropathy”, and “data score≥ 20”. The STRING database (https://string‐db.org/) was used to analyze protein–protein interactions (PPIs) between the target genes and the drugs involved in the drug‐disease interaction. Genes with a betweenness or closeness centrality higher than the median in each category were chosen as primary targets. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed using DAVID, a web‐based analysis tool.

2.1.2. Molecular docking analysis for the key targets

The active compounds in CT extracts were subjected to virtual molecular docking with key targets in m6A methylate modification, included Acteoside and Echinacoside. The SDF format of the molecular structure of the compounds was obtained from the PubChem database, and the protein crystal structure was obtained from the RCSB protein database (https://www.rcsb.org/). Protein water molecules were removed by PyMOL and hydrogen was added using AutoDockTools (V1.5.6). Molecular docking and scoring of compounds with different crystal structure proteins were achieved using AutoDock Vina. ¹³ The visualization processing was performed using Pymol software.

2.2. Animals and experimental design

2.2.1. Animals

Sixty‐three 8‐week‐old C57BL/6 male mice were purchased from the Animal Experiment Center of Xinjiang Medical University. The mice were maintained in a pathogen‐free environment at a room temperature of 22°C and relative humidity of (55 ± 5)%, with a 12 h alternating light/dark cycle and free access to food and water for 7 days. The mice were randomly divided into 7 groups (n = 9/group). There were no significant differences between groups based on the weight of the mice and their pole test results. All experiments were reviewed and permitted by the Experimental Animal Ethics Committee of Xinjiang Medical University (animal certification and SPF environment use license numbers were SCXK(Xin)2023‐0001 and SYXK(Xin)2023‐0004).

2.2.2. PDPN model

Employing canonical modeling methods, 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP) (30 mg/kg, Selleck, USA) was administrated intraperitoneally once a day for 7 days consecutively to make the subacute PDPN mouse models for this study. Mice injected 0.9% NaCl in the same way for 7 days provided control groups. ¹⁴

2.3. Drug treatment

After 7 days of adaptive feeding after MPTP treatment, the mice were randomly divided into 7 groups (n = 9/group) designated: normal control group (NC), MPTP model group (M), MPTP + 25 mg·kg⁻¹ Act group (LA), MPTP + 50 mg·kg⁻¹ Act group (MA), MPTP + 100 mg·kg⁻¹ Act group (HA), ¹⁵ MPTP + 125 mg·kg⁻¹ Levodopa group (D), ¹⁶ MPTP + 20 mg·kg⁻¹ Mecobalamin group (J), ¹⁷ respectively. Based on dosages in previous studies, the three dosages of Act were administered intragastrically once daily for 21 days to the respective groups. ¹⁰ , ¹⁵ The same drug schedule was used for the L and J groups.

2.4. Ethology assessment

To demonstrate the alterations to the motor and non‐motor behaviors of each mouse group, the pole test, shuttle box test and hot plate test were used.

Pole test: A pole 9 mm in diameter and 50 cm high was used to assess mouse locomotor function or dysfunction. Before the actual test, mice were trained for 3 consecutive days and each training session consisted of 3 test trials. In the actual test, the mice were placed at the top of pole facing head‐up, and the time taken for the forepaws to turn and reach the bottom was recorded. The maximum time allowed was 60s. ¹⁸

Automatic avoidance experiment: The shuttle box test was performed after the mice had been given 5 days dark‐room training. Under training conditions, after adapting to the chamber environment for 10s, the responses of the mice to photoelectric stimulation (photoacoustic stimulation for 10s and electric shock [0.3 mA, 50 Hz] for 2s) were measured. The frequency and response time of active avoidance by the mice were observed to assess the sensitivity capabilities of the mice. ¹⁹

Hot plate test: The thermal pain threshold of the mice was tested using a hot plate with a surface temperature maintained at 55°C. The withdrawal time started when the mouse was put on the plate and terminated when its forepaw grounded, with 60s set as a cutoff time to prevent limb damage. This test was repeated 3 times at 10‐min intervals, and the mean value was calculated. ²⁰

2.5. Tissue processing

Followed the behavioral tests, whole blood samples were obtained by cardiac puncture immediately after the mice were completely anesthetized with a 3% isoflurane/oxygen mixture. Serum for ELISA tests was collected by centrifugation at 1500 rpm for 20 min and stored at −80°C. Three DRGs from above lumbar vertebrae 3–5 (L3‐5) from each group were harvested and fixed in formalin for histological section tests, and the rest were collected for molecular biology tests.

2.6. Elisa assay

The levels of IL‐6 and α‐syn in the mice serum were measured by ELISA, performed using the relevant kits.

2.7. Light microscopic examination

DRG tissue sections 4 μm thick were deparaffinized, stained with H&E using routine procedures, and analyzed under a light microscope.

2.8. Transmission electron microscopy imaging of DRGs

DRG tissues were fixed in 2.5% glutaraldehyde and then 1% osmium tetraoxide, dehydrated in a graded series of ethanol concentrations and embedded in epoxy resin. Ultrathin sections (600 nm) were mounted on copper grids and then double‐stained with uranyl acetate and lead citrate. The sections were examined and photographed under a JEOL electron microscope (JEM1230 HC, JEOL, Japan), assessed at 15 000× and 30 000× magnification and images were collected for analysis.

2.9. Immunofluorescence (IF) staining analysis

Frozen optimal cutting temperature compound (OCT) Sections (9–10 μm) of mouse DRG tissues were prepared. IF staining was performed by incubating the samples overnight at 4°C using diluted primary antibodies for TH (1:200, TYH‐0020, Aves), FTO (1:200, bs‐7056R, Bioss), AKT (1:200, bsm‐52010R, Bioss), Caspase‐3 (1:200, bs‐0081R, Bioss), and IL‐6 (1:200, bs‐4539R, Bioss). Fluorescence‐conjugated secondary antibodies were used to detect fluorescent signals after counterstaining with DAPI (H‐1200, Vector, Burlingame, CA, USA). Frozen slides were scanned by a confocal laser scanning microscope (C2, Nikon, Japan). The red/green fluorescence intensity ratios were analyzed by ImageJ software V1.8.

2.10. Molecular biology assay

Western blot analysis was performed on the protein of lysates from the mouse DRG tissues. The lysate supernatants were collected after centrifugation. Proteins were separated by sodium dodecyl sulfate‐polyacrylamide gel electrophoresis, and blotted onto 0.45 μm PVDF membranes. The primary antibodies for AKT (1:1000, bsm‐52010R, Bioss), Caspase‐3 (1:1000, bs‐0081R, Bioss), FTO (1:1000, bs‐7056R, Bioss), METTL3 (1:1000, 15 073‐1‐AP, Proteintech), YTHDF2 (1:1000, AB246514, Abcam), and β‐actin (1:3000, bs‐0061R, Bioss) were used.

RNA isolation and qRT‐PCR was performed. The mRNA expression levels of m6A related FTO, YTHDF2 and METTL3, target pathway related AKT and Capase‐3 were detected by quantitative real‐time PCR. Total RNA was isolated from DRG tissues from mice of each group using the Trizol reagent (15596026, Invitrogen). The RNA purity was assessed by NanoDrop ND‐1000. The cDNA was conformed and qRT‐PCR was performed by using a RT‐qPCR Easy™‐ SYBR Green I kit (RT‐02111, FOREGENE). β‐Actin was used as an internal control. Each experiment was repeated 3 times and all data are presented as mean ± standard deviation (SD). Each primer sequence is showed in Table 1.

TABLE 1.

Primers used for qRT‐PCR tests.

Gene name	Sequence
β‐Actin (mouse)	F‐CTCCATCCTGGCCTCGCTGT
β‐Actin (mouse)	R‐GCTGTCACCTTCACCGTTCC
AKT (mouse)	F‐ATGAACGACGTAGCCATTGTG
AKT (mouse)	R‐TTGTAGCCAATAAAGGTGCCAT
Caspase‐3 (mouse)	F‐ATGGAGAACAACAAAACCTCAGT
Caspase‐3 (mouse)	R‐TTGCTCCCATGTATGGTCTTTAC
METTL3 (mouse)	F‐CTGGGCACTTGGATTTAAGGAA
METTL3 (mouse)	R‐TGAGAGGTGGTGTAGCAACTT
FTO (mouse)	F‐GACACTTGGCTTCCTTACCTG
FTO (mouse)	R‐CTCACCACGTCCCGAAACAA
YTHDF2 (mouse)	F‐ACAGTTACCCCTCGATGAGTG
YTHDF2 (mouse)	R‐GGTAGTGAGATACGGGATGGGA

Open in a new tab

2.11. Statistical analyses

SPSS 22.0 was used for data processing, and GraphPad Prism 9.00 software was used for analysis and interpretation of results. The measurement data were expressed as mean ± standard deviation (SD). Unpaired Student's t‐tests were used for comparisons between two groups and one‐way ANOVA was performed for multiple group comparisons and the LSD test for the difference between two groups. p‐values <0.05 were considered statistically significant, with p < 0.01, p < 0.001 and p < 0.0001 indicating high levels of significance.

3. RESULTS

3.1. Common targets in PD and PN of the active component of CT

3.1.1. Network pharmacologic analysis of CT medicinal ingredients effective against PD and PN

Network pharmacology identified the potential CT targets sharing genes with PD and PN, which provided assistance in narrowing the targets of this study (Figure 1). 52 and 45 targets were found to be shared by CT and PD and PN, respectively (Figure 1A,B). Based on our previous research, 7 main bioactive species have been confirmed. ¹⁵ The compounds were mainly focused on CASP3, AKT, HIF1, IL6, MMP9, TNF both in PD and PN. A PPI network compiled by STRING analysis showed the top 30 shared target cores. Clearly, strong associations between CT and PD focused on the PI3K/Akt Signaling Pathway, and the same closely relation existed between CT and PN (Figure 1C,D, left). The 20 top pathways were shown by KEGG analysis. The classical PI3K/AKT pathway, which our team has focused on in recent years, presented in the panels related to both PD and PN ²¹ (Figure 1C,D, right).

Network pharmacology analysis of *Cistanche tubulosa* in the treatment of Parkinson’ disease and peripheral neuropathy. (A, B) Venn diagram and network diagram of “component‐common target‐disease” of CT in the treatment of PD or PN. (C, D) PPI visualized network diagram of core targets for CT with PD (C left) and PN (D left), respectively. The node area in the figure represents degree value, and the connection thickness represents the combine score value. KEGG signal pathway enrichment analysis is shown for PD (C, right) and PN (D, right).

3.1.2. Act exhibits excellent binding to key targets of PD and PN

The previous study from our team showed the molecular system binding model for each component of CT. ¹⁵ To further study the role of m6A, autodock software was used to conduct molecular docking of Act with the key protein targets AKT, CASP3, IL‐6, METTL3, FTO and YTHDF2. The results were imported into Pymol software for visualization, and the molecular docking results are displayed as Figure 2. The binding energies are shown in Table 2. The binding energy between Act and each key protein were different, with AKT and FTO showing the most significant binding energy..

Different degrees of molecular docking of Acteoside with AKT, CASP3, IL‐6, METTL3, FTO and YTHDF2.

TABLE 2.

Binding energy between main active component and key protein targets.

Active ingredient	Key protein	Binging energy (kJ/mol)
Acteoside	AKT	−11.82
	CASP3	−4.09
	IL‐6	−5.52
	METTL3	−5.74
	FTO	−9.33
	YTHDF2	−6.56

Open in a new tab

3.2. Verification of the efficacy of Act against peripheral neuropathy in a PD mouse model

3.2.1. Framework of the mouse model and baseline experiments

Figure 3A is a schematic diagram of the experimental framework, including all details. The successful establishment of the PDPN model was confirmed by the results of central and peripheral sensory tests showing disrupted animal behavior (Figure 3B,C), and the IF images of the reduction of TH+ cells in the substantia nigra (Figure 3D), along with increased α‐syn (Figure 3E). Once the model was confirmed, drug interventions could be tested.

MPTP‐induced peripheral neuropathy in a PD mouse model. (A) Schematic diagram of the experimental framework. (B) Pole test results after MPTP toxicity induction. (C) Hot plate results after MPTP induction. (D) IF staining images of TH+ cells in SNpc; scale bar, 100 μm. Magnification: 10x. (E) Co‐staining images of TH+ cells (red), α‐syn (green) and DAPI (blue) in SNpc; scale bar, 50 μm. Magnification: 20x. Data are the mean ± SEM. *p < 0.05, ***p < 0.001 compared with NC group.

3.2.2. Act reduced the behavioral harm in seen in the PDPN mouse model

On the basis of ensuring that there was no statistical difference between each drug intervention group and the model group, the protective effect of Act on motor and non‐motor behavior disorders caused by PN in the PD mouse model was verified (Figure 3B,C). Different effects were seen among the different therapy groups. PDPN mice showed a bradykinesia in the pole test, and Act dose‐dependently restored their movement. The therapeutic effect seen in the D group was the same as that in the high dose Act group but differed from the effect in the J group (Figure 4A). Restored PN reactions were indicated by the data for sensitivity in the hot plate test and automatic avoidance in the shuttle box test. Act clearly alleviated PN, especially in the high dose group (p < 0.01), shown as more normal thermal or light/electric stimulated responses. The therapeutic effects of the J group treatment in the PDPN model were equally significant (p < 0.001) (Figure 4B–E).

Act reversed the behavioral disorders resulting from peripheral neuropathy in PD mice. (A) Total times in the pole test after Act therapy. (B) Paw withdrawal results in the hot plate test after Act therapy. (C) Times of successful shuttles after Act therapy. (D, E) Total immobility times after light and electrical stimulation. Data are the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 compared with NC group. ^# p < 0.05, ^## p < 0.01, ^### p < 0.001 compared with M group. ^◆ *p <* 0.05 compared with D group. ^▲ p < 0.05 compared with J group. (n = 6 or 7 mice per group).

3.2.3. Act corrected the histopathological changes in DRGs from the PDPN model

H&E staining assessment was used to judge morphological changes to DRGs from the PDPN model. The NC group showed a stable tissue morphology with complete nerve cells arranged in an orderly manner. Compared to the NC group, neuron arrangement became disordered in the M group along with narrow spaces between cells, and visible disorder of the nerve cell structure could be observed, which needs further evaluation. The pathological morphology of each Act treated group showed dose‐dependent improvement, with the cell arrangement gradually becoming normal. The integrity of DRGs in the D group were similar to that of the HA group but not the J group (Figure 5A).

Therapeutic effect of Act on DRG structure in peripheral neuropathy in the PD mouse model. (A) H&E staining of DRG tissue in each group (×400). Scale bar, 100 μm. (B) Therapeutic effect of Act on ultrastructural alterations in DRG cells in peripheral neuropathy in the PD mouse model (n = 3 mice per group). scale bar, 2 μm Magnification: 30 000x. The red arrow shows the cell nucleus, the green arrows show mitochondria, and the yellow arrows indicate vacuoles.

Morphological changes in DRG cells were further confirmed by transmission electron microscopy images of structural details. In NC group, neurons showed as large bodies with round nuclei, clear and intact nuclear membrane, rich euchromatin, obvious nucleoli, abundant cytoplasm and ribosome particles, and complete mitochondrial structure. In M group, the structure in the nucleus changed and the heterochromatin appeared to increase or aggregate into small clumps, distributed around the nuclear membrane, while the endoplasmic reticulum became swollen, accompanied by mitochondrial deformation. The matrix became sparse, most of the cliffs showed as blurred or even disappeared, and further vacuolar myelin sheaths appeared. The protective effect of Act was first manifested in the morphology of the nucleus and mitochondria in the low‐concentration group, and neurons with damaged cell bodies began to recover. In the medium‐dose group, in addition to more complete mitochondrial morphology, the endoplasmic reticulum was restored to its normal lamellar arrangement, and the cell body became larger and healthier. These recovery states were clearer and more specific in the high‐dose group. It could be seen that the two positive control groups also recovered to a certain extent under the action of the drugs (Figure 5B).

3.2.4. Act regulated the AKT/CASP3 pathway by reducing the expression of FTO and IL‐6

Following preliminary research on the target signaling pathways of Act, IF co‐staining was conducted to demonstrate a connecting role of Act on m6A and the AKT/CASP3 pathway in each group.

Model mice showed simultaneous overexpression of TH+ and IL‐6 in DRGs (p < 0.0001, p < 0.01), and TH+ cells showed some rearrangement localized in the neuronal membrane (Figure 6A,B). Total suppression of AKT was visible along with simultaneous FTO upregulation when CASP3 increased (p < 0.0001). ²² A marked protection of TH+ cells was achieved in the HA and J groups (p < 0.0001), while the D group showed a slight reversal effect (p < 0.001). However, similar effects were seen in images co‐stained for FTO‐ or AKT‐ with CASP3 in these three groups, shown as a considerable accumulation of AKT accompanying by a reduction of FTO and CASP3 (Figure 6C–E). These results further supported a connection between FTO expression and the AKT/CASP3 pathway.

Immunofluorescence staining of key proteins. (A, B) Staining and quantification of TH and IL‐6. Magnification: 40x. (C–E) Staining and quantification of FTO/CASP3 and AKT/CASP3. Magnification: 40x. All data are presented as mean ± SD (n = 3 mice per group). Scale bar, 20 μm. Data are the mean ± SEM. **p < 0.01, ***p < 0.001, ****p < 0.0001 compared with NC group. ^# p < 0.05, ^### p < 0.001, ^#### p < 0.0001 compared with M group (n = 3 mice per group). ^◆◆ p < 0.01 compared with D group.

3.2.5. Act exerted a therapeutic effect on PDPN model mice by influencing m6A modification to regulate the level of AKT/CASP3 signaling

Based on the results of the co‐staining images, tests for target protein expression further demonstrated the hypothesis by molecular biological methods.

Firstly, the levels of α‐syn and IL‐6 in peripheral blood were assessed by ELISA assay, and reflected the consistent elevation of both proteins in model mice (p < 0.001). The protective role of Act was most prominently reflected in the HA and D groups (p < 0.001), but in the J group there was almost no inhibitory effect on them both; this result also showed the same trend as the IF image results (Figure 7A). The expression results of AKT, Caspase‐3, FTO, METTL3 and YTHDF2 in DRG tissues also showed the same trends in the WB experiment (Figure 7B and Table S1). In this study, the toxic effect of MPTP inhibited the expression of AKT while upregulating CASP3 in DRGs (p < 0.001), and Act treatment elevated AKT and reduced CASP3, and this effect was most markedly seen in the reduction in levels of CASP3 (p < 0.001). Among the positive control groups, the D group showed a similar tendency to the HA group. The therapeutic effect in the J group was possibly related to the regulation of CASP3 and METTL3.

Act inhibited the activation of the AKT/CASP3 pathway by regulating m6A methylation. (A) Serum concentration of α‐syn and IL‐6 determined by ELISA. (B) and (C) Western blot and qRT‐PCR assays for the levels of AKT, CASP3, FTO, METTL3 and YTHDF2. Data are the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 compared with NC group. ^## p < 0.01, ^### p < 0.001 compared with M group (n = 6 mice per group).

Based on the RT‐qPCR results, the mRNA levels of CASP3 and FTO in the DRGs of the model mice were found to be significantly increased along with reductions of AKT, METTL3 and YTHDF2 (p < 0.001), while in the Act‐treated groups they were significantly regulated and showed dose‐dependence (p < 0.001). The results showed that the AKT/CASP3 pathway was activated in DRGs after MPTP induction, and this happened simultaneously with m6A regulation. The D group, which was also a positive control group, showed a more ideal treatment result than the J group (p < 0.001) (Figure 7C and Table S2).

4. DISCUSSION

To date, there is no effective clinical drug that can reverse or prevent the progression of PD, and peripheral nerve involvement is increasingly recognized as being part of PD. ²³ Levodopa is a well‐known common therapeutic drug for PD but a decrease in patient compliance is often seen because of adverse reactions such as vitamin B12 reduction and depression, as well as its unsatisfactory long‐term effects on PD. ²⁴ Therefore, development of a drug that can both control PD and prevent PN is a common goal for researchers. As a national neuroscience center, our medical institution had previously verified that PN is an important issue that PD patients cannot ignore, with an incidence rate of 62% to 86%. This result is consistent with current domestic and international research results. In addition, the incidence of PN may be underestimated due to the duration of the disease, assessment tools, the prodromal nature of symptoms, and the induction effect of levodopa. ²⁵ , ²⁶ , ²⁷ Our research team's preliminary results have verified that CT has a preventive and therapeutic effect on PD and IS models. Existing studies suggest that m6A methylation plays a key role in CNS and PN. Therefore, this study aimed to further explore the protective effect of Act on the PDPN model under the regulation of m6A modification, because it has been reported that m6A methylation may play a protective role in the nervous system by participating in cell activation, axon guidance pathway and calcium signaling pathway. ⁶ , ⁷

4.1. PN exists in the development of PD

This study used the MPTP‐induced model to verify using behavioral tests and IF images that PD mice also show PN, demonstrating what we have noticed clinically. In real‐world studies, the occurrence of PN may be related tightly to PD disease progression itself and the cumulative dose of levodopa. Patients need to undergo nerve conduction and sympathetic skin tests to make a diagnosis. The symptoms of PN, including large and small fiber polyneuropathy, can be clearly identified at an early stage. ²⁸ The behavioral tests in this project included a pole test to verify CNS injury, ¹⁴ a thermal pain test, and a photoelectric response test to identify changes in peripheral sensation. Assessing the motor coordination ability of mice through the pole test has become an important behavioral identification method in Parkinson's disease mouse experiments. The hot plate and photoelectric reaction experiments are better in combination to test peripheral nerve injury in mice. These methods can fully mimic the symptoms and measurement of PN in patients. Our drug intervention experiments suggested that medium and high doses of Act, particularly the high dose, induced some recovery in each behavioral test of central and peripheral injury in the mouse model. In these experiments, we specifically wanted to know the protective effect of Act on the peripheral nerves of PD mice, and we saw that the protective effect mainly concentrated on the reduction of thermal pain reaction time (thermal hyperalgesia) and the reduction of nerve responsiveness after photoelectric stimulation (mechanical hyperalgesia or retardation), both of which reflect common symptoms of neuropathic injury. After determining these behavioral changes, because the release of inflammatory factors in the body can reduce the threshold of peripheral nociceptors and enhance thermal pain response through nerve remodeling after peripheral nerve injury, we also measured IL‐6 levels in the mice. ²⁹ , ³⁰ High expression of IL‐6 in peripheral blood not only indicated the progression of central nervous system inflammation, but was also closely related to the development of peripheral neuropathy. ³¹ In this study, an IL‐6 marker was used as the inflammation‐related factor connecting m6A methylation with activation of the AKT/CASP3 pathway in the development of neuroinflammation. This result further supported recent research conclusions indicating that controlling the expression of FTO in m6A methylation plays an important role in stabilizing the expression level of IL‐6. ³² At the same time, METTL3 and YTHDF2 also showed some dynamic changes.

4.2. Act contributed to the reversal of PN in PD models

The protective effect of Act on the substantia nigra has been analyzed previously. ¹² Our research surprisingly found that Act could act as a treatment for PN. This result well compensated for the public concern over the complication of peripheral nerve injury in PD. In our behavioral experiments, the results of pole test, the hot plate test and the shuttle box test showed that Act had a therapeutic effect close to that of levodopa. The automatic avoidance experiment tested the response to light or electricity, demonstrating that both Act and Mecobalamin were better than levodopa in this PN test. Overall, the protective effect of Act on the central/peripheral nerves combined the advantages of levodopa and Mecobalamin.

Cell morphology and molecular biology tests gave further support to the conjecture raised by molecular docking analysis and the outcomes of in vivo tests. The results provided evidence that the AKT/CASP3 pathway in DRGs was activated after MPTP induction, while Act exerted different effects on different targets. At the high dose, Act showed the most typical effect on AKT/CASP3 pathway, and this protection could be seen more intuitively through fluorescent stained sections and transmission electron microscopy images. Interestingly, we found that the most significant effect of Act was on activation of AKT, while showing that levodopa had relatively weak effects on inhibiting the levels of TH and IL6; however, levodopa was still the strongest inhibitor of CASP3. This may be the reason why, in the real world, patients always experience adverse reactions despite effective treatment with levodopa. The underlying mechanism of this therapeutic effect is likely due to the maintenance of mitochondrial function followed by fixation of neuronal morphology and expression; this conjecture has also been partially verified in a previous study. ¹⁵

4.3. Dynamic regulation of m6A methylation in the protective effect of Act

We have known for some time that FTO, METTL3, and YTHDF2 represent important roles in m6A methylation. ³³ FTO, as the “eraser”, plays a demethylase role in the pathogenesis of neurodegenerative diseases and can erase the m6A modification of RNA. METTL3 acts as a key reader and is essential for ensuring the complete activity of the methyltransferase complex in vivo. YTHDF2 interacts with the target domain through its N‐terminal region and accelerates the degradation of m6A‐modified transcripts. Through the efforts of these three “generals”, m6A methylation is guaranteed to be in a normal working state.

Because we established a composite model that includes the concepts of PD and PN, we need two positive control groups for drug efficacy comparison. Our positive control groups showed an interesting result. Obviously, levodopa had a greater effect than methylcobalamin on the regulation of m6A, which seemed to explain the different efficacy in ethology assessments. Focussing on DRGs in therapy groups, FTO was significantly inhibited, while METTL3 and YTHDF2 showed an upward trend. Remarkably, this result seemed to be different from the regulatory changes to m6A in malignant tumors. Overall, the effect of Act was closer to that of levodopa, and even better for certain targets.

In this study, we could combine the changes in IL‐6 expression throughout the experiments for analysis (Figure 8). The protein levels of P‐α‐synuclein (Ser129), α‐synuclein, PI3K, AKT, and IL‐6 were detected in SN in PD mice in our preliminary program. ³⁴ This experiment supplemented the evidence of IL‐6 overexpression in peripheral blood and DRGs. Act was shown to play an important role in suppressing IL‐6 levels while correcting motor and non‐motor dysfunction in a PDPN mouse model. Other scholars' research told us that IL‐6, whose mRNA transcript was subjected to METTL3‐mediated m6A modification, promoted METTL3 deacetylation and nuclear translocation, and induced whole m6A abundance. ³⁵ The expression of IL‐6 might relate closely to the METTL3‐METTL14/YTHDF2 axis. ³⁶

Schematic diagram of the regulatory effect of Act on m6A methylation in PDPN mice. At steady state, low‐level expression of TH+ neurons under the protection of AKT is maintained in DRGs. However, DRG levels in the PD mouse model under MPTP toxicity increased significantly, and the expression of IL‐6 and CASP3 increased. This process was accompanied by m6A demethylation, with a significant increase in FTO as the main manifestation and a decrease in METTL3 and YTHDF2. In our experiments, the therapeutic effect of orally administered Act showed a trend for these toxic reactions to return to a steady state.

These findings shed some light on the simultaneous protective effects of Act on central and peripheral nerves, and may provide a new option for promoting functional recovery after PD with PN. In future studies, we will continue to research other PD models such as gene knockout models to further explore the molecular mechanisms behind the neuroprotective effects of Act in order to provide more powerful evidence for this part of our conclusions.

5. CONCLUSION

We treated MPTP‐induced PD model mice with oral Act to determine the therapeutic effect of the drug, using the same dosage as has been routinely used by our research group. The results showed that Act, the main medicinal ingredient of CT, not only reversed the dopaminergic neuropathy induced by MPTP in PD mice, but also prevented the motor and non‐motor dysfunction caused by peripheral nerve damage. Act played a role in balancing the m6A methylation level in DRGs, thereby activating AKT and downregulating the expression of CASP3. These results provide a good basis for further investigating the action of CT on peripheral nerves in order to treat PD effectively. However, one limitation of this study is that we only used a subacute PD model to provide evidence of the pharmacological effects of Act. In future studies, we will further strengthen our results using the asynPFF intraventricular injection model, which better simulates the chronic progression of PD. Another a key aspect in this study that needs further exploration is whether Act can reduce neuroinflammation by regulating m6A methylation thereby protecting mitochondrial function.

AUTHOR CONTRIBUTIONS

Yatan Li: Formal analysis; funding acquisition; resources. Wei Jia: Formal analysis; software. Junhua Hu: Investigation; resources. Borui Zhang: Software. Jianhua Yang: Supervision. Xinxin Qi: Data curation. Xinling Yang: Project administration; writing – review and editing.

FUNDING INFORMATION

The research was supported by the Xinjiang Uygur Autonomous Region Science and Technology Department‐ Tianshan Innovation Team Program Project (2023D14006); Xinjiang Uygur Autonomous Region Science and Technology Department‐ Natural Science Foundation (2023D01C115).

CONFLICT OF INTEREST STATEMENT

Yatan Li, Wei Jia, Junhua Hu, Borui Zhang, Xinxin Qi, Jianhua Yang and Xinling Yang declare that they have no any potential conflict of interest in relation to this work.

ETHICS STATEMENT

This study was conducted according to the guidelines of Animal Ethics Committee of Xinjiang Medical University (Approval Number: IAUCU‐20230228‐31).

CONSENT FOR PUBLICATION

The manuscript is approved by all authors for publication.

Supporting information

Figure S1.

AME2-8-1441-s003.docx^{(60.7KB, docx)}

Table S1.

AME2-8-1441-s001.docx^{(74KB, docx)}

Table S2.

AME2-8-1441-s002.docx^{(18.1KB, docx)}

ACKNOWLEDGMENTS

All authors contributed to the study conception and design. The authors thank Jianhua Yang for assisting in completing this work, and Junhua Hu and Borui Zhang, who performed the analysis. Thanks also Professor Yang for helping with the writing of the manuscript. Xinxin Qi shared the data of previous research. All authors read and approved the final manuscript.

Li Y, Jia W, Hu J, et al. Cistanche tubulosa improves peripheral neuropathy in MPTP‐induced PD mice based on regulation of m6A methylation. Anim Models Exp Med. 2025;8:1441‐1455. doi: 10.1002/ame2.70039

Yatan Li contributed to this work as the first author.

Xinling Yang contributed to this work as the corresponding author.

DATA AVAILABILITY STATEMENT

The datasets are available on reasonable request from the corresponding author.

REFERENCES

1. Morris HR, Spillantini MG, Sue CM, Williams‐Gray CH. The pathogenesis of Parkinson's disease. Lancet. 2024;403(10423):293‐304. doi: 10.1016/S0140-6736(23)01478-2 [DOI] [PubMed] [Google Scholar]
2. Tolosa E, Garrido A, Scholz SW, Poewe W. Challenges in the diagnosis of Parkinson's disease. Lancet Neurol. 2021;20(5):385‐397. doi: 10.1016/S1474-4422(21)00030-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Del Tredici K, Braak H. To stage, or not to stage. Curr Opin Neurobiol. 2020;61:10‐22. doi: 10.1016/j.conb.2019.11.008 [DOI] [PubMed] [Google Scholar]
4. Sommer C, Geber C, Young P, Forst R, Birklein F, Schoser B. Polyneuropathies. Dtsch Arztebl Int. 2018;115(6):83‐90. doi: 10.3238/arztebl.2018.083 [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Wang D, Zheng T, Zhou S, et al. Promoting axon regeneration by inhibiting RNA N6‐methyladenosine demethylase ALKBH5. Elife. 2023;12:e85309. doi: 10.7554/eLife.85309 [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Weng YL, Wang X, An R, et al. Epitranscriptomic m6A regulation of axon regeneration in the adult mammalian nervous system. Neuron. 2018;97(2):313‐325.e6. doi: 10.1016/j.neuron.2017.12.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Zhang L, Hao D, Ma P, et al. Epitranscriptomic analysis of m6A methylome after peripheral nerve injury. Front Genet. 2021;12:686000. doi: 10.3389/fgene.2021.686000 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Li Y, Guo X, Sun L, et al. N6‐Methyladenosine demethylase FTO contributes to neuropathic pain by stabilizing G9a expression in primary sensory neurons. Adv Sci (Weinh). 2020;7(13):1902402. doi: 10.1002/advs.201902402 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Yang X, Yv Q, Ye F, et al. Echinacoside protects dopaminergic neurons through regulating IL‐6/JAK2/STAT3 pathway in Parkinson's disease model. Front Pharmacol. 2022;13:848813. doi: 10.3389/fphar.2022.848813 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Zhang S, Gong F, Liu J, Liu T, Yang J, Hu J. A novel PHD2 inhibitor acteoside from Cistanche tubulosa induces skeletal muscle mitophagy to improve cancer‐related fatigue. Biomed Pharmacother. 2022;150:113004. doi: 10.1016/j.biopha.2022.113004 [DOI] [PubMed] [Google Scholar]
11. Zhang B, Ma Q, Wang W, et al. Study on mechanism of Cistanches Herba in the treatment of liver fibrosis based on network pharmacology,molecular docking and experimental verification. Nat Prod Res Dev. 2022;34(4):677‐686. doi: 10.16333/j.1001-6880.2022.4.016 [DOI] [Google Scholar]
12. Zhang M, Yang X. Research on the protective effect and mechanisms of verbascoside on parkinson disease model mice prepared by MPTP. J Neurosci Mental Health. 2024;24(5):364‐370. doi: 10.3969/j.issn.1009-6574.2024.05.009 [DOI] [Google Scholar]
13. Wang QQ, Sun QR, Ji XY, et al. The combined analgesic, sedative, and anti‐gastric cancer mechanisms of Tinospora sagittata var. yunnanensis (S. Y. Hu) H. S. Lo based on integrated ethnopharmacological data. J Ethnopharmacol. 2023;303:115990. doi: 10.1016/j.jep.2022.115990 [DOI] [PubMed] [Google Scholar]
14. Kam TI, Park H, Chou SC, et al. Amelioration of pathologic α‐synuclein‐induced Parkinson's disease by irisin. Proc Natl Acad Sci U S A. 2022;119(36):e2204835119. doi: 10.1073/pnas.2204835119 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Liao YC, Wang JW, Guo C, et al. Cistanche tubulosa alleviates ischemic stroke‐induced blood‐brain barrier damage by modulating microglia‐mediated neuroinflammation. J Ethnopharmacol. 2023;309:116269. doi: 10.1016/j.jep.2023.116269 [DOI] [PubMed] [Google Scholar]
16. Ying X, Li L, Zhang Y, et al. Effect of levodopa and benserazide tablet on the expression of mitochondrial autophage related genes PINK1 in midbrain of Parkinson disease model mice. Chin J Clin Pharmacol. 2018;34(14):1662‐1664. [Google Scholar]
17. Pan H, Huang H, Zhang L, Ma S, Yang H, Wang H. “Adjusting internal organs and dredging channel” electroacupuncture treatment prevents the development of diabetic peripheral neuropathy by downregulating glucose‐related protein 78 (GRP78) and caspase‐12 in streptozotocin‐diabetic rats. J Diabetes. 2019;11(12):928‐937. doi: 10.1111/1753-0407.12916 [DOI] [PubMed] [Google Scholar]
18. Park H, Kam TI, Peng H, et al. PAAN/MIF nuclease inhibition prevents neurodegeneration in Parkinson's disease. Cell. 2022;185(11):1943‐1959.e21. doi: 10.1016/j.cell.2022.04.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Salah H, Abdel Rassoul R, Medlej Y, et al. A modified two‐way active avoidance test for combined contextual and auditory instrumental conditioning. Front Behav Neurosci. 2021;15:682927. doi: 10.3389/fnbeh.2021.682927 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Xiang HC, Lin LX, Hu XF, et al. AMPK activation attenuates inflammatory pain through inhibiting NF‐κB activation and IL‐1β expression. J Neuroinflammation. 2019;16(1):34. doi: 10.1186/s12974-019-1411-x [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Zhang SL, Ma L, Zhao J, et al. The Phenylethanol glycoside liposome inhibits PDGF‐induced HSC activation via regulation of the FAK/PI3K/Akt signaling pathway. Molecules. 2019;24(18):3282. doi: 10.3390/molecules24183282 [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Gopinath A, Badov M, Francis M, et al. TNFα increases tyrosine hydroxylase expression in human monocytes. NPJ Parkinsons Dis. 2021;7(1):62. doi: 10.1038/s41531-021-00212-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Rohmann R, Kühn E, Scherbaum R, et al. Prevalence and characteristics of polyneuropathy in atypical parkinsonian syndromes: An explorative study. Brain Sci. 2021;11(7):879. doi: 10.3390/brainsci11070879 [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Ben‐Shlomo Y, Darweesh S, Llibre‐Guerra J, Marras C, San Luciano M, Tanner C. The epidemiology of Parkinson's disease. Lancet. 2024;403(10423):283‐292. doi: 10.1016/S0140-6736(23)01419-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Li Y, Yang X, Abudukaha G, Liu D. Analysis of comorbidities and combined medication characteristics in Parkinson's disease patients based on immune‐inflammatory indicators. J Xinjiang Med Univ. 2024;47(1):68‐72. doi: 10.3969/j.issn.1009-5551 [DOI] [Google Scholar]
26. Kühn E, Averdunk P, Huckemann S, et al. Correlates of polyneuropathy in Parkinson's disease. Ann Clin Transl Neurol. 2020;7(10):1898‐1907. doi: 10.1002/acn3.51182 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Rekik A, Santoro C, Poplawska‐Domaszewicz K, et al. Parkinson's disease and vitamins: a focus on vitamin B12. J Neural Transm (Vienna). 2024;131(12):1495‐1509. doi: 10.1007/s00702-024-02769-z [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Ramachandran A, Jose J, Gafoor VA, Das S, Balaram N. Prevalence and risk factors of peripheral neuropathy in Parkinson's disease. Ann Indian Acad Neurol. 2022;25(6):1109‐1115. doi: 10.4103/aian.aian_669_22 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Schumacher MA. Peripheral neuroinflammation and pain: how acute pain becomes chronic. Curr Neuropharmacol. 2024;22(1):6‐14. doi: 10.2174/1570159X21666230808111908 [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Woolf CJ, Mannion RJ. Neuropathic pain: aetiology, symptoms, mechanisms, and management. Lancet. 1999;353(9168):1959‐1964. doi: 10.1016/S0140-6736(99)01307-0 [DOI] [PubMed] [Google Scholar]
31. Zhang Y, Liu Y, Li Y, et al. Correlation between the peripheral neuropathy and levels of hs‐CRP, IL‐1β and IL‐6 in senile Parkinson's disease patients. Cell Mol Biol (Noisy‐le‐Grand). 2023;69(4):120‐124. doi: 10.14715/cmb/2023.69.4.19 [DOI] [PubMed] [Google Scholar]
32. He S, Li W, Wang G, et al. FTO‐mediated m6A modification alleviates autoimmune uveitis by regulating microglia phenotypes via the GPC4/TLR4/NF‐κB signaling axis. Genes Dis. 2022;10(5):2179‐2193. doi: 10.1016/j.gendis.2022.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Niu F, Han P, Zhang J, et al. The m6A reader YTHDF2 is a negative regulator for dendrite development and maintenance of retinal ganglion cells. Elife. 2022;11:e75827. doi: 10.7554/eLife.75827 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Yong Y, Wu Q, Meng X, et al. Dyrk1a phosphorylation of α‐synuclein mediating apoptosis of dopaminergic neurons in Parkinson's disease. Parkinsons Dis. 2023;2023:8848642. doi: 10.1155/2023/8848642 [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Huang J, Wang Y, Zhou Y. METTL3 and METTL14 regulate IL‐6 expression via RNA m6A modification of zinc transporter SLC39A9 and DNA methylation of IL‐6 in periodontal ligament cells. Biochim Biophys acta Mol. Cell Res. 2024;1871(1):119605. doi: 10.1016/j.bbamcr.2023.119605 [DOI] [PubMed] [Google Scholar]
36. Zhao L, Zhao Y, Liu Q, Huang J, Lu Y, Ping J. DDX5/METTL3‐METTL14/YTHDF2 axis regulates replication of influenza A virus. Microbiol Spectr. 2022;10(3):e0109822. doi: 10.1128/spectrum.01098-22 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1.

AME2-8-1441-s003.docx^{(60.7KB, docx)}

Table S1.

AME2-8-1441-s001.docx^{(74KB, docx)}

Table S2.

AME2-8-1441-s002.docx^{(18.1KB, docx)}

Data Availability Statement

The datasets are available on reasonable request from the corresponding author.

[ame270039-bib-0001] 1. Morris HR, Spillantini MG, Sue CM, Williams‐Gray CH. The pathogenesis of Parkinson's disease. Lancet. 2024;403(10423):293‐304. doi: 10.1016/S0140-6736(23)01478-2 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0002] 2. Tolosa E, Garrido A, Scholz SW, Poewe W. Challenges in the diagnosis of Parkinson's disease. Lancet Neurol. 2021;20(5):385‐397. doi: 10.1016/S1474-4422(21)00030-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0003] 3. Del Tredici K, Braak H. To stage, or not to stage. Curr Opin Neurobiol. 2020;61:10‐22. doi: 10.1016/j.conb.2019.11.008 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0004] 4. Sommer C, Geber C, Young P, Forst R, Birklein F, Schoser B. Polyneuropathies. Dtsch Arztebl Int. 2018;115(6):83‐90. doi: 10.3238/arztebl.2018.083 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0005] 5. Wang D, Zheng T, Zhou S, et al. Promoting axon regeneration by inhibiting RNA N6‐methyladenosine demethylase ALKBH5. Elife. 2023;12:e85309. doi: 10.7554/eLife.85309 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0006] 6. Weng YL, Wang X, An R, et al. Epitranscriptomic m6A regulation of axon regeneration in the adult mammalian nervous system. Neuron. 2018;97(2):313‐325.e6. doi: 10.1016/j.neuron.2017.12.036 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0007] 7. Zhang L, Hao D, Ma P, et al. Epitranscriptomic analysis of m6A methylome after peripheral nerve injury. Front Genet. 2021;12:686000. doi: 10.3389/fgene.2021.686000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0008] 8. Li Y, Guo X, Sun L, et al. N6‐Methyladenosine demethylase FTO contributes to neuropathic pain by stabilizing G9a expression in primary sensory neurons. Adv Sci (Weinh). 2020;7(13):1902402. doi: 10.1002/advs.201902402 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0009] 9. Yang X, Yv Q, Ye F, et al. Echinacoside protects dopaminergic neurons through regulating IL‐6/JAK2/STAT3 pathway in Parkinson's disease model. Front Pharmacol. 2022;13:848813. doi: 10.3389/fphar.2022.848813 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0010] 10. Zhang S, Gong F, Liu J, Liu T, Yang J, Hu J. A novel PHD2 inhibitor acteoside from Cistanche tubulosa induces skeletal muscle mitophagy to improve cancer‐related fatigue. Biomed Pharmacother. 2022;150:113004. doi: 10.1016/j.biopha.2022.113004 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0011] 11. Zhang B, Ma Q, Wang W, et al. Study on mechanism of Cistanches Herba in the treatment of liver fibrosis based on network pharmacology,molecular docking and experimental verification. Nat Prod Res Dev. 2022;34(4):677‐686. doi: 10.16333/j.1001-6880.2022.4.016 [DOI] [Google Scholar]

[ame270039-bib-0012] 12. Zhang M, Yang X. Research on the protective effect and mechanisms of verbascoside on parkinson disease model mice prepared by MPTP. J Neurosci Mental Health. 2024;24(5):364‐370. doi: 10.3969/j.issn.1009-6574.2024.05.009 [DOI] [Google Scholar]

[ame270039-bib-0013] 13. Wang QQ, Sun QR, Ji XY, et al. The combined analgesic, sedative, and anti‐gastric cancer mechanisms of Tinospora sagittata var. yunnanensis (S. Y. Hu) H. S. Lo based on integrated ethnopharmacological data. J Ethnopharmacol. 2023;303:115990. doi: 10.1016/j.jep.2022.115990 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0014] 14. Kam TI, Park H, Chou SC, et al. Amelioration of pathologic α‐synuclein‐induced Parkinson's disease by irisin. Proc Natl Acad Sci U S A. 2022;119(36):e2204835119. doi: 10.1073/pnas.2204835119 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0015] 15. Liao YC, Wang JW, Guo C, et al. Cistanche tubulosa alleviates ischemic stroke‐induced blood‐brain barrier damage by modulating microglia‐mediated neuroinflammation. J Ethnopharmacol. 2023;309:116269. doi: 10.1016/j.jep.2023.116269 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0016] 16. Ying X, Li L, Zhang Y, et al. Effect of levodopa and benserazide tablet on the expression of mitochondrial autophage related genes PINK1 in midbrain of Parkinson disease model mice. Chin J Clin Pharmacol. 2018;34(14):1662‐1664. [Google Scholar]

[ame270039-bib-0017] 17. Pan H, Huang H, Zhang L, Ma S, Yang H, Wang H. “Adjusting internal organs and dredging channel” electroacupuncture treatment prevents the development of diabetic peripheral neuropathy by downregulating glucose‐related protein 78 (GRP78) and caspase‐12 in streptozotocin‐diabetic rats. J Diabetes. 2019;11(12):928‐937. doi: 10.1111/1753-0407.12916 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0018] 18. Park H, Kam TI, Peng H, et al. PAAN/MIF nuclease inhibition prevents neurodegeneration in Parkinson's disease. Cell. 2022;185(11):1943‐1959.e21. doi: 10.1016/j.cell.2022.04.020 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0019] 19. Salah H, Abdel Rassoul R, Medlej Y, et al. A modified two‐way active avoidance test for combined contextual and auditory instrumental conditioning. Front Behav Neurosci. 2021;15:682927. doi: 10.3389/fnbeh.2021.682927 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0020] 20. Xiang HC, Lin LX, Hu XF, et al. AMPK activation attenuates inflammatory pain through inhibiting NF‐κB activation and IL‐1β expression. J Neuroinflammation. 2019;16(1):34. doi: 10.1186/s12974-019-1411-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0021] 21. Zhang SL, Ma L, Zhao J, et al. The Phenylethanol glycoside liposome inhibits PDGF‐induced HSC activation via regulation of the FAK/PI3K/Akt signaling pathway. Molecules. 2019;24(18):3282. doi: 10.3390/molecules24183282 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0022] 22. Gopinath A, Badov M, Francis M, et al. TNFα increases tyrosine hydroxylase expression in human monocytes. NPJ Parkinsons Dis. 2021;7(1):62. doi: 10.1038/s41531-021-00212-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0023] 23. Rohmann R, Kühn E, Scherbaum R, et al. Prevalence and characteristics of polyneuropathy in atypical parkinsonian syndromes: An explorative study. Brain Sci. 2021;11(7):879. doi: 10.3390/brainsci11070879 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0024] 24. Ben‐Shlomo Y, Darweesh S, Llibre‐Guerra J, Marras C, San Luciano M, Tanner C. The epidemiology of Parkinson's disease. Lancet. 2024;403(10423):283‐292. doi: 10.1016/S0140-6736(23)01419-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0025] 25. Li Y, Yang X, Abudukaha G, Liu D. Analysis of comorbidities and combined medication characteristics in Parkinson's disease patients based on immune‐inflammatory indicators. J Xinjiang Med Univ. 2024;47(1):68‐72. doi: 10.3969/j.issn.1009-5551 [DOI] [Google Scholar]

[ame270039-bib-0026] 26. Kühn E, Averdunk P, Huckemann S, et al. Correlates of polyneuropathy in Parkinson's disease. Ann Clin Transl Neurol. 2020;7(10):1898‐1907. doi: 10.1002/acn3.51182 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0027] 27. Rekik A, Santoro C, Poplawska‐Domaszewicz K, et al. Parkinson's disease and vitamins: a focus on vitamin B12. J Neural Transm (Vienna). 2024;131(12):1495‐1509. doi: 10.1007/s00702-024-02769-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0028] 28. Ramachandran A, Jose J, Gafoor VA, Das S, Balaram N. Prevalence and risk factors of peripheral neuropathy in Parkinson's disease. Ann Indian Acad Neurol. 2022;25(6):1109‐1115. doi: 10.4103/aian.aian_669_22 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0029] 29. Schumacher MA. Peripheral neuroinflammation and pain: how acute pain becomes chronic. Curr Neuropharmacol. 2024;22(1):6‐14. doi: 10.2174/1570159X21666230808111908 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0030] 30. Woolf CJ, Mannion RJ. Neuropathic pain: aetiology, symptoms, mechanisms, and management. Lancet. 1999;353(9168):1959‐1964. doi: 10.1016/S0140-6736(99)01307-0 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0031] 31. Zhang Y, Liu Y, Li Y, et al. Correlation between the peripheral neuropathy and levels of hs‐CRP, IL‐1β and IL‐6 in senile Parkinson's disease patients. Cell Mol Biol (Noisy‐le‐Grand). 2023;69(4):120‐124. doi: 10.14715/cmb/2023.69.4.19 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0032] 32. He S, Li W, Wang G, et al. FTO‐mediated m6A modification alleviates autoimmune uveitis by regulating microglia phenotypes via the GPC4/TLR4/NF‐κB signaling axis. Genes Dis. 2022;10(5):2179‐2193. doi: 10.1016/j.gendis.2022.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0033] 33. Niu F, Han P, Zhang J, et al. The m6A reader YTHDF2 is a negative regulator for dendrite development and maintenance of retinal ganglion cells. Elife. 2022;11:e75827. doi: 10.7554/eLife.75827 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0034] 34. Yong Y, Wu Q, Meng X, et al. Dyrk1a phosphorylation of α‐synuclein mediating apoptosis of dopaminergic neurons in Parkinson's disease. Parkinsons Dis. 2023;2023:8848642. doi: 10.1155/2023/8848642 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ame270039-bib-0035] 35. Huang J, Wang Y, Zhou Y. METTL3 and METTL14 regulate IL‐6 expression via RNA m6A modification of zinc transporter SLC39A9 and DNA methylation of IL‐6 in periodontal ligament cells. Biochim Biophys acta Mol. Cell Res. 2024;1871(1):119605. doi: 10.1016/j.bbamcr.2023.119605 [DOI] [PubMed] [Google Scholar]

[ame270039-bib-0036] 36. Zhao L, Zhao Y, Liu Q, Huang J, Lu Y, Ping J. DDX5/METTL3‐METTL14/YTHDF2 axis regulates replication of influenza A virus. Microbiol Spectr. 2022;10(3):e0109822. doi: 10.1128/spectrum.01098-22 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Cistanche tubulosa improves peripheral neuropathy in MPTP‐induced PD mice based on regulation of m6A methylation

Yatan Li

Wei Jia

Junhua Hu

Borui Zhang

Xinxin Qi

Jianhua Yang

Xinling Yang

Abstract

Background

Methods

Results

Conclusion

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1. Screening of active compounds in CT for PD‐related peripheral nerve impairment

2.1.1. Network pharmacologic analysis of CT extracts

2.1.2. Molecular docking analysis for the key targets

2.2. Animals and experimental design

2.2.1. Animals

2.2.2. PDPN model

2.3. Drug treatment

2.4. Ethology assessment

2.5. Tissue processing

2.6. Elisa assay

2.7. Light microscopic examination

2.8. Transmission electron microscopy imaging of DRGs

2.9. Immunofluorescence (IF) staining analysis

2.10. Molecular biology assay

TABLE 1.

2.11. Statistical analyses

3. RESULTS

3.1. Common targets in PD and PN of the active component of CT

3.1.1. Network pharmacologic analysis of CT medicinal ingredients effective against PD and PN

FIGURE 1.

3.1.2. Act exhibits excellent binding to key targets of PD and PN

FIGURE 2.

TABLE 2.

3.2. Verification of the efficacy of Act against peripheral neuropathy in a PD mouse model

3.2.1. Framework of the mouse model and baseline experiments

FIGURE 3.

3.2.2. Act reduced the behavioral harm in seen in the PDPN mouse model

FIGURE 4.

3.2.3. Act corrected the histopathological changes in DRGs from the PDPN model

FIGURE 5.

3.2.4. Act regulated the AKT/CASP3 pathway by reducing the expression of FTO and IL‐6

FIGURE 6.

3.2.5. Act exerted a therapeutic effect on PDPN model mice by influencing m6A modification to regulate the level of AKT/CASP3 signaling

FIGURE 7.

4. DISCUSSION

4.1. PN exists in the development of PD

4.2. Act contributed to the reversal of PN in PD models

4.3. Dynamic regulation of m6A methylation in the protective effect of Act

FIGURE 8.

5. CONCLUSION

AUTHOR CONTRIBUTIONS

FUNDING INFORMATION

CONFLICT OF INTEREST STATEMENT

ETHICS STATEMENT

CONSENT FOR PUBLICATION

Supporting information

ACKNOWLEDGMENTS

DATA AVAILABILITY STATEMENT

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases