Extended spectrum beta-lactamase producing Escherichia coli encoding aminoglycoside and fluoroquinolone resistant genes in urinary tract infection patients in a tertiary hospital in Nigeria

Abstract

Escherichia coli causing urinary tract infections (UTIs) remains the most common bacterial infection diagnosed among outpatients as well as hospitalized patients. This study aimed to detect the extended-spectrum beta-lactamase-producing E. coli habouring aminoglycosides and fluoroquinolone-resistant genes in UTI patients. A total of 372 clean-catch midstream urine samples of patients with UTI attending Alex Ekwueme Federal University Teaching Hospital Abakaliki, Nigeria (AE-FUTHA) was collected. The collected urine samples were processed using standard microbiology and molecular methods to isolate and identify E. coli. Detection of ESBL-producing E. coli was performed using the double-disk synergy test. The ESBL-producing E. coli were subjected to antimicrobial susceptibility testing following the standard Kirby–Bauer disk diffusion method. PCR-specific primers were used to screen for the ESBL, aminoglycosides and fluoroquinolone-resistant genes. Out of the 372 urine samples collected, 84 (22.58%) distinct E. coli isolates were recovered, out of which 24 (28.57%) were ESBL positive. While all the isolates were resistant to amoxicillin/clavulanic acid 24 (100%), others were highly resistant to aztreonam and sulfamethoxazole/trimethoprim 22 (91.7%), ceftriaxone 21 (87.5%), ceftazidime and cefotaxime 16 (66.7%). Resistance to a fluoroquinolone, a ciprofloxacin was observed in 15 (62.5%). Out of the 24 ESBL-positive isolates, 12 were selected based on their resistance to both aminoglycosides and fluoroquinolones antibiotics used. These ESBL-producing E. coli encoded _blaOXA-1 3 (25%), _blaSHV 3 (25%) and _blaTEM 8 (66.7%). Fluoroquinolone genes, qnrA and qnrC were detected in all the isolates 12 (100%), while qnrB was detected in 10 (83.35). Aminoglycoside gene, ant (4′)-la was detected in all the isolates 12 (100%), while aph (2”)-ld was haboured by 10 (83.3%). Co-resistance of ESBL, fluoroquinolone and aminoglycoside (blaTEM + qnrA + qnrB + qnrC + ant (4′)-la + aph (2”)-lb) was observed in 8(66.7%). E. coli is one of the predominant bacteria isolated from UTI patients in Abakaliki. A high proportion have the ability to produce ESBL and predominantly encoded blaTEM with co-existence of fluoroquinolone gene, qnr and aminoglycoside, ant (4′)-la.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12879-025-11561-7.

Introduction

The most common bacterial infection that affects both men and women is urinary tract infection (UTI) [1]. Undernourishment, poor living conditions, poor sanitation, and environmental conditions are the main causes of this disease’s prevalence in poorer nations [2]. The prevalence of UTI fluctuates with age, reaching its zenith in young infants, toddlers, and older adolescents [3]. The use of aminoglycosides as an empirical and conclusive treatment for UTI is supported by summarized evidence, primarily in regions where multidrug-resistant Gram-negative pathogens are prevalent [4]. Geographical variations in resistance rates to aminoglycosides are influenced by resistance mechanisms [5]. Additionally, fluoroquinolones have been used extensively to treat UTIs; however, their effectiveness has been hampered by the growing appearance of resistant strains [6]. The predominance of bacterial pathogens that produce extended-spectrum beta-lactamases (ESBLs) has led to a surge in UTI complications. These infections are also causing numerous management and epidemiological problems, particularly when they are unable to withstand the antimicrobial activity of some antibiotics used to treat UTIs [7]. Multidrug-resistant (MDR) strains of Escherichia coli have been linked to UTIs [8, 9], supporting the fact that E. coli is one of the main causes of UTIs and the most common bacteria that produce various ESBLs [10, 11].

Because of antibiotic resistant gene transfer, gram-negative bacteria that make β-lactamases are a big issue in the medical field [12]. The co-harboring of an ESBL with fluoroquinolone and aminoglycoside resistant genes is a significant concern because ESBL transfer is plasmid-mediated [13–15]. Quinolone resistance (qnr) genes have been found in ESBL-producing E. coli isolated from clinical isolates [16], urinary tract infections [17], and diarrheal stools [18] in other studies. Additionally, it has been documented that urinary tract infections can harbor ESBL-producing Escherichia coli that carry aminoglycoside resistance genes [14, 19, 20]. Comparative data on the relationship between quinolone and aminoglycoside co-resistance in Enterobacteriaceae that produce ESBL in Nigerian hospitals is, however, scarce. According to one investigation, human clinical samples from Ebonyi State had a high incidence of ESBL-producing E. coli that carried fluoroquinolone resistance genes and ESBL [21]. Beta-lactamases and antibiotic resistance in enterobacterial uropathogenic [22] and E. coli from UTI [23] were described in another research. Hence, this study evaluated the co-existence of fluoroquinolone and aminoglycoside resistant genes among ESBL producing Escherichia coli isolated from patients with urinary tract infections (UTIs) attending the Alex Ekwueme Federal Teaching Hospital Abakaliki (AE-FUTHA) Ebonyi State, Nigeria.

Methodology

Sample collection

Simple random sampling technique, 20% prevalence rate of ESBL-producing E. coli [21] and 95% confidence interval was used to obtain a total of 372 urine sample across different wards and clinics (Table 2) from inpatients and outpatients (table S2) with UTIs attending Alex Ekwueme Federal University Teaching Hospital Abakaliki (AE-FUTHA) from September 2020 to February 2021. Only patients that were clinically diagnosed with UTI by the attending physicians were included. Patients that previously took antibiotics were not included in the study. The clean catch early morning midstream urine samples were collected in sterile universal containers and immediately transported to the microbiology laboratory unit of Ebonyi State University, Abakaliki, Ebonyi State, Nigeria for further bacteriological analysis.

Table 2.

The number of E. coli and ESBL positive E. coli recovered from the 372 urine samples

Groups	Hospital Clinic	E. coli (%)	ESBL-positive (%)
		n = 372	n = 84
1	GOPD Clinic	8	5
2	CHER	2	0
3	MOPC	7	2
4	SOPC	12	4
5	NHIS Clinic	6	2
6	A&E Clinic	10	2
7	Virology Clinic	2	0
8	Female Medical Ward	9	1
9	Gynaecology Ward	1	1
10	Male Medical Ward	6	3
11	Eye Clinic	1	0
12	Antenatal Clinic	1	0
13	PSOP Ward	4	0
14	Male Surgical ward	5	2
15	VIP Ward	2	0
16	CHOP Clinic	2	0
17	CCRN Clinic	1	0
19	Female Surgical Ward	3	0
20	Labour Ward	1	1
22	PNW	1	1
	Total	84 (22.58)	24(28.57)

KEY: GOPD General Outpatient Department, CHER Children Emergency, MOPC Medical Outpatient clinic, SOPC Surgical Outpatient clinic, NHIS National Health Insurance Scheme, A & E Accident & Emergency, PSOP Post-Operative, VIP Very important persons, CHOP Children’s Outpatient clinic, CCCRN Centre for Clinical Care and Clinical Research of Nigeria, PNW Post Natal Ward

Bacterial isolation and identification

About 100 µL of each urine sample were enriched into 900 µL of sterile tryptic soy broth (TSB)(Oxoid, UK) and incubated for 18–24 h at 35 °C and thereafter streaked onto plates of MacConkey agar and Eosin Methylene Blue (EMB) agar (Merck Co., Germany). The plates were then incubated at 35 °C for 18–24 h. After incubation, E. coli was identified by standard biochemical techniques such as colonial morphology, Gram staining, motility, indole production, methyl red, Vogos-proskauer, citrate utilization, urease, starch hydrolysis as previously described [2, 24, 25]. The bacterial 16 S rRNA gene was used to perform the molecular identification. The universal primer pair used is shown in Table 1, while the generated electrophoresis bands are seen in figure S1. Nine representative amplicons were selected, sequenced and deposited in GenBank.

Table 1.

Oligonucleotide primer sequences used in the study

Genes	Primer sequences (5′−3′)	Amplicon size (bp)	References
16 S rRNA	27 F: AGAGTTTGATCMTGGCTCAG	1500	[26]
	1525R: AAGGAGGTGWTCCARCCGCA
bla CTX-M	F: GCGACAATACTGCCATGAATAAGC	349	[27]
	R: ATATCGTTGGTGGTGCCATAATCTC
bla SHV	F: TCGCCTGTGTATTATCTCCC	769	[28]
	R: CGCAGATAAATCACCACAATG
bla OXA-1	F: ATATCTCTACTGTTGCATCTCC	619	[28]
	R: AAACCCTTCAAACCATCC
bla TEM	F: GTATCCGCTCATGAGACAATA	966	[29]
	R: TCTAAAGTATATATGAGTAAAC
qnrA	F: TTCAGCAAGATTTCTCA	700	[15]
	R: GGCAGCACTATTACTCCCAA
qnrB	F: GATCGTGAAAGCCAGAAAGG	810	[15]
	R: ACGATGCCTGGTAGTTGTCC
qnrC	F: GGGTTGTACATTTATTGAATCG	308	[15]
	R: CACCTACCCATTTATTTTCA
aac(6’)-lb-cr	F: TGACCTTGCGATGCTCTATG	509	[15]
	R: CACAATCGACTAAAGAGTACCAATC
qepA	F: GCAGGTC CAGCAGCGGGTAG	218	[15]
	R: CTTCCTGCCCGAGTATC GTG
aph(2”)-lb	F: CCAAGAGCAATAAGGGCATA	220	[15]
	R: CACTATCATAACCACTACCG
aph(2”)-lc	F: CCACAATGATAATGACTCAGTTCCC	1450	[30]
	R: CCACAGCTTCCGATAGCAAGAG
aph(2”)-ld	F: GTGGTTTTTACAGGAATGCCATC	1280	[30]
	R: CCCTCTTCATACCAATCCATATAACC
ant(4′)-la	F: CAAACTGCTAAATCGGTAGAAGCC	1300	[30]
	R: GGAAAGTTGACCAGACATTACGAACT
Aac	F: ACCTACTCCCAACATCAGCC	169	[30]
	R: ATATAGATCTCACTACGCGC
aadA2	F: ATTTGCTGGTAACGGTGACC	866	[30]
	R: CTTCAAGTATGACGGGCTGA

Detection of extended spectrum beta-lactamase (ESBL)-producing E. coli

ESBL-producing E. coli isolates were confirmed phenotypically by the double disc synergy test (DDST) method as previously described [31, 32]. Antibiotic disks containing amoxycillin/clavulanic acid (20/10µg) were placed at the center of Muellar-Hinton agar plates and antibiotic disks containing ceftazidime (30 µg) and cefotaxime (30 µg) were placed adjacent to the central disk (amoxycillin/clavulanic acid) at a distance of 15 mm. The plates were incubated at 37 °C for 24 h; a ≥ 5 mm increase in the inhibition zone diameter for either of the cephalosporins tested in combination with the central disk versus its zone when tested alone phenotypically confirms ESBL production. Selected representative ESBL-positive isolates were used for further studies based on their resistance to both aminoglycosides and fluoroquinolones antibiotics used.

Antimicrobial susceptibility profiling

The resistance and susceptibility patterns of the ESBL positive E. coli isolates were determined by the Kirby and Bauer disk diffusion test method as recommended by Clinical Laboratory Standard Institute (CLSI, 2023) [33]. An overnight culture of the test bacteria grown in nutrient broth (Oxoid, UK) was adjusted to 0.5 McFarland turbidity standards. The inoculum was aseptically inoculated on the surface of Mueller-Hinton (MH) agar plates using sterile swab sticks. The following antibiotic disks were used: Ceftazidime (30 µg), ceftriaxone (30 µg), cefotaxime (30 µg), meropenem (10 µg), imipenem (10 µg), amoxicillin/clavulanic acid (20/10 µg), aztreonam (30 µg), nitrofurantion (300 µg), ciprofloxacin (5 µg), ofloxacin (5 µg), gentamycin (10 µg), sulphamethoxazole/trimethoprim (1.25/23.75 µg) (Oxoid, UK). E. coli ATCC 25,922 was used as quality control. The antibiotics were aseptically placed on the surface of the inoculated Mueller-Hinton agar plate using sterile forceps. The plates were incubated at 37 °C for 24 h, and the inhibition zone diameters (IZDs) produced by the antibiotic disks were measured, recorded and compared to the standard breakpoints [34].

Amplification and detection of ESBL, fluoroquinolones and aminoglycosides genes

Following the manufacturer’s instructions, the ZR Fungal/Bacterial DNA MiniPrepTM kit (Zymo Research, CA, USA) was used to extract the bacterial genomic DNA. The following genes were amplified and identified: ant(4′)-la, aph(2”)-lb, aph(2”)-lc, aph(2”)-lc, aadA2, aac for aminoglycoside resistance, _blaCTX-M, _blaSHV, _blaOXA-1, _blaTEM, for ESBL, qnrA, qnrB, qnrC, qepA, and aac(6’)lb-cr for quinolone resistance. The following ATCC strains were first tested to confirm the presence of some target ESBL genes: E. coli ATCC 35218 (_blaTEM), Klebsiella pneumoniae ATCC 700603 (_blaSHV), E. coli ATCC 25922 (negative control). Representative electrophoresis gel bands showing the amplified genes have been included in supplementary file. Table 1 lists the oligonucleotide primers that were utilized. About 12.5 µL of Taq 2X Master Mix (New England Biolabs, M0270); 1 µL of each of the 10 µM forward and reverse primers; 2 µL of DNA template; and 8.5 µL of nuclease-free water make up the PCR master mix utilized in the test. An initial denaturation at 94˚C for five minutes was followed by 36 cycles of denaturation at 94˚C for thirty seconds, annealing at 55˚C for thirty seconds, and elongation at 72˚C for forty-five seconds. After seven minutes of a final elongation step at 72˚C, the holding temperature was kept at 10˚C. The amplified products were observed using a gel documentation system after being performed on 1.5% agarose gel electrophoresis at 110 V for one hour. A Genetic Analyzer 3130 xl sequencer (Applied Biosystems) was used to sequence the amplicons after they had been treated using a BigDye terminator version 3.1 cycle sequencing kit [34]. The generated sequences were annotated in NCBI-GenBank database before obtaining accession numbers.

Statistical analysis

Statistical analysis using the ANOVA and Tukey Post-hoc multiple comparison test tools for the comparative evaluation of categorical variables was performed with the SPSS 20.0 version statistical software package. Results were only considered to be statistically significant if the p-value was less than 0.05 (p < 0.05).

Results

Out of the 372 urine samples collected, 84 (22.58%) distinct E. coli isolates were recovered, out of which 24 (28.57%) were ESBL positive. The highest number of ESBL-producing Escherichia coli isolates were obtained from the GOPD, 5 (20%) followed by the ones obtained from the SOPC, 4 (16.67%) (Table 2). The highest numbers of recovered E. coli from the urine samples were seen in SOPC, A&E, GOPD and MOPC. The demographic distributions of the isolates are shown in table S1. There was no significant difference (p = 0.064) in the ESBL-producing E. coli isolated from both the males and the females.

While all the isolates were resistant to amoxicillin/clavulanic acid 24 (100%), others were highly resistant to aztreonam and sulfamethoxazole/trimethoprim 22 (91.7%), ceftriaxone 21 (87.5%), ceftazidime and cefotaxime 16 (66.7%). Resistance to a fluoroquinolone, a ciprofloxacin was 15 (62.5%). Imipenem was resisted by 7 (29.2%) of the isolates (Table 3). For further studies on the detection of antibiotics resistance genes, 12 isolates that were resistant to both aminoglycoside, gentamicin and the beta-lactams were used.

Table 3.

Antibiotics resistance profile of ESBL-producing E. coli (n = 24)

Antibiotics	Resistant (%)
Cefotaxime	16 (66.7)
Amoxicillin/clavulanic acid	24 (100)
Ceftazidime	16 (66.7)
Ofloxacin	15 (62.5)
Imipenem	7 (29.2)
Sulfamethoxazole/trimethoprim	22 (91.7)
Meropenem	14 (58.3)
Ceftriaxone	21 (87.5)
Ciprofloxacin	15 (62.5)
Nitrofurantoin	15 (62.5)
Gentamicin	13 (54.2)
Aztreonam	22 (91.7)

In Table 4, PCR amplification of the resistant genes showed that the ESBL-producing E. coli (n = 12) encoded _blaOXA-1 3 (25%), _blaSHV 3 (25%) and _blaTEM 8 (66.7%) genes but not _blaCTX-M. Fluoroquinolone genes qnrA and qnrC were detected in all the isolates 12 (100%), while qnrB and qepA were detected in 10 (83.35) and 4 (33.3%) respectively. aac(6’)-lb-cr was not haboured in any of the isolates. Aminoglycoside genes, ant(4′)-la was detected in all the isolates, 12 (100%), while aph(2”)-ld and aadA2 were haboured by 10 (83.3%) and 4 (33.3%) respectively. Co-resistance of ESBL, fluoroquinolone and aminoglycoside (_blaTEM + qnrA + qnrB + qnrC + ant(4′)-la + aph(2”)-lb) was observed in 8(66.7%).

Table 4.

Detection of the resistance genes among the ESBL producing E. coli (n = 12)

Antibiotics Class	Genes	Positive isolates n (%)
β-lactams	bla OXA-1	3(25.0)
	blaCTX-M	0(0.0)
	bla SHV	3(25.0)
	bla TEM	8(66.7)
Fluoroquinolones	qnrA	12(100)
	qnrB	10(83.3)
	qnrC	12(100)
	aac(6’)-lb-cr	0(0.0)
	qepA	4(33.3)
Aminoglycosides	aadA2	4(33.3)
	aac	2(16.7)
	ant(4′)-la	12(100)
	aph(2”)-lb	1(8.3)
	aph(2”)-lc	1(8.3)
	aph(2”)-ld	10(83.3)
β-lactams + fluoroquinolones + aminoglycosides
co-resistance	bla TEM + qnrA +	8(66.7)
	qnrB + qnrC +
	ant(4′)-la + aph(2”)-lb

Discussion

In this study, ESBL-producing E. coli were isolated from 372 urine samples obtained from patients with UTI. ESBL, aminoglycosides and fluoroquinolone resistant genes were detected and sequenced.

E. coli isolates from the urine samples

In this study, 84 (22.58%) distinct E. coli isolates were recovered from 372 urine samples of UTI patients, out of which 24 (28.57%) were ESBL positive. Such a high number of E. coli recovered from urine samples of UTI patients have been reported in Nigeria and elsewhere. In Minna [35], Awka [36] and Benin, Nigeria [37], occurrence frequency of 23.5%, 24.2% and 22.3% respectively were observed. Higher frequency rates of 40.4%, 30.7% and 38.5% were equally reported in other parts of Nigeria and Africa, River state, Ondo state and Kenya [38–40]. As high as 84% frequency rate have been reported in Sri Lanka [41]. In a comparative evaluation of bacteria isolates implicated in UTIs, Escherichia coli accounted for 80–85% [42]. Most of the E. coli in our study were recovered from the outpatients’ departments of the hospital indicating the possibility of a community-based acquisition and spread of this UTI in our sample population. Similar observations have been reported in Ado-Ekiti, Nigeria, Iran and Bangladesh where the highest numbers (37.4%, 59.21%, 62.6%) of E. coli recovery from UTI came from the SOPD and GOPD [43–45]. Low compliance with hand hygiene, lack of clean water, crowded households, poor toilet facilities, close human–livestock, contact international travel to high-risk areas as well as low socioeconomic status are some of the factors favouring the spread of community-acquired UTIs [46–48].

ESBL-producing E. coli

Extended-spectrum beta-lactamases (ESBL) production was detected in 28.57% (24/84) of the E. coli isolated from the urine samples in this study. Such high frequency rates in E. coli recovery from UTI were observed in Enugu, Bauchi and Ile-Ife, Nigeria at 27.7%, 28.2% and 26.1% respectively [49, 50]. Much higher rates have been reported elsewhere in Abakaliki (68.2%) [51], Qatar (83%) [52] and Minna (88.5%) [53]. However, in much developed countries, like USA [54] and Australia [55], much lower rates were observed at 6.8% and even less 1.9%, respectively. in Australia. In this study, the ESBL producing E. coli were all resistant to AMC and more than 60% resistant to all cephalosporins tested. This finding correlates with an earlier study in Abakaliki, Nigeria where resistance to cefotaxime, ceftazidime, and ceftriaxone were recorded at 83.6%, 79.5% and 57.5% respectively [56]. Similarly, in Minna, Nigeria [48], resistance to cefotaxime at 84.6% was reported. The observation is the same elsewhere, outside Nigeria. Yadav and Prakash, (2017) in Southern Terai of Nepal observed high resistance to ceftriaxone and ceftazidime at 67.47% and 63.41% respectively [57]. Also, Fernando et al. (2017) observed 100% resistance to ceftriaxone and ceftazidime in Sri Lanka [45], while Hassuna et al., (2020) in Upper Egypt recorded the same 100% resistance to ceftazidime and cefotaxime. The high rate of resistance in this study which could be attributed to indiscriminate use and abuse of beta-lactam antibiotics by individuals led to problems in the treatment of microbial infections and diseases caused by these antibiotic-resistant organisms as a result of ESBL production.

Detected ESBL resistant genes

The molecular detection of ESBL resistance genes among the isolates in this study revealed that the _blaTEM (66.7%) was most predominant over _blaOXA-1 (25.0%) and _blaSHV (25.0%). Within the same locality of our study, Abakaliki, _blaTEM has been reported as the most predominant (55%) ESBL resistant gene among E. coli of clinical origin [51]. Similar higher result was observed in Minna, Nigeria, and Ghana where _blaTEM from E. coli isolated from UTI patients predominated at 70% and 66.7% respectively [58]. However, in Minna, while _blaOXA frequency rate was 20%, _blaSHV gene was not observed. Elsewhere in Nepal, multi-drug resistant ESBL-producing isolates of E. coli were reported to habour 83.8% _blaTEM gene [59]. A lower rate of _blaTEM (50.5%), though the predominant ESBL gene, was seen in Bangladesh followed by _blaCTX-M and _blaSHV at 46% and 18.7% respectively [60]. Since the ESBL gene predominance varies between regions and locations, other studies reported a lower frequency rate of ESBL genes. In Gombe, Nigeria, _blaSHV (10%) was reported as the most prevalent uropathogenic ESBL producing E. coli, followed by _blaCTX-M (5%) [61]. Similarly, Kpalap et al., (2019) in Port-Harcourt, Nigeria reported the predominance of _blaSHV over _blaCTX-M and _blaTEM [62]. Conversely, Rodríguez-Baño et al.., (2004) reported that _blaCTX (67%) was more predominant followed by _blaTEM and _blaSHV 22% and 11% respectively [63]. Our study observed AMC resistance and detected OXA-1 gene. Studies have reported frequent association of _blaOXA−1 with the worldwide-spread _blaCTX-M-15. This association of _blaOXA−1 with the ESBL genes make isolates resistant to β-lactam-β-lactamase inhibitor combinations [64].

Quinolones and aminoglycosides resistant genes

In this study, the molecular detection of PMQR genes among the ESBL-producing E. coli isolates revealed that qnrA, and qnrC were 100% detected in all ESBL positive isolates, while qnrB and qepA were detected in 83.3% and 33.3% of the isolates respectively. Qnr gene confers partial resistance to fluoroquinolones by protecting DNA gyrase from the effects of fluoroquinolones [15]. Ogbolu et al., (2016) reported PMQR carriage rate of 35.2% in Abakaliki south-eastern Nigeria comprising of qnrA (9.9%), qnrB (5.6%), qnrS (11.3%) and qnrD (1.4%) but no qnrC was detected in their study [65]. In Port-Harcourt, Nigeria, Onanuga et al. (2019) reported the qnr variants (qnrB, qnrD and qnrS) detected in 28% of the E. coli isolates from urinary samples of UTIs [24]. In another study, qnrB (71.3%) along with qnrS and qnrA genes (4.5%, and 62.8%, respectively) were significantly associated with quinolone resistance among UPEC strains in the north of Iran [66]. In yet another study in Iran, Abbasi et al. (2018) reported qnrB at 25% as the only detected qnr genes among E. coli strains isolated from UTIs [67]. These differences in Qnr frequency rate can be explained by the difference in environmental conditions, the geographical distribution of qnr genes, the sample size, the methods of detection used, or the low level of quinolone usage and hence the acquisition of its resistant gene. Results showed that all the aminoglycoside-resistant isolates harboured the ant(4′)-la gene with one or more of the other screened AME (aminoglycoside-modifying enzyme) genes. The ant(4′)-la (100%) and aph(2”)-ld (83.3%) were the most prevalent AME genes among all the ESBL- producing E. coli isolates. In contrast, the presence of aacC2, aadA1 and aadA2 as the prominent genes among uropathogenic ESBL-producing E. coli isolates was reported in Port-Harcourt, Nigeria [23]. Elsewhere within Europe, aph(3’)-Ia (30.3%), aac(3)-IId (22.8%), and aac(6’)-Ib-cr (11.8%) were the most prevalent AME genes in Zurich, Switzerland [68], while in Bialystok, Poland the enzymatic resistance against aminoglycosides among clinical isolates of E. coli is predominantly caused by aac(6′)-Ib (59.2%) and aph(3”)-Ib (36.2%) [69]. In a study conducted by Azimi et al., (2022) in Iran, aac (6’)-Ib (66%) aadA15 (43%) were the most prevalent AME genes among clinical isolates of E. coli [70]. The results of AME-genes detection from E. coli of Egyptian isolates revealed that the most prevalent AME-genes were aac(3′)-IIa (40%), aac(6′)-Ib (30%) followed by aph(3′)-Ia (23.3%), ant(2″)-Ia(20.0%), aph(3′)-VI(13.3%) [71]. These data suggest that various reasons such as diversity of specimen type, geographic regions, sample size, bacterial sources, usage of antibiotics, and applied detecting methods could affect the distribution patterns of AME. The findings in this study detected the association of ESBL-genes with fluoroquinolone and aminoglycoside resistant genes. A co-existence of _blaTEM + qnrA + qnrB + qnrC + ant(4′)-la + aph(2”)-ld genes were identified in 66.7% ESBL-producing E. coli isolates from the UTI Patients. Co-detection of these genes has been reported in Saudi Arabia, Mexico, Nigeria and Zurich area, Switzerland [15, 23, 72–74].

Limitations of study

This study has certain limitations. The small sample size may have affected the non-detection of the worldwide _blaCTX-M. Also, specific primers for the several _blaCTX-M and the newer ESBLs were not included in the study. The use of a more advanced whole genome sequencing would reveal a more detailed AMR genes and ESBL genes within the isolates. We hope that further studies with more sample size across different hospitals and increased assay of multiple ESBL genes will provide more information.

Conclusion

This study observed a 22.58% frequency rate in E. coli associated with UTIs in a tertiary hospital in Abakaliki, Nigeria. A high number of these E. coli exhibited ESBL producing ability with significant resistance to cephalosporins, fluoroquinolones and aminoglycosides. Continuous use of these drugs might most likely be associated with treatment failure and serious antimicrobial resistance. This study also highlighted the predominant detection and co-existence of blaTEM, qnrA, qnrC and ant(4′)-la. The presence of these reported genes encoded by the isolates are known to be located on transferable plasmids which also carry other aminoglycosides and fluoroquinolones genes resulting in rapid dissemination of MDR among bacterial species suggesting an increasing UTIs treatment failure with commonly used antibiotics.

Abbreviations

UTI

Urinary Tract Infection

MDR

Multi Drug Resistance

ESBL

Extended Spectrum Beta Lactamase

AME

Aminoglycosides Modifying Enzyme

DDST

Double Disc Synergy Test

Authors’ contributions

M.A and I.R.I conceptualized the study. M. A and C.E performed the investigations/methods. E.E.D prepared original draft. C. S. I and E. F. N reviewed and edited the draft. I. R. I supervised the project. All authors read and agreed to the final version of the manuscript.

Funding

This work received no funding.

Data availability

The generated gene sequences have been deposited and publicly available in DDBJ/ENA/GenBank and accessible with the following links:

[https://www.ncbi.nlm.nih.gov/nuccore/PV541238.1] (https://www.ncbi.nlm.nih.gov/nuccore/PV541238.1)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541239] (https://www.ncbi.nlm.nih.gov/nuccore/PV541239)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541240] (https://www.ncbi.nlm.nih.gov/nuccore/PV541240)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541241] (https://www.ncbi.nlm.nih.gov/nuccore/PV541241)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541242] (https://www.ncbi.nlm.nih.gov/nuccore/PV541242)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541243] (https://www.ncbi.nlm.nih.gov/nuccore/PV541243)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541244] (https://www.ncbi.nlm.nih.gov/nuccore/PV541244)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541245] (https://www.ncbi.nlm.nih.gov/nuccore/PV541245)

[https://www.ncbi.nlm.nih.gov/nuccore/PV541246] (https://www.ncbi.nlm.nih.gov/nuccore/PV541246)

Upon reasonable request, the corresponding author will provide any other datasets generated and examined during the current work.

Declarations

Ethics approval and consent to participate

Informed consent to participate was obtained from all of the participants in the study. The Ethical approval for the study was obtained from the Research and Ethics committee of Alex Ekwueme Federal University Teaching Hospital, Abakaliki, Ebonyi State, Nigeria prior to the commencement of this research work, with reference number; AE-FUTHA/REC/VOL.3/2021/168. All samples collected from the hospital under investigation were processed and handled according to the Helsinki principles for human and animal research.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.