Abstract
Background
Oxidative stress plays a pivotal role in cellular aging, and dietary antioxidants may modulate this process through regulation of the aging-related Klotho gene. This cross-sectional study investigated the association between dietary total antioxidant capacity (DTAC) and Klotho gene expression in 50 healthy Iranian adults (aged 18–40 years).
Methods
Using validated food frequency questionnaires, we calculated DTAC (mmol Trolox equivalents/day) and assessed Klotho mRNA levels in peripheral blood mononuclear cells (PBMCs) via RT-PCR (ΔCt method). Linear regression models evaluated these associations, with Model 1 showing crude associations and Model 2 adjusting for age, sex, BMI, waist circumference, physical activity, and fiber intake.
Results
Unadjusted analysis revealed DTAC significantly predicted Klotho expression (β = -0.662, p < 0.001, R² = 0.438), with higher antioxidant intake associated with lower ΔCt values (indicating greater Klotho expression). This association remained significant after full adjustment (β = -0.599, p = 0.002, Adjusted R² = 0.381). Notably, among individual antioxidants, only zinc maintained an independent inverse relationship with ΔCt Klotho in the adjusted model (β = -0.439, p = 0.016), while other antioxidants lost significance.
Conclusion
These findings demonstrate that higher dietary antioxidant intake, particularly zinc, is significantly associated with increased Klotho gene expression, suggesting a potential mechanism by which antioxidant-rich diets may influence aging processes. This study provides novel evidence linking DTAC to Klotho expression in humans, supporting further investigation into dietary strategies for modulating aging-related pathways.
Keywords: Klotho protein, Human, Gene expression regulation, Antioxidants, Diet, Oxidative stress
Introduction
The critical role of nutrition in longevity and healthy aging has become increasingly evident in epidemiological research [1]. Oxidative damage from reactive oxygen species (ROS) represents a fundamental mechanism underlying cellular aging [2], with dietary antioxidants serving as crucial modulators of this process [3]. The U.S. Food and Drug Administration recognizes dietary antioxidants as compounds capable of mitigating ROS-mediated damage [4], with abundant sources including fruits, vegetables, nuts, and whole grains [5]. Importantly, the collective antioxidant potential of one’s diet, quantified as dietary total antioxidant capacity (DTAC), may provide a more comprehensive assessment of antioxidant exposure than individual nutrient analysis [6].
In recent years, the molecule klotho has emerged as a new player in inhibiting ROS and oxidative stress [7]. Originally identified through its association with premature aging in knockout mice [8], Klotho exists in three isoforms (α, β, γ) [9], with circulating α-Klotho demonstrating particular relevance to anti-aging processes [10]. Mechanistically, α-Klotho enhances cellular resistance to oxidative stress by modulating insulin/IGF-1 signaling pathways [11], establishing a potential link between dietary antioxidants and Klotho-mediated longevity.
Despite these advances, research examining dietary influences on Klotho expression remains limited. While some studies report positive associations between antioxidant-rich Mediterranean diets and soluble Klotho levels [12, 13], others show contradictory findings [14]. Notably, no previous investigation has examined DTAC in relation to Klotho gene expression in Peripheral Blood Mononuclear Cells (PBMCs) - a clinically relevant and accessible tissue for human studies [7]. Our study addresses this gap by providing the first analysis of DTAC-Klotho relationships at the gene expression level.
Methods
Study design and participants
Prior to the commencement of the study, informed consent was obtained from all participants involved. The study was formally approved by the ethics committee of the National Nutrition & Food Technology Research Institute, Shahid Beheshti University of Medical Sciences (IR.SBMU.NNFTRI.REC.1403.038). In adherence to the Helsinki Declaration of 1975, as revised in 2013 [15], and the ethical guidelines set by the responsible committee on human experimentation, the entire procedure was carried out.
This cross-sectional study enrolled 50 healthy adults (aged 18–40 years) with normal BMI (18.5–25 kg/m²) between September-December 2024. Participants were excluded based on comprehensive health criteria: current smoking; pregnancy/lactation; presence of metabolic syndrome (assessed through clinical measurements of waist circumference, blood pressure, fasting glucose, and lipid profile); acute/chronic diseases (cardiovascular conditions, diabetes, renal disorders, cancer, or inflammatory diseases); use of any regular medications for medical conditions; recent antioxidant supplementation (past 3 months); or adherence to special diets. All included participants demonstrated absence of metabolic syndrome components through screening and reported no regular medication use, confirming their metabolically healthy, treatment-naive status.
Gene expression of the Klotho
RNA extraction and cDNA synthesis from PBMCs
PBMCs were obtained from EDTA anticoagulated blood. The Ficoll-Lymphodex (Inno-Train, Germany) gradient separation method was used for isolation, followed by the addition of RNX-plus solution (Cinaclone, Iran), and stored at −80 °C for RNA extraction. Total RNA was extracted from PBMCs using RNX-Plus solution following the manufacturer’s protocol (Cinaclone, Iran). A total of 5 µg of total RNA was used for complementary DNA (cDNA) synthesis (Yekta Tejhiz Azma, Iran) according to the manufacturer’s instructions.
Real-Time Polymerase Chain Reaction (Real-Time RT‒PCR)
Real-time PCR was performed in duplicate for the genes Klotho and GAPDH (used as an internal control). The reaction mixture consisted of 10 µl of RealQ Plus 2x Master Mix Green (with high ROX, Ampliqon, Denmark), 7 µl of double distilled water, 0.5 µl of forward primer (10 pmol/µL), 0.5 µl of reverse primer (10 pmol/µL), and 2 µL of cDNA in a total volume of 20 µL. After a denaturation step at 95 °C for 15 min, 40 amplification cycles were performed. Each cycle included a denaturation step at 95 °C for 25 s and an annealing step at 60 °C for 30 s for Klotho, and GAPDH. The melting curve ranged from 60 to 95 °C (StepOnePlus; Real-Time PCR, Applied Biosciences, Paisley, UK). The sequence of each primer was designed according to the protocols (Table 1), and after completion of the real-time PCR, its validity was confirmed by agarose gel electrophoresis. The threshold cycle (Ct) values for Klotho were normalized to the Ct values of the reference gene GAPDH to account for variations in input RNA and efficiency of reverse transcription. The normalized expression level of Klotho was calculated using the ΔCt method as follows: ΔCt = CtKlotho − CtGAPDH.
Table 1.
List of primers used for real-time PCR. (Sequence 5’ → 3’)
| Human gene | Forward primer | Reverse primer | Product Lengths (base pair) |
|---|---|---|---|
| Klotho | GTGATGAGGGACTGGCTGAAC | GTCTACAAGGATGGTGGTATAATGG | 129 |
| GAPDH | CATCAAGAAGGTGGTGAAGCAG | GCGTCAAAGGTGGAGGAGTG |
A lower ΔCt value indicates higher expression of Klotho relative to GAPDH. These ΔCt values were used directly for statistical analysis to evaluate the association between DTAC and Klotho gene expression.
Dietary assessment
The participants’ diets were evaluated using an approved and well-trained team of dietitians. They utilized a previously validated semi-quantitative food frequency questionnaire (FFQ) to assess the participants’ food intake over the course of a year [16]. To enhance the accuracy of food quantification, the interviews incorporated a comprehensive evaluation and description of the food consumed using colored photographs of various portion sizes (food album). The nutrient content of the selected foods was determined using the United States Department of Agriculture’s Nutrient Data Laboratory database and was calculated using the oxygen radical absorbance capacity (ORAC) method to measure the DTAC [17]. The results were reported in millimoles (mmol) of Trolox Equivalents (TE) per day. Additionally, the DTAC was adjusted for total energy intake using the residual method.
Socio-demographic, anthropometrics and physical activity
Socio-demographic data regarding age, sex, marital status, education level, history of medication and supplement usage, and monthly family income were collected through responses to the pretested baseline questionnaire. Due to cultural and religious beliefs of the subjects, information on alcohol and opium consumption was not gathered in this particular study.
Weight was recorded with a precision of 0.1 kg, and height with a precision of 0.1 cm, utilizing a Seca Electronic scale (model 799, Germany) and a stadiometer in accordance with the protocol established by the International Society for the Advancement of Kinanthropometry [18]. BMI was computed by dividing weight by height squared (kg/m2). Waist circumference was measured at the halfway point between the iliac crest and the lower boundary of the rib cage, following a normal exhalation.
Physical activity levels were assessed using a previously validated questionnaire that involved interviews. This questionnaire consisted of nine different categories of metabolic equivalent (MET), which ranged from sleep/rest (0.9) to high-intensity activities (> 6). By multiplying the duration of each activity by its corresponding MET value, the MET hours for each activity were calculated. The total MET hours per day were then determined by summing the MET hours for all the different activities performed throughout the day [19, 20].
Statistical analysis
All analyses were performed using SPSS 20 (IBM Corp.) with α = 0.05. Normality was assessed using Kolmogorov-Smirnov tests supplemented by visual inspection of Q-Q plots and histograms. Continuous variables were expressed as mean ± SD (normally distributed) or median (IQR; non-normal), while categorical variables were reported as n (%). Between-group comparisons employed independent t-tests (normal data) or Mann-Whitney U tests (non-normal data). Chi-square tests evaluated categorical differences. For primary analyses, we constructed two linear regression models examining DTAC-Klotho relationships: Model 1 (unadjusted) and Model 2 (adjusted for age, sex, BMI, waist circumference, physical activity, and fiber intake). Standardized β coefficients were reported with 95% confidence intervals where applicable. Effect sizes were interpreted using R² values, with p < 0.05 considered statistically significant.
Results
This cross-sectional study enrolled 50 participants (mean age 23.9 ± 3.8 years; 60% female) who were stratified by median dietary total antioxidant capacity (DTAC = 11.3 mmol/day). As detailed in Table 2, the low (< 11.3 mmol/day) and high (≥ 11.3 mmol/day) DTAC groups were well-matched across all demographic parameters. No significant age difference was observed between the low and high DTAC groups (23.9 ± 3.9 years vs. 23.8 ± 3.8 years, respectively; p = 0.921). Gender distribution did not differ significantly between groups, with 62.5% females in the low DTAC group compared to 57.7% in the high DTAC group (p = 0.729). The proportion of unmarried participants was comparable between groups (83.3% vs. 73.1% in low and high DTAC groups, respectively; p = 0.382). Educational levels were similarly distributed across both DTAC groups, with no significant differences in undergraduate, master’s or PhD student proportions (p = 0.869).
Table 2.
Baseline characteristics of participants stratified by median DTAC
| Variables | Total Participants (n = 50) | according to median DTAC (mmol/day) | P Value | |
|---|---|---|---|---|
| < 11.3 (n = 24) |
≥ 11.3 (n = 26) |
|||
| Age, y | 23.9 ± 3.8 | 23.9 ± 3.9 | 23.8 ± 3.8 | 0.921 |
| Gender | 0.729 | |||
| Female | 30 (60) | 15 (62.5) | 15 (57.7) | |
| Male | 20 (40) | 9 (37.5) | 11 (42.3) | |
| Marital status | 0.382 | |||
| Married | 11 (22) | 4 (16.7) | 7 (26.9) | |
| No married | 39 (78) | 20 (83.3) | 19 (73.1) | |
| Educational level | 0.869 | |||
| Undergraduate student | 21 (42) | 10 (41.7) | 11 (42.3) | |
| Master’s student | 18 (36) | 8 (33.3) | 10 (38.5) | |
| PhD student | 11 (22) | 6 (25) | 5 (19.2) | |
| PA (MET-hour/day) | 38.9 ± 5.5 | 38.3 ± 5.9 | 39.5 ± 5.1 | 0.432 |
| BMI (Kg/m2) | 22.2 ± 2.1 | 22.2 ± 2.1 | 22.1 ± 2.3 | 0.975 |
| WC (cm) | 81.8 ± 7.1 | 80.4 ± 6.3 | 83.2 ± 7.6 | 0.166 |
| Dietary Intakes | ||||
| Energy Intake (Kcal) | 2001 (1785–2458) | 1820 (1616–1985) | 2436 (2015–2698) | < 0.001 |
| Carbohydrate (g/day) | 270.2 (241.0–331.8) | 246 (220–268) | 329 (272–364) | < 0.001 |
| Protein (g/day) | 74.5 (66.9–90.7) | 68.2 (60.6–74.3) | 90.2 (76.8–101.2) | < 0.001 |
| Total fat (g/day) | 68.9 (61.5–84.7) | 62.7 (55.7–68.4) | 84.7 (69.4–91.5) | < 0.001 |
| Fiber (g/day) | 15.3 (12.0–19.1) | 12.3 (11.1–14.8) | 18.5 (15.9–20.8) | < 0.001 |
Values are expressed as mean ± SD (anthropometrics and demographics), median (Q1-Q3) (dietary data), or n (%) (categorical variables), as appropriate
BMI body mass index, DTAC dietary total antioxidant capacity, MET metabolic equivalent, PA physical activity, WC waist circumference
The low and high DTAC groups showed nearly identical anthropometric profiles, with no significant differences in BMI (22.2 ± 2.1 vs. 22.1 ± 2.3 kg/m², p = 0.975) or waist circumference (80.4 ± 6.3 vs. 83.2 ± 7.6 cm, p = 0.166). Physical activity levels were similarly balanced between groups (38.3 ± 5.9 vs. 39.5 ± 5.1 MET-hour/day, p = 0.432).
Table 3 reveals significant differences in antioxidant intake between high and low Klotho expressors. Participants with higher Klotho gene expression (lower ΔCt values) in PBMCs demonstrated markedly greater DTAC (12.3 vs. 10.6 mmol/day, p = 0.003), vitamin C (99 vs. 87 mg/day, p = 0.013), lycopene (1878 vs. 1584 µg/day, p = 0.003), zinc (12.2 vs. 9.6 mg/day, p = 0.010), and selenium (65 vs. 55 µg/day, p = 0.038). While α-tocopherol intake showed no significant difference (p = 0.484), β-carotene approached marginal significance (p = 0.059).
Table 3.
Comparison of energy-adjusted antioxidant intake between groups with high and low Klotho gene expression in PBMCs
| Variables | Total Participants (n = 50) | Klotho Expression (ΔCt) | P Value | |
|---|---|---|---|---|
| Low Klotho Expressors (n = 25) | High Klotho Expressors (n = 25) | |||
| Dietary TAC (mmol/day) | 11.3 (9.7–12.7) | 10.6 (8.9–11.9) | 12.3 (10.6–15.1) | 0.003 |
| α-Tocopherol (mg/day) | 5.6 (4.2–6.3) | 5.5 (3.6–6.3) | 5.6 (4.5–6.2) | 0.484 |
| Vitamin C (mg/day) | 98 (84–102) | 87 (81–99) | 99 (96.5–105.5) | 0.013 |
| β-Carotene (µg/day) | 1658 (1490–1785) | 1569 (1457–1697) | 1700 (1511–1885) | 0.059 |
| Lycopene (µg/day) | 1699 (1500–1900) | 1584 (1362–1728) | 1878 (1629–1990) | 0.003 |
| Zinc (mg/day) | 10.7 (9.1–13.5) | 9.6 (8.3–11.3) | 12.2 (10.1–15.5) | 0.010 |
| Selenium(µg/day) | 59 (47.8–69) | 55 (44–67) | 65 (53–76) | 0.038 |
Values are expressed as median (Q1-Q3)
Table 4 presents two linear regression models examining the association between dietary antioxidant intakes and Klotho gene expression (ΔCt) in PBMCs. Model 1 shows the crude (unadjusted) association, while Model 2 adjusts for potential confounders including age, sex, BMI, WC, physical activity, and fiber intake. A simple linear regression revealed that DTAC significantly predicted ΔCt Klotho levels (β = −0.662, p < 0.001, R² = 0.438), indicating that higher antioxidant intake was associated with lower ΔCt values (higher Klotho expression). After adjusting for confounders, DTAC remained significantly associated with ΔCt Klotho (β = −0.599, p = 0.002, Adjusted R² = 0.381). In the fully adjusted model, dietary zinc showed a significant independent inverse relationship with ΔCt Klotho (β=−0.439, p = 0.016), suggesting enhanced Klotho expression with higher zinc intake. Notably, this association persisted while other antioxidants lost statistical significance (all p > 0.05) after adjustment for covariates.
Table 4.
Linear regression of the association between dietary antioxidant variables and Klotho gene expression in PMBCs
| Model 1 | Model 2* | |||
|---|---|---|---|---|
| Dietary antioxidant variables | Standardized β | P Value | Standardized β | P Value |
| Dietary TAC (mmol/day) | − 0.662 | < 0.001 | −0.599 | 0.002 |
| α-Tocopherol (mg/day) | − 0.055 | 0.706 | − 0.122 | 0.357 |
| Vitamin C (mg/day) | − 0.331 | 0.019 | − 0.133 | 0.458 |
| β-Carotene (µg/day) | − 0.410 | 0.003 | − 0.234 | 0.117 |
| Lycopene (µg/day) | − 0.355 | 0.011 | − 0.168 | 0.236 |
| Zinc (mg/day) | − 0.546 | < 0.001 | − 0.439 | 0.016 |
| Selenium (µg/day) | − 0.439 | 0.001 | − 0.534 | 0.596 |
*Model 2 adjusted for age, sex, body mass index, waist circumference, physical activity level, and dietary fiber intake
Discussion
This study provides novel evidence that DTAC is significantly associated with enhanced Klotho gene expression in human PBMCs of young Iranian adults, with zinc emerging as a particularly potent modulator of this aging-related pathway. Our findings extend previous research on antioxidant-Klotho relationships by demonstrating three key advances: (1) establishing DTAC as a comprehensive dietary predictor of Klotho expression beyond individual nutrients, (2) identifying PBMCs as a viable tissue for monitoring nutritional influences on Klotho, and (3) revealing zinc’s unique role in maintaining this association after full adjustment for confounders. The robust dose-response relationship suggests that antioxidant-rich diets may directly upregulate Klotho expression, potentially offering a nutritional strategy to mitigate oxidative stress-associated aging.
While our findings demonstrate a clear association between DTAC and Klotho expression, these results must be interpreted within the broader context of Klotho’s complex regulatory mechanisms. Emerging evidence reveals that Klotho expression is governed by an intricate interplay of genetic, epigenetic, and nutritional factors. Genetic polymorphisms such as the G-395 A promoter variant and KL-VS haplotype significantly influence tissue-specific expression patterns and functional outcomes, particularly in cardiovascular and metabolic diseases [21]. At the epigenetic level, chromatin remodeling and cis-regulatory elements dynamically modulate Klotho expression, with documented dysregulation in chronic conditions like kidney disease [22]. Our observed DTAC-Klotho association may partially reflect antioxidant-mediated epigenetic modulation, though this requires experimental verification. Beyond total antioxidant capacity, specific nutrients exhibit distinct Klotho-regulatory properties: zinc (which remained significant in our adjusted models) demonstrates sex-dependent effects in murine models [23], while potassium upregulates renal Klotho through aldosterone signaling [24] and phosphorus intake shows an inverse U-shaped relationship with expression levels [23]. Vitamin E has also been shown to induce renal Klotho during oxidative injury [25]. This multilayered regulation underscores that while DTAC captures important dietary influences, the net effect on Klotho expression likely represents integration across genetic background, epigenetic landscape, and specific nutrient interactions—a fundamental complexity in nutritional genomics research that future nutrigenomic studies should address.
The findings of this study align with and extend the growing body of evidence linking dietary patterns to Klotho regulation, while introducing novel insights into the role of DTAC and zinc. Our observation of a positive association between DTAC and Klotho gene expression in peripheral PBMCs corroborates findings from He et al., who reported a similar relationship between their Composite Dietary Antioxidant Index (CDAI) and soluble Klotho levels in middle-aged populations [26]. Both studies highlight the importance of cumulative antioxidant intake, though ours advances this field by demonstrating effects at the gene expression level and identifying zinc as a key mediator. The inverse association between pro-inflammatory diets [27] and Klotho levels further supports our findings, as DTAC inherently reflects anti-inflammatory dietary components. Zhang et al.’s demonstration of a threshold effect (DII = −1.82) aligns with our dose-response relationship, suggesting a nonlinear interplay between dietary quality and Klotho regulation [27]. Similarly, Wu et al. [12] identified the Mediterranean diet—a pattern rich in antioxidants—as positively associated with s-Klotho, though their focus on specific food components (e.g., fruits, dairy) contrasts with our whole-diet DTAC approach. Notably, while Wu et al. [12] found fruit intake - a major source of vitamin C – significant, our adjusted models showed vitamin C lost significance, possibly reflecting population differences (young Iranians vs. U.S. adults) or methodological variations (gene expression vs. serum protein measurement).
Our results resonate strongly with studies examining broader dietary indices. Liu et al. [28] and Ma et al. [29] demonstrated positive associations between dietary fiber/HEI-2015 scores and Klotho, consistent with our findings that high-DTAC diets (often fiber-rich) upregulate Klotho expression. The dose-response relationship we observed mirrors Ma et al.’s threshold effect (HEI-2015 > 45.15), reinforcing the concept of a “critical level” of dietary quality required to influence aging biomarkers. Cai et al. [30] further contextualizes these findings by showing Klotho’s mediating role in translating dietary quality to organ function, suggesting our observed gene expression changes may have systemic health implications. However, our study diverges from some earlier work in key aspects. Unlike Pathare et al. [7], who reported reduced Klotho expression in hypertensive patients, our healthy participants showed no such deficit, potentially highlighting Klotho’s role as both a biomarker and therapeutic target. Additionally, while our adjusted models revealed zinc’s unique significance among antioxidants, this contrasts with Wu et al.’s [12] emphasis on fruit-derived nutrients, possibly due to differences in dietary assessment methods (FFQ vs. 24-hour recall) or population-specific dietary patterns.
The observed association between DTAC and increased Klotho gene expression likely reflects a synergistic interplay between exogenous antioxidants and endogenous cytoprotective pathways. At the molecular level, excessive reactive oxygen and nitrogen species (ROS/RNS) overwhelm cellular defense mechanisms, triggering oxidative damage to lipids, proteins, and DNA—a key driver of aging and age-related diseases [31]. Dietary antioxidants mitigate this damage by directly scavenging free radicals and supporting endogenous antioxidant systems, including enzymatic (e.g., superoxide dismutase, catalase) and non-enzymatic (e.g., glutathione) defenses [32]. Notably, Klotho emerges as a critical mediator of these protective effects through multiple interconnected mechanisms: (1) Oxidative Stress Regulation: Klotho upregulates antioxidant protein expression (e.g., Nrf2 pathway targets) while suppressing ROS-generating enzymes (e.g., NADPH oxidases), creating a favorable redox environment [33]. (2) Growth Factor Modulation: By inhibiting insulin/IGF-1 and Wnt signaling pathways, Klotho reduces oxidative stress-induced cellular senescence and maintains mitochondrial function [34]. (3) Anti-inflammatory Action: Klotho attenuates NF-κB-mediated inflammation, which is both a cause and consequence of oxidative stress [33]. (4) Organ Protection: Experimental models demonstrate Klotho’s ability to preserve kidney function by suppressing fibrotic pathways activated by oxidative damage [35].
The link between DTAC and Klotho may operate through a feed-forward loop: dietary antioxidants reduce baseline oxidative stress, which (a) decreases oxidative inhibition of Klotho transcription and (b) enhances Klotho’s capacity to further activate antioxidant defenses. This is particularly relevant in the vasculature and brain, where Klotho’s protection against endothelial dysfunction and neuronal apoptosis depends on redox homeostasis [36]. The prominent role of zinc in our findings aligns with its dual function as both an antioxidant cofactor (e.g., in superoxide dismutase) and a potential epigenetic regulator of Klotho expression. These mechanistic insights suggest that high-DTAC diets may amplify Klotho’s anti-aging effects by simultaneously reducing oxidative burden and potentiating Klotho-mediated cytoprotection—a paradigm with implications for preventing age-related decline in renal, cardiovascular, and neurological function [36]. Future research should explore whether antioxidant supplementation can directly upregulate Klotho in oxidative stress-prone tissues.
This study has several notable strengths that enhance the validity of our findings. First, we utilized PBMCs as a clinically accessible yet biologically relevant tissue for assessing Klotho gene expression, with existing evidence suggesting a positive correlation between PBMC-derived mRNA and systemic protein levels [7]. Second, our dietary assessment employed a validated FFQ complemented by portion-size photographs, enabling comprehensive evaluation of both habitual intake and seasonal variations - a significant advantage over single 24-hour recall methods. Third, we calculated DTAC from foods using the ORAC method, providing a holistic measure of antioxidant exposure. Fourth, our rigorous adjustment for key confounders (age, sex, BMI, physical activity, and fiber intake) strengthens the robustness of the observed associations. However, several limitations warrant consideration. The cross-sectional design precludes causal inference about the relationship between DTAC and Klotho expression. While we controlled for major demographic and lifestyle factors, unmeasured confounders—including genetic polymorphisms (e.g., KL-VS haplotype), epigenetic modifications, and specific nutrient interactions (e.g., phosphorus-zinc balance)—may influence Klotho expression independently of dietary antioxidants. Additionally, while the ORAC method provides a standardized metric for comparing antioxidant capacity across foods, its biological relevance has been questioned since ORAC values reflect in vitro activity that may not fully translate to in vivo effects. The USDA’s discontinuation of ORAC values underscores these limitations, particularly regarding extrapolation to physiological outcomes. Although we could not measure plasma oxidative stress markers to validate our DTAC estimates, future studies should incorporate such biomarkers to strengthen biological interpretation. While our sample size (n = 50) provided sufficient statistical power (80% at α = 0.05) to detect clinically relevant associations (r ≥ 0.38) between DTAC and Klotho expression, several considerations warrant caution. First, the modest sample may have limited our ability to detect smaller (yet potentially biologically important) effect sizes or to conduct meaningful subgroup analyses. Second, while participants were carefully selected to represent healthy Iranian adults aged 18–40 years, the homogeneity of our cohort may affect generalizability to other demographic groups or populations with different dietary patterns. Third, the inherent variability in both dietary assessment methods and gene expression measurements suggests that larger replication studies would be valuable to confirm the robustness of our findings. These results should therefore be interpreted as providing preliminary evidence that requires validation in more diverse, population-based cohorts. Although we used the comprehensive database for antioxidant values, its coverage of traditional Iranian foods and herbal products was incomplete, potentially introducing measurement error. Financial constraints prevented measurement of serum Klotho protein levels, leaving the translational relevance of our gene expression findings to be confirmed. Additionally, while FFQs capture long-term intake better than recalls, they remain subject to reporting biases inherent to self-reported dietary data.
Future longitudinal studies with larger, more diverse samples should incorporate both gene expression and protein measurements while utilizing more comprehensive antioxidant databases that include region-specific foods. Intervention trials could further elucidate whether targeted dietary modifications can causally influence Klotho expression.
Conclusions
This study provides compelling evidence that dietary total antioxidant capacity (DTAC) is significantly associated with enhanced Klotho gene expression in PBMCs, with zinc emerging as a particularly potent nutritional modulator of this aging-related pathway. Our findings bridge critical gaps in nutritional gerontology by: establishing DTAC as a comprehensive metric for assessing antioxidant-Klotho relationships beyond individual nutrients, validating PBMCs as a practical tissue for monitoring nutritional influences on aging biomarkers, and identifying zinc’s unique role in maintaining Klotho expression independent of other dietary and lifestyle factors. The robust dose-response relationship suggests that antioxidant-rich diets may directly upregulate Klotho, potentially offering a dietary strategy to counteract oxidative stress-associated aging.
Acknowledgements
This research was supported by National Nutrition and Food Technology Research Institute, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Grant No. 03-43010180). The funder had no role in the study design, data collection and interpretation, or the decision to submit the work for publication.
Authors’ contributions
Conceptualization, G.E. and A.G.; methodology, H.Z.; validation, G.E. and A.G.; formal analysis, Z.R., M.M. and G.E.; investigation, Z.R., S.V.F., M.M. and H.Z.; resources, Z.R., M.M. and S.V.F.; data curation, G.E. and A.G.; writing—original draft preparation, Z.R.; writing—review and editing, G.E. and A.G.; visualization, L.Z., X.C. and N.L.; supervision, G.E. and A.G.; project administration, G.E.; funding acquisition, G.E. All authors have read and agreed to the published version of the manuscript.
Funding
This research was supported by National Nutrition and Food Technology Research Institute, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Grant No. 03-43010180). The funding was specifically allocated for the execution of this project and did not cover publication-related expenses.
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
The study was formally approved by the ethics committee of the National Nutrition & Food Technology Research Institute, Shahid Beheshti University of Medical Sciences (IR.SBMU.NNFTRI.REC.1403.038). Written informed consent was obtained from all participants prior to their inclusion in the study.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Ghazaleh Eslamian, Email: gh.eslamian@sbmu.ac.ir, Email: gh_eslamian@yahoo.com.
Arman Ghorbani, Email: arman.ghorbani@sbmu.ac.ir, Email: ghorbani.nut@gmail.com.
References
- 1.Fontana L, Partridge L. Promoting health and longevity through diet: from model organisms to humans. Cell. 2015;161(1):106–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Liguori I, Russo G, Curcio F, Bulli G, Aran L, Della-Morte D, et al. Oxidative stress, aging, and diseases. Clin Interv Aging. 2018;13:757–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Chaudhary P, Janmeda P, Docea AO, Yeskaliyeva B, Abdull Razis AF, Modu B, et al. Oxidative stress, free radicals and antioxidants: potential crosstalk in the pathophysiology of human diseases. Front Chem. 2023;11: 1158198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Dewell A, Tsao P, Rigdon J, Gardner CD. Antioxidants from diet or supplements do not alter inflammatory markers in adults with cardiovascular disease risk. A pilot randomized controlled trial. Nutr Res. 2018;50:63–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Abeyrathne E, Nam K, Huang X, Ahn DU. Plant- and animal-based antioxidants’ structure, efficacy, mechanisms, and applications: a review. Antioxidants. 2022. 10.3390/antiox11051025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang Y, Yang M, Lee SG, Davis CG, Koo SI, Chun OK. Dietary total antioxidant capacity is associated with diet and plasma antioxidant status in healthy young adults. J Acad Nutr Diet. 2012;112(10):1626–35. [DOI] [PubMed] [Google Scholar]
- 7.Pathare G, Raju S, Mashru M, Shah V, Shalia K. Gene expression of Klotho & antioxidative enzymes in peripheral blood mononuclear cells of essential hypertension patients in Indian population. Indian J Med Res. 2020;152(6):607–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Matsumura Y, Aizawa H, Shiraki-Iida T, Nagai R, Kuro-o M, Nabeshima Y. Identification of the human Klotho gene and its two transcripts encoding membrane and secreted Klotho protein. Biochem Biophys Res Commun. 1998;242(3):626–30. [DOI] [PubMed] [Google Scholar]
- 9.Liu Y, Chen M. Emerging role of α-Klotho in energy metabolism and cardiometabolic diseases. Diabetes Metab Syndr. 2023;17(10): 102854. [DOI] [PubMed] [Google Scholar]
- 10.Cheikhi A, Barchowsky A, Sahu A, Shinde SN, Pius A, Clemens ZJ, et al. Klotho: an elephant in aging research. J Gerontol A Biol Sci Med Sci. 2019;74(7):1031–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kurosu H, Yamamoto M, Clark JD, Pastor JV, Nandi A, Gurnani P, et al. Suppression of aging in mice by the hormone Klotho. Science. 2005;309(5742):1829–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wu SE, Chen YJ, Chen WL. Adherence to mediterranean diet and soluble Klotho level: the value of food synergy in aging. Nutrients. 2022;14:19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jurado-Fasoli L, Castillo MJ, Amaro-Gahete FJ. Dietary inflammatory index and S-Klotho plasma levels in middle-aged adults. Nutrients. 2020. 10.3390/nu12020281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jurado-Fasoli L, Amaro-Gahete FJ, De-la OA, Martinez-Tellez B, Ruiz JR, Gutiérrez Á, et al. Adherence to the mediterranean diet, dietary factors, and S-Klotho plasma levels in sedentary middle-aged adults. Exp Gerontol. 2019;119:25–32. [DOI] [PubMed] [Google Scholar]
- 15.World Medical Association Declaration. Of helsinki: ethical principles for medical research involving human subjects. JAMA. 2013;310(20):2191–4. [DOI] [PubMed] [Google Scholar]
- 16.Mirmiran P, Esfahani FH, Mehrabi Y, Hedayati M, Azizi F. Reliability and relative validity of an FFQ for nutrients in the Tehran lipid and glucose study. Public Health Nutr. 2010;13(5):654–62. [DOI] [PubMed] [Google Scholar]
- 17.Haytowitz DB, Bhagwat S. USDA database for the oxygen radical absorbance capacity (ORAC) of selected foods, release 2. US Dep Agric. 2010;3(1):10–48. [Google Scholar]
- 18.Norton K (2018) Standards for anthropometry assessment. In: Norton K, Roger E (eds) Kinanthropometry and exercise physiology. Routledge, London, pp 68–137
- 19.Aadahl M, Jørgensen T. Validation of a new self-report instrument for measuring physical activity. Med Sci Sports Exerc. 2003;35(7):1196–202. [DOI] [PubMed] [Google Scholar]
- 20.Mirzaei M, Asghari-Jafarabadi M, Amini-Sani N, Bakhtari-Aghdam F, Dastgiri S. Psychometric evaluation of a self-reported physical activity questionnarie used in the pilot phase of the AZAR cohort study. Health Promot Perspect. 2016;6(3):152–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Donate-Correa J, Martín‐Núñez E, Martínez‐Sanz R, Muros‐de‐Fuentes M, Mora‐Fernández C, Pérez‐Delgado N, et al. Influence of Klotho gene polymorphisms on vascular gene expression and its relationship to cardiovascular disease. J Cell Mol Med. 2016;20(1):128–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Xu P, Jiang M, Chen J, Zhou Y, Wang Z. The long-range chromosomal interaction controlling Klotho gene expression in human chronic kidney disease. ACS Omega. 2024;9(52):51264–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Morishita K, Shirai A, Kubota M, Katakura Y, Nabeshima Y, Takeshige K, et al. The progression of aging in Klotho mutant mice can be modified by dietary phosphorus and zinc. J Nutr. 2001;131(12):3182–8. [DOI] [PubMed] [Google Scholar]
- 24.Jung HJ, Pham TD, Su XT, Grigore TV, Hoenderop JG, Olauson H, et al. Klotho is highly expressed in the chief sites of regulated potassium secretion, and it is stimulated by potassium intake. Sci Rep. 2024;14(1): 10740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.El-Gendey FE, Hemeda SA, Sosa GA, Alhusseini NF. Factors those up regulate Klotho and glutathione peroxidase-1 gene expression improve renal function in rats with acute renal failure. Am J Biochem Biotechnol. 2015;11(3):160. [Google Scholar]
- 26.He H, Chen X, Miao D, Zhang H, Wang Y, He X, et al. Composite dietary antioxidant index and plasma levels of soluble klotho: insights from NHANES. Oxid Med Cell Longev. 2023;2023:3524611. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 27.Zhang C, Zhang Z, Li J, Deng L, Geng J, Jin K, et al. Association between dietary inflammatory index and serum Klotho concentration among adults in the united States. BMC Geriatr. 2022;22(1): 528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Liu S, Wu M, Wang Y, Xiang L, Luo G, Lin Q, et al. The association between dietary fiber intake and serum Klotho levels in Americans: a cross-sectional study from the National Health and Nutrition Examination Survey. Nutrients. 2023. 10.3390/nu15143147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ma TC, Zhou J, Wang CX, Lin ZZ, Gao F. Associations between the healthy eating index-2015 and S-Klotho plasma levels: a cross-sectional analysis in middle-to-older aged adults. Front Nutr. 2022;9: 904745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Cai Q, Hu S, Qi C, Yin J, Xu S, Hou FF, et al. Serum anti-aging protein α-Klotho mediates the association between diet quality and kidney function. Nutrients. 2023. 10.3390/nu15122744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Pizzino G, Irrera N, Cucinotta M, Pallio G, Mannino F, Arcoraci V, et al. Oxidative stress: harms and benefits for human health. Oxid Med Cell Longev. 2017;2017:8416763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Jomova K, Alomar SY, Alwasel SH, Nepovimova E, Kuca K, Valko M. Several lines of antioxidant defense against oxidative stress: antioxidant enzymes, nanomaterials with multiple enzyme-mimicking activities, and low-molecular-weight antioxidants. Arch Toxicol. 2024;98(5):1323–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Prud’homme GJ, Wang Q. Anti-inflammatory role of the Klotho protein and relevance to aging. Cells. 2024. 10.3390/cells13171413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Yamamoto M, Clark JD, Pastor JV, Gurnani P, Nandi A, Kurosu H, et al. Regulation of oxidative stress by the anti-aging hormone Klotho. J Biol Chem. 2005;280(45):38029–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Donate-Correa J, Martín-Carro B, Cannata-Andía JB, Mora-Fernández C, Navarro-González JF. Klotho, oxidative stress, and mitochondrial damage in kidney disease. Antioxidants. 2023. 10.3390/antiox12020239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zavvari Oskuye Z, Mehri K, Khalilpour J, Nemati S, Hosseini L, Bafadam S, et al. Klotho in age-related cardiovascular diseases: insights into mitochondrial dysfunction and cell death. IJC Heart & Vasculature. 2025;57: 101629. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
No datasets were generated or analysed during the current study.