PMAIP1 mediates endoplasmic reticulum stress in human dental pulp stem cells during pulpitis pathogenesis

Abstract

Background

Pulpitis, characterized by dental pulp inflammation, significantly impacts oral health, yet its molecular mechanisms remain poorly understood. This study investigated the role of endoplasmic reticulum (ER) stress in pulpitis pathogenesis and explored its therapeutic potential.

Methods

We examined ER stress markers in human pulpitis specimens and lipopolysaccharide (LPS)-treated human dental pulp stem cells (hDPSCs). Transcriptomic analysis of public datasets (GSE98359) was performed to identify ER stress-related differentially expressed genes (DEGs). The therapeutic efficacy of 4-phenylbutyric acid (4-PBA), an ER stress inhibitor, was evaluated in both in vitro and in vivo pulpitis models.

Results

Significantly elevated expression of BiP and CHOP was observed in pulpitis specimens and LPS-treated hDPSCs. Bioinformatic analysis identified 19 ER stress-related DEGs in pulpitis, with PMAIP1 emerging as central regulators. Pathway analysis revealed significant enrichment in ER stress response, inflammatory signaling, and apoptotic pathways. 4-PBA treatment effectively attenuated both LPS-induced ER stress and inflammatory responses in hDPSCs and experimental pulpitis.

Conclusions

Our findings establish ER stress as a critical mediator in pulpitis pathogenesis and PMAIP1 is identified as a key regulatory hub. The therapeutic efficacy of 4-PBA suggests that targeting ER stress represents a promising strategy for pulpitis treatment.

Clinical significance

The demonstration of 4-PBA therapeutic efficacy provides a strong foundation for developing novel treatments targeting ER stress in pulpitis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12903-025-06843-0.

Introduction

Pulpal inflammation (pulpitis) poses a significant clinical challenge in contemporary dentistry, often manifesting as acute pain and potentially culminating in tooth loss without proper intervention [1]. Although the initial inflammatory cascade serves as a protective mechanism, persistent or severe inflammation can lead to irreversible pulpal damage and subsequent tissue necrosis [2–4]. Elucidating the underlying molecular pathways in pulpitis progression remains crucial for developing targeted therapeutic approaches.

Recent investigations have highlighted the endoplasmic reticulum (ER) stress response as a fundamental cellular mechanism with multifaceted roles in inflammatory conditions [5, 6]. The ER, which orchestrates protein folding and processing, maintains cellular equilibrium through the unfolded protein response (UPR) when challenged by various cellular stressors [7, 8]. The canonical UPR signaling cascade operates through three primary transmembrane sensors: PERK, IRE1α, and ATF6 [9]. These molecular sensors are typically maintained in their inactive configurations through interaction with the ER chaperone BiP/GRP78 [10]. Environmental and pathological stressors trigger BiP dissociation, activating these sensors and inducing CHOP expression, a critical transcriptional regulator in inflammation-mediated apoptosis [11]. Moreover, Caspase-12 activation, specifically associated with ER stress, has been linked to inflammatory signaling cascades and cellular death pathways in various tissue types [12]. Emerging evidence has demonstrated the involvement of ER stress and subsequent UPR activation in various oral pathologies, including periodontal disease and dental disease [13–15]. However, the precise mechanisms by which ER stress influences pulpitis development and progression remain inadequately understood.

While previous research has established the presence of pro-inflammatory mediators, including TNF-α, in pulpal inflammation, the upstream regulatory networks governing their expression patterns remain to be fully characterized [16, 17]. Understanding the potential interplay between ER stress and inflammatory responses in dental pulp tissue represents a critical knowledge gap in our comprehension of pulpitis pathogenesis.

In this study, we investigated the role of ER stress in pulpitis progression using both human pulp specimens and a rat pulpitis model. We hypothesized that ER stress mediates inflammatory responses in pulpitis through the CHOP/Caspase-12 pathway. Our findings provide new insights into the molecular mechanisms underlying pulpitis and suggest potential therapeutic strategies targeting ER stress for the treatment of pulpal inflammation.

Materials and methods

Human pulp tissue collection

Human dental pulp tissues were obtained from healthy third molars, extracted from teeth diagnosed with irreversible pulpitis at Shenzhen Stomatology Hospital. Patient inclusion criteria: Patients aged 18 to 22 years without underlying diseases or periodontal disease. Nine cases of pulpitis third molars extracted for treatment purposes, with each patient independently diagnosed by two endodontic specialists. Nine healthy, caries-free third molars were selected as controls. Pulp samples were obtained by crown splitting and immediately placed in 4% paraformaldehyde fixative, stored at 4 °C for 48 h, then paraffin-embedded and sectioned into 3–5 μm thick sagittal sections for further use. All procedures were approved by the Institutional Ethics Committee of Shenzhen Stomatology Hospital.

Animal model

A total of 15 male Sprague-Dawley rats (8 weeks old, weighing 250–300 g) were purchased from Beijing Vital River Laboratory Animal Technology Company. For the pulpitis model, the left maxillary first molar was selected for pulpitis induction, while the right maxillary first molar of the same rat served as a negative control. The rats were anesthetized intraperitoneal injection of pentobarbital sodium (40 mg/kg body weight) before mechanical exposure of the pulp in their first Maxillary molar, which was achieved using a water-cooled round carbide bur. The exposed pulp was left open to the oral environment for 3 days before being sealed with glass ionomer cement. Glass ionomer cement was mixed at a water-to-powder ratio of 1:1 to form a paste-like consistency and then filled into the access cavity. The purpose of this treatment was to seal the pulp chamber, restore tooth morphology, and prevent further bacterial invasion. Successful establishment of pulpitis was confirmed as follows: rats were sacrificed on the 3rd day post-exposure, maxillary bone specimens were collected, and HE staining was performed to observe the degree of pulpal inflammation, neutrophil infiltration, and tissue necrosis.

The animals were randomly assigned to three experimental groups: sham-operated controls (underwent identical procedure without pulp exposure), untreated pulpitis, and pulpitis treated with 4-PBA (an ER stress inhibitor). At least three animals were included in each group. The administration details of 4-PBA in the animal model are as follows: a concentration of 5 mM was applied via local administration. Specifically, 5 mM 4-PBA was applied to collagen sponges for local pulp capping, followed by coronal glass ionomer filling and sealing. Administration occurred 3 days post-pulp exposure, and animals were sacrificed 4 days post-treatment (7 days post-pulp exposure). All animals were killed by cervical dislocation after anaesthesia with an intraperitoneal injection of pentobarbital sodium (40 mg/kg). This method was chosen due to its rapid and humane approach, minimizing suffering and ensuring a quick death. Maxillary bone specimens were collected on day 7 post-sacrifice. Subsequently, samples were placed in 4% paraformaldehyde fixative and stored at 4 °C for 48 h, followed by demineralization in 10% EDTA for 6 weeks with solution changes every 2 days. Tissues were paraffin-embedded and sectioned into 3–5 μm thick sagittal sections for further use.

The experimental protocols were approved by the Laboratory Animal Welfare & Ethics Committee of Bestcell Model Biological Center (approval number: 2025-1-21A).

Cell culture and treatment

Primary human dental pulp cells (hDPCs) were isolated from healthy premolars and third molars extracted from patients aged 13–23 years for orthodontic treatment. Teeth were placed in sterile culture dishes and washed 3–4 times with PBS until all surface blood was completely removed. Teeth were split to extract the pulp, with 2 mm of apical pulp tissue removed. Pulp tissue was placed in digestion solution containing 3 mg/ml type I collagenase (Invitrogen, 17100017) and 4 mg/ml dispase (Gibco, 17105041), thoroughly minced, and digested in a cell culture incubator for 1 h. Digestion was terminated with complete medium containing 10% fetal bovine serum, followed by centrifugation at 1000 rpm for 5 min. The supernatant was removed, and tissue blocks were resuspended in complete medium with 20% fetal bovine serum, seeded in T25 culture flasks, and placed in a cell culture incubator. Medium was changed every 2 days, and when cells reached 80% confluence, they were passaged using trypsin digestion. P3-P5 cells were used for experiments. For LPS stimulation, cells were treated with 1 µg/mL E. coli LPS (Sigma, L2880) for 24 h. Where indicated, cells were pretreated with 2 mM 4-phenylbutyric acid (4-PBA, MCE, HY-A0281) prior to LPS stimulation.

Flow cytometric analysis

To identify the cellular phenotype, hDPSCs at passage 3 were harvested and reconstituted in PBS at 1 × 10⁶ cells/mL. Surface antigen profiling was conducted through direct immunolabeling. The cell suspension underwent a 30-minute staining process at 4 °C in darkness using a panel of fluorochrome-conjugated monoclonal antibodies: PE-CD90 (BioLegend), PE-CD105 (BD Pharmingen), PerCP-Cy™5.5-CD44 (BD Pharmingen), FITC-CD34 (BioLegend), and FITC-CD45 (BioLegend). Following dual PBS washing procedures, antigen expression patterns were assessed on a FACSCalibur system (BD Biosciences). Expression profiles were processed and analyzed through FlowJo software.

Immunofluorescence staining

Tissue Sect. (4 μm) were deparaffinized, rehydrated, and subjected to antigen retrieval. After blocking, sections were incubated with primary antibodies against BiP (1:200), CHOP (1:200), Caspase-12 (1:200), and TNF-α (1:200) overnight at 4 °C. After washing, sections were incubated with appropriate fluorescent-labeled secondary antibodies and counterstained with DAPI. Images were acquired using a confocal microscope (Olympus).

Western blot analysis

Total protein was extracted using RIPA buffer supplemented with protease inhibitors. Protein concentrations were determined using the BCA assay. Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked and incubated with primary antibodies against BiP (Proteintech, 11587-1-AP, 1: 1000), CHOP (Proteintech, 15204-1-AP, 1: 1000), Caspase-12 (Proteintech, 55238-1-AP, 1: 1000), TNF-α (Proteintech, 17590-1-AP, 1: 1000), and GAPDH (Proteintech, 10494-1-AP, 1: 20000) overnight at 4 °C. After washing, membranes were incubated with HRP-conjugated secondary antibodies. Protein bands were visualized using an enhanced chemiluminescence system.

siRNA transfection

Chemical synthesized siRNAs targeting PMAIP1 and scrambled control siRNA were purchased from Tsingke Biotechnology. hDPSCs were seeded in 6-well plates and cultured to 70–80% confluence before transfection. Transfection was performed using Lipofectamine 3000 reagent according to the manufacturer’s instructions. siRNA was used at a final concentration of 50 nM. After 6 h of transfection, the medium was replaced with fresh complete culture medium.

Real-time PCR analysis

Total RNA was extracted using TRIzol reagent (Vazyme, Nanjing, China) and reverse transcribed using Reverse transcription reagents (Vazyme, Nanjing, China). Real-time PCR was performed using SYBR Green master mix (Vazyme, Nanjing, China). GAPDH served as an internal control. Relative gene expression was calculated using the 2^(-ΔΔCT) method. The following primers were used (Table 1):

Table 1.

Sequence of primers for qPCR and gene knockdown

Genes	Forward primer 5’−3’	Reverse primer 5’−3’
PMAIP1	ACCAAGCCGGATTTGCGATT	ACTTGCACTTGTTCCTCGTGG
HSPA5	CATCACGCCGTCCTATGTCG	CGTCAAAGACCGTGTTCTCG
DDIT3	GGAAACAGAGTGGTCATTCCC	CTGCTTGAGCCGTTCATTCTC
CASP12	AACAACCGTAACTGCCAGAGT	CTGCACCGGCTTTTCCACT
TNFA	GAGGCCAAGCCCTGGTATG	CGGGCCGATTGATCTCAGC
NOD2	CACCGTCTGGAATAAGGGTACT	TTCATACTGGCTGACGAAACC
PIK3R1	ACCACTACCGGAATGAATCTCT	GGGATGTGCGGGTATATTCTTC
THBS1	GCCATCCGCACTAACTACATT	GCCATCCGCACTAACTACATT
THBS4	TGTGATGGGACGCTTAAACAAA	ATTGTGAACGGAATCCACCTG
STC2	GGGTGTGGCGTGTTTGAATG	TTTCCAGCGTTGTGCAGAAAA
RCN3	CATGCGGGACATCGTGATTG	CTCGGCTGAGTACAGATCCG
FCGR2B	AGCCAATCCCACTAATCCTGA	GGTGCATGAGAAGTGAATAGGTG
RASGRF1	TCCTGTCGTGAACTGGACAAT	CTGCACTGGCTAAGGACATCC
NCCRP1	TGACGAACAACCAGCCATTAC	AGACATGCAGCTCATAGACGC
ATP2A3	CTGGTCATCATGCTGATCCTC	CAGCGTGGTGGACTTGATCT
GAPDH	ATTCCATGGCACCGTCAAGG	TCGCCCCACTTGATTTTGGA
si-PMAIP1#1	GGAACCUGACUGCAUCAAA	UUUGAUGCAGUCAGGUUCC
si-PMAIP1#2	CUGGAAGUCGAGUGUGCUA	UAGCACACUCGACUUCCAG

Bioinformatics analysis

Endoplasmic reticulum (ER) stress-related genes were obtained from the GeneCards database (https://www.genecards.org/). The gene expression dataset GSE98359 was downloaded from the Gene Expression Omnibus (GEO) database. Raw data were normalized and analyzed using R software (version 4.2.1). Principal component analysis (PCA) was performed to evaluate sample clustering. Differential expression analysis was conducted using the limma package, with the criteria of |log2FC| >1 and adjusted P value < 0.05 for identifying differentially expressed genes (DEGs). Volcano plots were generated using the ggplot2 package. Gene Ontology (GO) enrichment analysis including biological process (BP), cellular component (CC), and molecular function (MF) categories, as well as KEGG pathway analysis were performed using the clusterProfiler package. The significance threshold was set at P < 0.05. The Friend analysis was then performed using the GOSemSim package, which was conducted on human gene data (Homo sapiens), allowing for the identification of key genes involved in both pulpitis and ER stress responses based on gene similarity measures. GEPIA2 (http://gepia2.cancer-pku.cn/) were used to investigated the correlations between central regulators and ER stress and inflammatory markers.

Statistical analysis

Data are presented as mean ± standard deviation. Statistical analyses were performed using Prism 9.0 software. Group differences were analyzed using either the Student’s t-test, Welch’s t-test, or the Wilcoxon rank-sum test, depending on the data distribution and homogeneity of variances. P < 0.05 was considered statistically significant.

Results

Activation of ER stress signaling in pulpitis

To investigate the potential involvement of ER stress in pulpitis pathogenesis, we first examined the expression patterns of key ER stress markers in clinical specimens and established rat pulpitis model. Immunofluorescence analysis revealed significantly elevated expression of BiP and CHOP in pulpitis specimens compared to healthy pulp tissues (Fig. 1A, B), indicating activation of ER stress response during pulpal inflammation.

Fig. 1.

Activation of ER stress signaling in pulpitis (A, B) Immunohistochemistry analysis of BiP and CHOP expression in pulpitis specimens, healthy human pulp tissues, rat pulpitis model samples, and control rat pulp tissues. Scale bars: 20 μm. (C) Flow cytometric characterization of hDPSCs isolated from healthy dental pulp. hDPSCs demonstrated positive expression of mesenchymal markers (CD44, CD90, and CD105) and negative expression of hematopoietic markers (CD34 and CD45). (D, E) Immunofluorescence analysis of BiP and CHOP expression in hDPSCs treated with lipopolysaccharide. MFI: mean fluorescent intensity. ***P < 0.001. Scale bars: 20 μm. (F, G) Immunofluorescence analysis of TNFα and CASP12 expression in hDPSCs following LPS treatment. MFI: mean fluorescent intensity. *P < 0.05, **P < 0.01, ***P < 0.001. Scale bars: 20 μm

For mechanistic investigation, we isolated and characterized primary hDPSCs from healthy dental pulp tissues. Flow cytometric analysis confirmed their stem cell identity through positive expression of mesenchymal markers (CD73, CD90, and CD105) and negative expression of hematopoietic markers (CD34 and CD45) (Fig. 1C). When challenged with LPS (1 µg/mL, 24 h), these cells exhibited significant upregulation of BiP and CHOP (Fig. 1D, E), accompanied by increased expression of TNFα and the ER stress-specific apoptotic marker CASP12 (Fig. 1F, G). These findings establish a direct link between inflammatory stimuli and ER stress activation in dental pulp cells.

Transcriptomic analysis of pulpitis reveals global changes in gene expression and pathway activation

To gain comprehensive molecular insights into pulpitis pathogenesis, we performed bioinformatic analysis of transcriptomic data from public datasets (GSE98359). Quality control assessment showed that all samples met the standard criteria with uniform distribution (Fig. 2A). Principal component analysis (PCA) demonstrated clear segregation between healthy and inflamed pulp samples (Fig. 2B), reflecting distinct disease-associated transcriptional signatures. This analysis identified 2,218 differentially expressed genes (DEGs), with 1,683 upregulated and 535 downregulated genes in pulpitis specimens (Fig. 2C). Detailed GO analysis revealed significant enrichment in biological processes related to inflammatory response and immune regulation, particularly leukocyte-mediated immunity, leukocyte activation and cell-cell adhesion (Fig. 2D). Further examination of cellular components and molecular functions highlighted enrichment in plasma membrane organization, extracellular matrix composition, and immune receptor activity (Fig. 2D, E). KEGG pathway analysis identified multiple signaling cascades involved in inflammation and tissue homeostasis, notably cytokine-cytokine receptor interaction, cell adhesion molecules, and immune cell differentiation pathways (Fig. 2F). These findings demonstrate extensive immune and inflammatory pathway activation in pulpitis.

Fig. 2.

Transcriptomic analysis of pulpitis reveals global changes in gene expression and pathway activation (A) Quality control assessment of transcriptomic data from the GSE98359 dataset (B) Principal component analysis (PCA) demonstrating clear separation between healthy and inflamed pulp tissue samples. (C) Volcano plot of differentially expressed genes (DEGs) in pulpitis samples. (D-G) Gene Ontology (GO) enrichment analysis and KEGG pathway analysis of DEGs, highlighting biological processes, cellular components, molecular functions, and pathways relevant to pulpitis

Identification and characterization of ER Stress-Related DEGs in pulpitis

To specifically investigate ER stress involvement in pulpitis, we performed integrative analysis between pulpitis DEGs and ER stress-associated gene sets. This systematic approach identified 19 overlapping genes implicated in both processes (Fig. 3A, B). Key candidates including PMAIP1, NOD2, PIK3R1, THBS4, THBS1, STC2, RCN3, FCGR2B, RASGRF1, NCCRP1 and ATP2A3 exhibited significant differential expression (Fig. 3C). Correlation analysis revealed distinct expression relationships between these genes, visualized through heatmap representation (Fig. 3D). Strong positive correlations were observed between RASGRF1 and ATP2A3, as well as ABCA7 and RCN3, while negative correlations emerged between HSPA1A and RASGRF1 (represented in blue). Notably, PMAIP1 showed positive correlations with several key ER stress pathway components (e.g., GRP78, DDIT3, CASP12), suggesting its potential role in regulating ER stress in pulpitis. However, further experimental validation is needed to confirm its central regulatory role in pulpitis pathogenesis.

Fig. 3.

Identification and characterization of ER stress-related DEGs in pulpitis (A) Venn diagram showing overlap between pulpitis DEGs and ER stress-associated genes. (B) Heatmap representation of differentially expressed ER stress-related genes (C) Statistical analysis of differentially expressed ER stress-related genes based on TPM (transcripts per million) data between healthy and pulpitis samples. (D) Correlation analysis of ER stress-related genes. Positive correlations are shown in red, while negative correlations are in blue

Functional analysis of ER Stress-Associated gene networks in pulpitis

Comprehensive pathway analysis revealed significant enrichment of ER stress-related DEGs in critical biological processes and molecular pathways. GO analysis identified enrichment in response to ER stress, unfolded protein response, and extrinsic apoptotic signaling pathways (Fig. 4A-D). KEGG pathway analysis further highlighted involvement in TNF signaling, PI3K-Akt signaling, and P53 pathways, establishing mechanistic links between ER stress, inflammation, and tissue remodeling in pulpitis.

Fig. 4.

Functional analysis of ER stress-associated gene networks in pulpitis (A-D) Gene Ontology (GO) enrichment analysis and KEGG pathway analysis of ER stress-related DEGs, highlighting biological processes, cellular components, molecular functions, and pathways relevant to pulpitis. (E) Friend analysis displaying the mean similarity of ER stress-related gene networks in pulpitis. (F) RT-PCR validation of key ER stress-related DEGs in clinical specimens. *P < 0.05, **P < 0.01. “ns” indicates no significance. (G) Correlation analysis showing significant positive associations between key regulators (PMAIP1, NOD2, PIK3R1) and ER stress markers (GRP78, DDIT3) and CASP12, TNFα in whole blood. (H) RT-PCR validation of PMAIP1, HSPA5, DDIT3, CASP12 and TNFα in LPS treated hDPSCs with or without PMAIP1 knockdown. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Friend analysis quantitatively assessed gene network relationships, identifying PMAIP1 (mean similarity = 0.58318) as a central hub, followed by NOD2 (0.51487) and PIK3R1 (0.50451) (Fig. 4E). Genes with lower similarity, such as ATP2A3 (mean = 0.40918), exhibited relatively weaker connections within the gene network (Fig. 4E). RT-PCR validation confirmed significant upregulation of PMAIP1, NOD2, STC2, RCN3 and downregulation of PI3K3R in clinical specimens (Fig. 4F). PMAIP1, also known as NOXA, belongs to a pro-apoptotic subfamily within the BCL-2 protein family, referred to as the BCL-2 homology domain 3 (BH3)-only subfamily, which is regulated by various stress signals and plays a key role in apoptotic regulation [18]. Immunohistochemical analysis further confirmed the upregulation of PMAIP1 in inflamed pulp tissues (Fig. S1). GEPIA correlation analysis demonstrated significant positive associations between these key regulators (similarity mean exceeding 0.5) and established ER stress markers (GRP78, DDIT3) and inflammatory mediators (CASP12, TNFα) (Fig. 4G), further supporting the regulatory roles of PMAIP1, NOD2, and PIK3R1. Then, we performed siRNA-mediated PMAIP1 knockdown experiments to investigate its mechanistic role in ER stress. Following PMAIP1 knockdown, we evaluated both ER stress markers and downstream inflammatory responses under LPS stimulation. The results showed that PMAIP1 knockdown significantly reduced LPS-induced ER stress markers (HSPA5, CHOP) at mRNA level. Downstream apoptotic and inflammatory markers (CASP12, TNFA) were also decreased following PMAIP1 knockdown (Fig. 4H). These results demonstrate that PMAIP1 mediates ER stress induction and subsequent inflammatory responses in pulpitis, confirming its upstream regulatory role in this pathway.

Therapeutic targeting of ER stress attenuates pulpal inflammation

To evaluate the therapeutic potential of targeting ER stress in pulpitis, we examined the effects of the chemical chaperone 4-PBA. We examined PMAIP1 expression in rat pulpitis tissues after 4-PBA delivery. 4-PBA treatment reduced PMAIP1 expression compared to untreated pulpitis controls. This finding imply that 4-PBA therapeutic effects is mediated through downregulation of PMAIP1. Western blot analysis demonstrated that 4-PBA treatment effectively suppressed LPS-induced expression of BiP, CHOP, CASP12, and TNFα in hDPSCs (Fig. 5A-E). These findings were further validated in a rat pulpitis model, where 4-PBA administration significantly reduced the expression of inflammatory and ER stress markers (Fig. 5F). These results establish ER stress as a viable therapeutic target in pulpitis management.

Fig. 5.

Therapeutic targeting of ER stress attenuates pulpal inflammation (A-E) Western blot analysis of BiP, CHOP, CASP12, and TNFα expression in hDPSCs following LPS stimulation and treatment with the chemical chaperone 4-PBA. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. (F) H&E staining images of 4-PBA-treated pulp tissues and untreated pulpitis samples (scale bars: 100 μm), along with immunohistochemistry staining images of CASP12 and TNFα in 4-PBA-treated inflamed pulp tissues compared to untreated pulpitis samples. Scale bars: 20 μm

Discussion

Our study reveals novel molecular mechanisms underlying pulpitis pathogenesis, establishing endoplasmic reticulum (ER) stress as a central orchestrator of inflammatory responses in dental pulp tissue. Through integrated transcriptomic and functional analyses, we identified PMAIP1 as a pivotal regulator connecting ER stress to inflammatory signaling cascades, while demonstrating the therapeutic potential of targeting ER stress with 4-PBA in pulpitis treatment.

The marked upregulation of canonical ER stress markers (BiP and CHOP) in clinical pulpitis specimens provides the first direct evidence linking ER stress activation to pulpal inflammation. This finding extends beyond previous studies that primarily focused on inflammatory mediators in pulpitis [19, 20], revealing a fundamental cellular stress response that may initiate and perpetuate inflammatory cascades. The concurrent elevation of ER stress-specific apoptotic marker Caspase-12 with inflammatory mediator TNF-α suggests that ER stress may serve as an upstream trigger for inflammatory cell death in pulpal tissue, consistent with observations in other inflammatory conditions [21].

We also noticed that the prominently significant gene located at the top-right corner of Fig. 2C is CRLF1 (Cytokine Receptor-Like Factor 1). CRLF1 functions as a co-receptor in IL-6 family cytokine signaling pathways and has been associated with inflammatory responses in various disease contexts [22, 23]. The notable upregulation of CRLF1 in our pulpitis model suggests activation of cytokine-mediated inflammatory pathways [24], which is consistent with the known inflammatory nature of pulpitis. While this finding provides additional insight into the inflammatory landscape of pulpitis, detailed characterization of CRLF1’s specific role in pulpal inflammation warrants further investigation in future studies.

Our bioinformatic analysis identified PMAIP1 as a previously unrecognized central hub in pulpitis pathogenesis, exhibiting the highest network connectivity among ER stress-related differentially expressed genes. This finding aligns with recent studies highlighting PMAIP1’s role in cellular stress responses [25, 26], though its function in dental pulp inflammation was previously unexplored. The strong positive correlations between PMAIP1 and established ER stress markers (GRP78, DDIT3) suggest its potential role in amplifying stress responses, while its associations with inflammatory mediators indicate its function in bridging cellular stress to inflammatory signaling [27]. The identification of NOD2 and PIK3R1 as key regulatory molecules provides mechanistic insight into how ER stress signals are translated into inflammatory responses. NOD2, known for its role in inflammatory diseases [28], emerged as a significant node in our network analysis, suggesting that ER stress may modulate inflammatory responses through NOD2-dependent pathogen recognition pathways. Similarly, PIK3R1 is essential for XBP-1s translocation to the nucleus and thus regulating endoplasmic reticulum (ER) stress [29].

Perhaps the most clinically relevant finding is the therapeutic efficacy of 4-PBA in attenuating both ER stress and inflammatory responses. The significant reduction in BiP, CHOP, CASP12, and TNF-α expression following 4-PBA treatment aligns with studies demonstrating its effectiveness in other inflammatory conditions [30, 31]. This approach is particularly promising as it addresses an upstream regulatory mechanism rather than merely suppressing inflammatory mediators, potentially offering more effective disease control. Our findings also shed light on the complex interplay between ER stress and dental pulp stem cell function. Recent studies have demonstrated that stem cell properties can be significantly impacted by ER stress [32], suggesting that targeting this pathway might not only reduce inflammation but also preserve the regenerative capacity of dental pulp tissue. The observed effects of 4-PBA on pulp stem cells warrant further investigation into potential regenerative applications.

The translation of these findings into clinical practice could fundamentally change our approach to pulpitis treatment. Current therapeutic strategies primarily focus on symptom management and pulp preservation [33], often with limited success in cases of irreversible pulpitis. Our identification of ER stress as a druggable target, coupled with the demonstration of 4-PBA’s effectiveness, opens new avenues for developing targeted therapies that could potentially prevent the progression from reversible to irreversible pulpitis.

The use of both human specimens and a rat model provides cross-species validation of our observations. The integration of transcriptomic analysis with functional studies offers robust evidence for the role of ER stress in pulpitis. However, certain limitations should be acknowledged. While our rat model successfully recapitulated key features of human pulpitis, species-specific differences in dental pulp biology May affect the generalizability of some findings. The temporal dynamics of ER stress activation during different stages of pulpitis progression require further investigation. Although 4-PBA showed promising results, optimization of its delivery method and timing for clinical application needs additional study. Additionally, the long-term effects of ER stress modulation on pulp tissue homeostasis and regeneration capacity remain to be determined.

Our current findings establish the direct effects of ER stress on hDPSCs and provide the mechanistic foundation for understanding pulpal inflammation responses. However, to enhance biological relevance, future studies should incorporate heterogeneous cell co-cultures that include immune cells, endothelial cells, and other pulp tissue components, as these multicellular interactions are critical in the physiological context. And detailed characterization of the PMAIP1-mediated signaling network in pulpal inflammation, particularly its interaction with NOD2 and PIK3R1 pathways, will be crucial for understanding the complete molecular mechanism. The development of targeted delivery systems for ER stress modulators could enhance their therapeutic efficacy in dental pulp tissue [34]. Further investigation of potential biomarkers for early detection of ER stress activation in pulpitis could guide therapeutic intervention timing. Moreover, exploration of combination therapies targeting both ER stress and conventional inflammatory pathways may lead to more effective treatment strategies.

Conclusion

Our study establishes ER stress as a critical mediator in pulpitis pathogenesis and identifies PMAIP1 as a central regulatory hub connecting ER stress to inflammatory responses. The demonstration of 4-PBA’s therapeutic efficacy provides a strong foundation for developing novel treatments targeting ER stress in pulpitis. These findings not only advance our understanding of pulpal inflammation but also offer promising directions for clinical intervention strategies.

Abbreviations

ER

Endoplasmic reticulum

LPS

Lipopolysaccharide

hDPSCs

Human dental pulp stem cells

DEGs

Differentially expressed genes

4-PBA

4-phenylbutyric acid

UPR

Unfolded protein response

hDPCs

Human dental pulp cells

DMEM

Dulbecco’s modified Eagle’s medium

GEO

Gene Expression Omnibus

PCA

Principal component analysis

GO

Gene Ontology

BP

Biological process

CC

Cellular component

MF

Molecular function

Authors’ contributions

Caixia Zhou: Writing – review & editing, Writing – original draft, Visualization, Validation, Methodology, Investigation, Formal analysis, Data curation, Conceptualization. Jiali Zhang: Writing – review & editing, Validation, Methodology. Luyi Chen: Writing – review & editing, Resources, Investigation. Yanheng Yu: Writing – review & editing, Validation, Software. Yingying Sun: Data curation, Software. Yunping Pan: Writing – original draft. Song Cai: Funding acquisition. Ping Zhong: Writing – review & editing, Writing – original draft, Supervision, Resources, Project administration, Conceptualization.

Funding

This study was supported by the Guangdong Provincial Natural Science Foundation, General Project [Grant No.2024A1515010632].

Data availability

All data supporting the findings was contained within the manuscript. All procedures were approved by the Institutional Ethics Committee of Shenzhen Stomatological Hospital (approval number: LLWYH-PJ-20250114-001). The patient had provided written informed consent for the publication of their personal or clinical information. Animal experimental protocols were approved by the Laboratory Animal Welfare & Ethics Committee of Bestcell Model Biological Center (approval number: 2025-1-21A). Endoplasmic reticulum (ER) stress-related genes were obtained from the GeneCards database (https://www.genecards.org/). The gene expression dataset GSE98359 was downloaded from the Gene Expression Omnibus (GEO) database. The authors confirm that the data supporting the findings of this study are available within in this manuscript. The authors will supply the relevant data in response to reasonable requests.

Declarations

Ethics approval and consent to participate

Our study was carried out in accordance with the declarations of Helsinki and were approved by the Institutional Ethics Committee of Shenzhen Stomatological Hospital (approval number: LLWYH-PJ-20250114-001) and the Laboratory Animal Welfare & Ethics Committee of Bestcell Model Biological Center (approval number: 2025-1-21A). Informed consent was obtained from all participants involved in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.