The regulatory role of the Notch signaling pathway in mitophagy and macrophage-mediated elimination of Mycobacterium bovis bacillus Calmette-Guérin

Abstract

Background

The Notch signaling pathway plays a critical role in maintaining immune responses. This study examined the regulatory effect of the Notch signaling pathway on mitophagy and macrophage function in response to Mycobacterium bovis Bacillus Calmette-Guérin (BCG) infection.

Methods

RAW264.7 cells with stable Notch-1 knockdown were divided into three groups: control, siRNA Notch-1, and siRNA Notch-1 + valinomycin. Following BCG infection, we measured reactive oxygen species (ROS) levels, the expression of Notch signaling and mitophagy-related genes, cytokines, and BCG colony count.

Results

RAW264.7 cells infected with 1919-siRNA lentivirus exhibited significantly decreased expression of Notch-1, indicating stable Notch-1 knockdown. Following BCG infection, the expression of Notch-1 decreased in the siRNA Notch-1 group and the siRNA Notch-1 + valinomycin group compared to the control group. Moreover, the expression levels of JAG1, autophagy markers (Beclin 1 and LC3), and mitophagy markers (Drp-1 and Nix) were significantly increased in the siRNA Notch-1 + valinomycin group. Additionally, the ROS level showed a significant increase in the siRNA Notch-1 group, which was further augmented after treatment with mitophagy inducer valinomycin. The BCG clearance rate decreased in the siRNA Notch-1 group but increased after treatment with valinomycin. IL-6 levels were significantly elevated in the siRNA Notch-1 group and further increased in the siRNA Notch-1 + valinomycin group. However, TNF-α levels significantly increased in the siRNA Notch-1 group and decreased significantly in the siRNA Notch-1 + valinomycin group.

Conclusion

The Notch signaling pathway inhibits mitophagy and macrophage-mediated elimination of BCG.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12879-025-11552-8.

Background

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) is a live-attenuated vaccine designed to protect humans from Mycobacterium tuberculosis (Mtb) infection [1]. Its parental strain is Mycobacterium bovis, which belongs to a larger complex of Mycobacterium species. It has been widely used in immunological studies and vaccine development [2–5]. It may protect against Mtb infection through several possible mechanisms, such as antibody-mediated protection, innate immune mechanisms, and alternative T-cell responses [3, 4]. However, BCG lacks certain virulence factors inherent in Mtb, including the RD1 locus, which plays a crucial role in the pathogenesis of tuberculosis [6, 7]. Therefore, the immune responses elicited by BCG may not directly correlate with the immunopathogenic processes associated with virulent Mtb.

Mitophagy, a selective form of autophagy responsible for the degradation of damaged mitochondria, plays a crucial role in maintaining cellular homeostasis and regulating inflammatory responses [8]. Studies have shown that BCG can modulate mitophagy in macrophages [9, 10], thereby influencing immune responses. Key mitophagy proteins, such as Beclin 1 and microtubule-associated protein light chain 3 (LC3), have been implicated in this process [11, 12]. Despite the established relationship between BCG and mitophagy, the pathway regulating this relationship has not been fully elucidated.

The Notch signaling pathway is an important pathway for maintaining immune responses [13, 14]. Our previous study found that the expression of Notch signaling pathway-related genes in tuberculosis patients was increased and associated with Th1/Th2 imbalance [15]. The circAGFG1 enhances autophagy and reduces cell apoptosis through the miRNA-1257/Notch axis in active tuberculosis patients and Mtb-infected macrophages [16]. The Notch pathway does not unilaterally regulate autophagy; instead, there is interaction between the two. Inhibiting Notch signaling affects autophagy, and autophagy regulates the degradation of Notch-1 protein through feedback regulation [17, 18]. It is also observed that 24 h after hypoxic-ischemic injury, Notch pathway inhibition did not affect autophagy protein levels, possibly due to feedback regulation of autophagy [19]. However, the role of the Notch signaling pathway in regulating the ability of macrophages to eliminate BCG and the mechanism involving mitophagy remains unclear.

In this study, we explored the regulatory role of the Notch signaling pathway in mitophagy and macrophage-mediated elimination of BCG. By examining these interactions, we hope to enhance our understanding of the immune mechanisms activated by BCG.

Materials and methods

RAW264.7 cell culture in vitro

The RAW264.7 cells, which were gifted by Professor Lijun Bi from the Institute of Biophysics, Chinese Academy of Sciences, were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37 °C. When the cells reached 80% confluency, they were subcultured.

Screening of RAW264.7 cells with stable knockdown of Notch-1

RAW264.7 cells were inoculated into a 12-well plate. Lentiviral-mediated delivery of siRNAs was performed when the cell confluence reached approximately 30%. This density was selected based on the specific growth characteristics of RAW264.7 cells, which may optimize transfection efficiency while ensuring the cells remain healthy and viable during the infection process. Briefly, the lentiviral interference vector was LV-3 (pGLVH1/GFP + Puro) (#C06003; Genepharma, Shanghai, China). For lentiviral packaging, a three-plasmid system consisting of PG-P1-VSVG, PG-P2-REV, and PG-P3-RPE was used. The cells were transfected with the empty lentiviral vector (negative control; sequence: TTCTCCGAACGTGTCACGT) or lentiviruses carrying four siRNAs against Notch-1 (1327-siRNA with the sequence of GCTTCCTTCTACTGCGAATGT, 1607-siRNA with the sequence of GCTGTGAGATTGATGTTAATG, 1919-siRNA with the sequence of GCGTGTGTACAGAAGGTTACA, and 2795-siRNA with the sequence of GCAAGGAGTCTGAAGACTATG) at a multiplicity of infection (MOI) of 1, 10, 50, and 100. After infection for 72 h, the fluorescence intensity of GFP and cell survival status were observed under a Leica DM IL LED Inverted Laboratory Microscope (Leica Instrument Co., Ltd, Germany) to determine infection efficiency and cell viability, as previously described [20–23]. The knockdown efficiency was assessed using quantitative real-time PCR (qRT-PCR) detection of the Notch-1 expression level. It was determined that the 1919-siRNA at an MOI of 100 had the optimal knockdown efficacy. Subsequently, 2.5 µg/mL puromycin was added to the control cells and the cells infected with 1919-siRNA Notch-1 at an MOI of 100 for 5 days. Meanwhile, the blank control group with only RAW264.7 cells was set up. After the complete death of the cells in the control group, the cells with Notch-1 knockdown were cultured with 1 µg/mL puromycin for 11 days. Then, monoclonal cells were subsequently isolated and examined using qRT-PCR. The cells with stable knockdown of the Notch-1 gene were selected and used for subsequent experiments.

Cell treatments

The RAW264.7 cells with stable knockdown of Notch-1 were seeded into 6-well plates at a density of 1.5 × 10⁶ cells per well. After 12 h of culture, the cells were divided into three groups. The control group included cells infected with empty lentiviral vectors. The siRNA Notch-1 group included RAW264.7 cells with stable knockdown of Notch-1. For the siRNA Notch-1 + valinomycin (VAL) group, the RAW264.7 cells with stable knockdown of Notch-1 were treated with 10 µM mitophagy inducer VAL (MS0049, Maokang Biotechnology, Shanghai, China). After treatment for 12 h, the sonicated BCG suspension was used to infect the cells in each group at an MOI of 10. Cells were cultured for an additional 24 h before collection.

Flow cytometry analysis of reactive oxygen species (ROS)

After infection with BCG for 24 h, the cells were washed once with serum-free culture medium, and then a 1:1000 diluted probe DCFH-DA [24] (S0033S, Beyotime Biotechnology, Shanghai, China) was added for detecting intracellular ROS. The cells were then incubated at 37 °C for 30 min with gentle inversion every 3–5 min to ensure thorough contact between the probe and the cells. After washing three times with a serum-free culture medium, the fluorescence intensity was measured using the CytoFLEX S flow cytometer (Beckman Coulter Life Sciences, Brea, CA, USA).

Chip detection of cell cytokines after BCG infection

We collected the cell supernatant 24 h after BCG infection and incubated it with Mouse T Cell Response Array C1 (AAM-TCR-1, RayBiotech, Norcross, GA, USA) at 4 °C overnight. Subsequently, we washed the chip four times with 1× wash buffer I and 1× wash buffer II, each time for 5 min, followed by incubation with biotinylated antibody at room temperature for 2 h. After washing four times with 1× wash buffer I and 1× wash buffer II, each time for 5 min, the incubation with HRP-streptavidin was conducted at room temperature for 2 h. After washing again, the chip was incubated for 2 min with the mixture of detection reagents C and D. Finally, the levels of IFN-γ, IL-10, IL-12p70, IL-13, IL-17, IL-17 F, IL-18, IL-2, IL-4, IL-5, IL-6, IL-7, IL-9, TGF-β, and TNF-α were detected on ImageQuant LAS4000 Scanner (GE Healthcare Corporate, Chicago, USA).

Analysis of BCG clearance rate

The cells were seeded into 24-well plates, with 3 × 10⁵ cells per well. Then, the cells were treated and grouped as described above. After BCG infection for 24 h, the cells were lysed with 0.1% TritonX-100 (SLCD3242, Sigma, Germany), and then diluted to 10⁻¹, 10⁻², and 10⁻³ and plated. Each dilution gradient was inoculated into two bacterial culture plates for 3 weeks. The bacterial colony counts were counted by the naked eye.

qRT-PCR

RNAiso Plus (9109, Takara Bio, Dalian, China) was used for total RNA extraction from cultured cells. The RNA concentration and purity were assessed using a microvolume UV-visible spectrophotometer. The RNA was then reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (RR037A, Takara). The mRNA levels of Notch-1, Beclin 1, Jagged canonical Notch ligand 1 (JAG1), dynamin-related protein 1 (Drp-1), LC3, NIP3-like protein X (Nix), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were quantified using qRT-PCR and the CFX Connect™ Fluorescent Quantitative PCR Detection System (Bio-Rad, CA, Hercules, USA). The primer sequences are presented in Table 1. GAPDH served as the internal control. The 20 µL reaction system included: 10 µL of 2x TB Green^® Premix Ex Taq™ II, 0.4 µL of ROX Reference Dye (50×), 2 µL of cDNA, 0.8 µL each of the forward and reverse primers, and 6 µL of ddH₂O. The PCR amplification conditions were as follows: pre-denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30s. The 2^−ΔΔCt method was employed for determining the relative expression levels.

Table 1.

Primer sequences for qRT-PCR

	Sequence (5’−3’)	Product length (bp)	Tm (◦C)	GenBank accession number	Gene ID
Beclin 1 Forward	ATGGAGGGGTCTAAGGCGTC	149	61.05	NC_000077	56,208
Beclin 1 Reverse	TGGGCTGTGGTAAGTAATGGA		58.73
Drp-1 Forward	TAAGCCCTGAGCCAATCCATC	77	59.86	NC_000082	74,006
Drp-1 Reverse	CATTCCCGGTAAATCCACAAGT		58.65
LC3 Forward	CTGCCTGTCCTGGATAAGACCA	126	54.93	NC_000074	67,443
LC3 Reverse	CTGGTTGACCAGCAGGAAGAAG		55.57
Nix Forward	GCAGGGACCATAGCTCTCAG	300	59.61	NC_000080	12,177
Nix Reverse	TGCTCAGTCGCTTTCCAATA		57.24
Notch-1 Forward	TGCCAGGACCGTGACAACTC	148	62.38	NC_000068	18,128
Notch-1 Reverse	CACAGGCACATTCGTAGCCATC		61.88
JAG1 Forward	CCAGCCAGTGAAGACCAAGT	127	59.89	NC_000068	16,449
JAG1 Reverse	CAATTCGCTGCAAATGTGTT		56.12
GAPDH Forward	CGTCCCGTAGACAAAATGGT	226	57.91	NC_000072	14,433
GAPDH Reverse	TTGATGGCAACAATCTCCAC		56.31

Note: Drp-1, dynamin-related protein 1; LC3, Microtubule-associated protein light chain 3; Nix, NIP3-like protein X; Notch-1, Neurogenic Locus Notch Homolog Protein 1; JAG1, Jagged canonical Notch ligand 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Western blot

The cells were collected and treated with an equal amount of RIPA lysis buffer (Solarbio, Beijing, China; T8060) for 30 min on ice, followed by centrifugation at 12,000 rpm at 4 °C for 10 min to obtain the supernatant. Protein content was determined using the BCA assay kit (Beyotime, Beijing, China; P0010), and the samples were loaded for protein electrophoresis and transferred to a PVDF membrane (Millipore, ISEQ00010). The membrane was then blocked with 5% skim milk at room temperature for 1 h. Primary antibodies were diluted in TBST solution with 1% BSA and incubated overnight at 4 °C. Subsequently, the secondary antibody was diluted in TBST (1:5000) and incubated at room temperature for 2 h, followed by three 10-min washes. Images were captured using a chemiluminescent imaging system (Tanon5200). The primary antibodies, including anti-LC3 A/B (435665), anti-Beclin 1 (3495T), anti-Drp1 (5391T), anti-Nix (12396 S), and anti-Notch-1 (4380T), were obtained from Cell Signaling Technology (Bosedun, USA). The anti-JAG1 antibody was from Affinity Biosciences (DF8269; Cincinnati, OH, USA), while the anti-GAPDH was from ZEN-bio (200306-7E4; Chengdu, China). The secondary antibody used was goat anti-rabbit IgG (HRP) (ab205718, Abcam, Cambridge, UK). Three independent experiments were performed for Western blot analysis.

Statistical analysis

All data are presented as means ± standard error of the mean and were analyzed using GraphPad Prism 8.0.1. The comparisons between two groups were performed using unpaired two-tailed t-tests, while comparisons among more than two groups were conducted using one-way or two-way ANOVA, followed by Tukey’s post hoc test for multiple pairwise comparisons. The P-value of less than 0.05 was considered statistically significant.

Results

RAW264.7 cells with stable knockdown of Notch-1 are successfully constructed

To knock down Notch-1, the lentiviruses containing four siRNA Notch-1 sequences were infected into RAW264.7 macrophages. The lentivirus infection efficacy and cell viability were monitored under a fluorescence microscope. The fluorescent images showed that the cells infected with lentiviruses exhibited high fluorescence intensity, indicating a high infection efficiency at an MOI of 100 (Fig. 1A). Moreover, the bright-field images revealed that the cell morphology and density were similar among different groups, indicating an insignificant effect of lentivirus infection on cell viability. Therefore, the optimal MOI was determined at 100. The qRT-PCR was performed to evaluate the expression of Notch-1. The melting temperature of GAPDH remained consistent across all experimental conditions, as shown in Supplementary Figure S1, confirming its stability as a housekeeping gene for normalization in our experiments. As shown in Fig. 1B, Notch-1 was decreased after siRNA lentivirus infection, with the most prominent decrease in the cells infected with 1919-siRNA lentivirus. Thus, the 1919-siRNA at an MOI of 100 had the optimal knockdown efficacy. Subsequently, the 1919-siRNA-infected cells were subjected to stable cell line screening with 2.5 µg/mL puromycin. After culturing for 5 days, cells in the control group died, while the fluorescence of cells in the lentivirus-infected group increased (Fig. 1C). After maintaining the culture with 1 µg/mL puromycin for 11 days, Notch-1 was significantly decreased in the selected stable cell line No. 12 (Fig. 1D). The cells with lower Notch-1 expression exhibited stronger fluorescence (Fig. 1E). This suggests that RAW264.7 cells with stable knockdown of Notch-1 are successfully constructed.

Fig. 1.

Screening of a cell line with stable knockdown of Notch-1. A The fluorescent and bright-field images of RAW264.7 macrophages after infection with lentiviruses carrying four siRNA Notch-1 sequences. The MOI was 100. B Relative expression of Notch-1 mRNA. C The fluorescent images of RAW264.7 macrophages after treatment with 2.5 µg/mL of puromycin for 5 days. The highlighted number in the upper left corner indicates the clone number. D Relative expression of Notch-1 mRNA in the stable cell line No. 12. E The fluorescent and bright-field images of RAW264.7 macrophages (stable cell line No. 12) after treatment with 1 µg/mL of puromycin for 11 days. Magnification: 40×. *P < 0.05, **P < 0.01; Comparisons between two groups were conducted using unpaired two-tailed t-tests, whereas comparisons among three or more groups were carried out using two-way ANOVA, followed by Tukey’s post hoc test for multiple pairwise comparisons

Expression levels of mitophagy-related genes after BCG infection in macrophages with Notch-1 knockdown

To investigate the expression of the Notch pathway and mitophagy-related genes in cells after BCG infection, we performed qRT-PCR and Western blot analysis. As shown in Fig. 2A, compared to the control group, the expression of the Notch-1 mRNA in the siRNA Notch-1 group and the siRNA Notch-1 + VAL group decreased significantly. Knocking down Notch-1 had no significant effect on the expression of the ligand JAG1 mRNA, but VAL significantly increased the expression of the JAG1 mRNA. Moreover, Notch-1 knockdown significantly increased the expression of the LC3 mRNA, and its expression was further increased by VAL. Additionally, knocking down Notch-1 did not result in significant differences in the expression of Beclin 1, as well as the mitophagy-associated marker genes Drp-1 and Nix. However, VAL significantly elevated the expression levels of these genes. To further validate the qRT-PCR results, we conducted a Western blot analysis. The original uncropped Western blot images with makers and visible margins are presented in the supplementary Figure S2. Consistently, we found that the Notch-1 and JAG1 protein levels decreased significantly in the siRNA Notch-1 group than the control group, but there was no significant difference between the siRNA Notch-1 and the siRNA Notch-1 + VAL groups (Fig. 2B and C). Similarly, the expression levels of autophagy marker proteins Beclin 1 and LC3 decreased in the siRNA Notch-1 group but increased in the siRNA Notch-1 + VAL group. Notably, the expression levels of mitophagy marker proteins Drp-1 and Nix showed no evident change in the siRNA Notch-1 group but significantly increased in the siRNA Notch-1 + VAL group.

Fig. 2.

Expression levels of Notch pathway and mitophagy-related genes after BCG infection in macrophages with stable knockdown of Notch-1. A The gene expression was detected with qRT-PCR. The protein expression was measured with Western blot analysis. Representative (B) and quantitative Western blot results (C) are presented. *P < 0.05. Statistical differences among groups were analyzed using one-way ANOVA, followed by Tukey’s post hoc test for multiple pairwise comparisons

Mitophagy exacerbates the production of ROS in BCG-infected macrophages with Notch-1 knockdown

To investigate the effect of mitophagy inducers on the production of ROS in macrophages after BCG infection, cells were incubated with DCFH-DA, and the fluorescence signal was detected using flow cytometry. As shown in Fig. 3A and B, after BCG infection, ROS was significantly increased in the siRNA Notch-1 group compared to the control and was further increased with the addition of the mitophagy inducer VAL. This suggests that mitophagy could exacerbate the generation of ROS in BCG-infected macrophages with Notch-1 knockdown.

Fig. 3.

Levels of ROS in macrophages infected with BCG. A Flow cytometry images for detecting ROS. B The relative level of ROS in each group. **P < 0.01; ***P < 0.001; ****P < 0.0001. Statistical analysis was performed using one-way ANOVA, with multiple comparisons assessed via Tukey’s post hoc test

Mitophagy promotes IL-6 secretion in BCG-infected macrophages with Notch-1 knockdown while inhibiting the production of TNF-α

To further investigate the regulatory effect of the Notch signaling pathway on cytokine secretion in macrophages infected with BCG through mitophagy, chip detection of cytokines was performed. The results are shown in Fig. 4. Compared with the control group, IL-6 in the siRNA Notch-1 group significantly increased, and the increase was more prominent after treatment with the mitophagy inducer VAL in the siRNA Notch-1 + VAL group. Conversely, TNF-α significantly increased in the siRNA Notch-1 group but significantly decreased in the siRNA Notch-1 + VAL group. There were no significant differences in the remaining cytokines.

Fig. 4.

Cytokine levels in the culture supernatant of BCG-infected macrophages with stable knockdown of Notch-1. Chip detection of cytokines was performed. *** P < 0.001; **** P < 0.0001. Two-way ANOVA analyzed the differences among groups, followed by Tukey’s post hoc test for pairwise comparisons

Inhibiting the Notch signaling pathway decreases macrophage clearance of BCG, while mitophagy induction enhances BCG clearance

To examine how the Notch signaling pathway regulates mitophagy and affects macrophages’ clearance of mycobacteria, we performed colony counting after incubating cells with BCG. The results, as shown in Fig. 5A and B, demonstrate that compared to the control group, the colony-forming units were significantly increased in the siRNA Notch-1 group. However, it was significantly decreased after treatment with the mitophagy inducer VAL. These results indicate that the BCG clearance rate was reduced in the siRNA Notch-1 group, but increased after treatment with the mitophagy inducer VAL.

Fig. 5.

BCG clearance rate of macrophages with stable knockdown of Notch-1. *P < 0.05; *** P < 0.001; Differences among groups were assessed using one-way ANOVA, with Tukey’s post hoc test for pairwise comparisons

Discussion

In this study, we investigated the regulatory role of the Notch signaling pathway in mitophagy and the macrophage-mediated elimination of BCG, a live-attenuated vaccine strain derived from Mycobacterium bovis. Our findings demonstrate that Notch signaling significantly influences mitophagy in macrophages upon BCG infection. Specifically, we observed that the inhibition of Notch signaling led to increased mitophagic activity and improved clearance rates of BCG by macrophages, alongside alterations in pro-inflammatory cytokine production. These results suggest that modulation of Notch signaling may play an essential role in regulating the immune response to BCG. Notably, the Notch-1 knockdown achieved a reduction of less than 50%. While this may raise concerns about biological significance, we would like to emphasize that our experimental design prioritized the balance between achieving effective knockdown efficiency and maintaining cell survival. The current results represent the best attainable outcome under these constraints. Therefore, we believe that these findings still contribute meaningfully to our understanding of the regulatory role of Notch-1 in macrophage behavior in response to BCG infection. Nonetheless, further optimization of knockdown efficiency and validation at the protein level is warranted in future studies to corroborate these findings.

IL-6 triggers cellular autophagy through a STAT3-independent pathway. It facilitates the initiation of autophagic vesicle formation and enhances autophagic flux [25]. Consistently, this study also found that mitophagy promoted IL-6 secretion in macrophages infected with BCG after Notch-1 knockdown, suggesting that there may be a synergistic effect between mitophagy and IL-6. Studies have reported that the knockout of autophagy genes can exacerbate TNF-α-dependent cell/tissue damage in mice, indicating that autophagy may inhibit TNF-α-mediated cytotoxicity in various conditions [26–29]. When autophagy is impaired in tumor cells, TNF-α-induced apoptosis plays a crucial role in anti-tumor immunity [30]. The TNF-α response observed in our study was unexpected, as Notch-1 knockdown led to an initial increase in TNF-α levels, which decreased following VAL treatment. This could suggest a complex interaction where the suppression of Notch-1 induces a pro-inflammatory response that is subsequently reduced by the activation of mitophagy through valinomycin. Further investigations examining the temporal dynamics of cytokine expression following Notch-1 modulation and mitophagy induction are warranted to fully elucidate these relationships.

Accumulated evidence suggests that ROS can induce autophagy through several distinct mechanisms, such as autophagy-related gene 4, protein kinase B/mammalian target of rapamycin, mitogen-activated protein kinase/high mobility group box 1, and mitochondrial electron transport chain [31–34]. Overall, most results indicate that ROS promotes the execution of autophagy. It is worth noting that previous studies have indicated a potential crosstalk between Notch signaling and mitophagy [35–38]. For example, one study by Song et al. [37] demonstrated that Notch signaling can regulate autophagy, which includes mitophagy, in cancer cells. Another study by Mitsuishi et al. [38] highlighted the involvement of the Notch pathway in maintaining mitochondrial homeostasis. The findings of this study revealed that mitophagy exacerbated the production of ROS in BCG-infected macrophages after Notch-1 knockdown. This indicates that there may be a synergistic effect between mitophagy and ROS. The degradation of NICD1 may be initiated through its interaction with LC3 in the nucleus. Subsequently, LC3 may facilitate the translocation of NICD1 to the cytoplasm and direct it towards autophagolysosomal degradation, thereby indicating an inhibitory effect of LC3 on the Notch-1 pathway [39]. In our study, we observed an increase in LC3 mRNA expression following Notch-1 knockdown; however, this was accompanied by a reduction in LC3 protein levels. This discrepancy raises important questions regarding the regulatory mechanisms at play. Potential factors contributing to this phenomenon may include post-transcriptional modifications, variations in protein stability, or temporal differences between mRNA transcription and protein translation. These findings suggest a complex interplay between Notch-1 signaling and the autophagy pathway, indicating that increased mRNA expression does not necessarily correlate with enhanced protein levels. Future studies are warranted to further investigate these dynamics and elucidate the regulatory mechanisms involved.

Mitophagy, a selective autophagic mechanism, can eliminate damaged mitochondria and plays a crucial role in immune evasion by some viruses and bacteria. Mycobacterium bovis induces mitophagy in macrophages, and the induction of mitophagy is impaired by knocking out PINK1, suggesting that the PINK1-Parkin pathway is involved in Mycobacterium bovis-induced mitophagy. Mycobacterium bovis induces mitophagy by inhibiting host xenophagy, thereby promoting its intracellular survival [10]. Phagocytosis is the process by which cells, such as macrophages, engulf and digest pathogens, such as Mtb or BCG, to eliminate them from the body [40, 41]. The clearance rate of BCG in macrophages is a crucial indicator of the macrophages’ ability to effectively phagocytose and eliminate the bacteria [42]. The analysis of BCG clearance rate, often assessed through bacterial colony counts, provides a quantitative measure of how well macrophages can phagocytose and eliminate the bacteria [41, 43]. Therefore, the evaluation of the BCG clearance rate indirectly reflects the phagocytic ability of macrophages in terms of their capacity to internalize, degrade, and clear the pathogen. Our results suggest that mitophagy enhanced the clearance rate of BCG by macrophages after Notch-1 knockdown, indicating the interplay between Notch signaling, mitophagy, and the phagocytic function of macrophages in response to mycobacterial infections.

The Notch pathway is activated after hypoxic-ischemia injury and regulates synaptic plasticity by negatively regulating autophagy and promoting the expression of SYP and PSD95 [19]. In this study, we found that both the Notch-1 signaling pathway and mitophagy promoted the bactericidal activity of macrophages against BCG. Therefore, it is plausible to suggest that Notch-1 and mitophagy may exert a synergistic effect in promoting the bactericidal activity of macrophages against BCG, despite the inhibitory relationship between Notch-1 and mitophagy.

While this study provides valuable insights into the regulatory role of the Notch signaling pathway in mitophagy and macrophage-mediated elimination of BCG, several limitations should be noted. Firstly, the use of the RAW264.7 cell line may not fully recapitulate the complexity of the immune response in vivo. Thus, further validation in primary macrophages or animal models is warranted. Secondly, the study primarily focused on the role of Notch-1 in regulating mitophagy and bacterial clearance. Future research should investigate the potential involvement of other Notch receptors or downstream signaling components. Thirdly, the study lacked experiments using an autophagy inhibitor like Chloroquine and failed to provide mitophagic flux data and mitochondrial DNA impairment data, potentially limiting the understanding of mitophagy regulation by the Notch signaling pathway. Additionally, a rescue experiment—such as Notch-1 re-expression or the administration of a Notch pathway agonist—has not been conducted, which may weaken the causal link between Notch-1 suppression and the observed phenotypes. Future studies incorporating these experiments are warranted to strengthen the conclusions and provide further insights into the mechanisms by which Notch-1 regulates mitophagy and macrophage activity. Lastly, the assessment of bacterial clearance was conducted solely at a single time point (24 h post-infection), which may limit our understanding of the kinetics of intracellular bacterial persistence and killing. Future investigations incorporating time-course experiments are essential. Such studies will allow for a more nuanced understanding of how Notch-1 regulation influences the dynamics of bacterial clearance and the overall macrophage response to infection.

Conclusion

In conclusion, this study unveils the interplay between Notch signaling, mitophagy, and macrophage function. The Notch signaling pathway may inhibit mitophagy and thereby hinder the elimination of BCG by macrophages. These findings underscore the importance of Notch signaling in shaping the immune response to BCG. However, given that BCG is a vaccine strain with distinct immunological properties compared to virulent Mtb, caution must be exercised when extrapolating these results to Mtb infection. Further studies are warranted to investigate the implications of Notch signaling in the context of virulent Mtb.

Abbreviations

ROS

Reactive oxygen species

Mtb

Mycobacterium tuberculosis

VAL

Valinomycin

BCG

Bacillus Calmette-Guérin

Drp-1

dynamin-related protein 1

LC3

Microtubule-associated protein light chain 3

Nix

NIP3-like protein X

Notch-1

Neurogenic Locus Notch Homolog Protein 1

JAG1

Jagged canonical Notch ligand 1

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

Authors’ contributions

Yiwei Zhao performed the experiments, collected and analyzed the data, and wrote the paper. Qifeng Li designed the study, collected the funds, and revised the paper. All authors have read and approved the manuscript.

Funding

This study was supported by the Tianshan Talent Training Program of Xinjiang Uygur Autonomous Region (2022TSYCCX0105), and the Key R&D Program of Xinjiang (2024B03021-2).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.