Abstract
Background
Capsaicin, phytochemical component in red hot chili peppers, has previously been demonstrated to exhibit antitumor effect in various cancer type. However, the deep biological function and molecular mechanism of capsaicin was still uncertain.
Methods
This study applied cell viability assay, apoptosis assay, Transwell assay, immunofluorescence, qPCR, western blot assay and high-throughput RNA sequencing to explore the effect of capsaicin on gene expression and chemotherapy sensitization in gastric cancer cells.
Results
Capsaicin could significantly inhibit cell viability and induce apoptosis in both AGS and HGC-27 gastric cancer cell line. Through high-throughput RNA sequencing, capsaicin exhibited inhibiting role in DNA repair, DNA replication and chromosome assemble pathway. qPCR assay and western blot validated that capsaicin could inhibit expression of the key enzymes (FEN1, LIG1 and PARP1) in DNA damage response and chemotherapy resistance. In vitro assay demonstrated that capsaicin could significantly induce cyto-toxicity and chemotherapy-induced DNA damage of 5-FU and Oxalipatin at low dose. Immunofluorescence analysis revealed that capsaicin inhibited both the expression and nuclear accumulation of PARP1 in AGS cells treated with 5-FU or oxaliplatin.
Conclusions
Capsaicin could inhibit DNA repair, thereby inhibited cell viability and improved the sensitivity of chemotherapy in gastric cancer cells.
Supplementary Information
The online version contains supplementary material available at 10.1186/s40001-025-03127-9.
Keywords: Capsaicin, DNA damage repair, Chemotherapy sensitivity, Gastric cancer
Introduction
Gastric cancer ranks third in cancer related death. Till now, 5-fluorouracil plus platinum agent is still the first line regimen in treatment of gastric cancer [1]. However, drug resistance is widely occurred thus limits its therapeutic efficiency [2]. Chemo-resistance could be caused by various mechanisms including: existence of cancer stem cells, hyperactivation of DNA repair pathways, dysregulation of apoptosis signals. Therefore, finding out an efficiency approach to induce chemo-sensitization is essential in cancer treatment.
Some natural dietary agents, which come from fruits, vegetables, or spices, exhibit potential therapeutic value in cancer treatment. Capsaicin, alternatively called trans-8-methyl-N-vanillyl-6-nonenamide, is the piquant component in red hot chili peppers which exhibits effects in cancer progression [3]. Previous researches have been demonstrated that capsaicin could inhibit cell proliferation in various cancer [4]. Meanwhile, capsaicin was also reported to induce of apoptosis and cell cycle arrest. Some studies indicated that capsaicin could be used for cancer prevention [5]. However, the effect of capsaicin on gene expression and its potential mechanism on chemotherapy sensitization were still uncertain.
In this study, we found capsaicin could inhibit cell viability in gastric cancer cell lines. Through high-throughput RNA sequencing, genes regulating DNA repair, DNA replication and chromosome assemble pathways were analyzed to be down-regulated by capsaicin. qPCR assay and western blot demonstrated that capsaicin could inhibit expression of the key enzymes (FEN1, LIG1 and PARP1) which play critical roles in DNA damage response and chemotherapy resistance. In vitro assay showed that capsaicin could impair the DNA repair process, thereby enhancing chemotherapy-induced DNA damage in gastric cancer cells. Our findings revealed a novel function of capsaicin in DNA damage repair and might provide new potential targets in cancer therapy.
Methods
Cell culture
Human gastric cancer cell line AGS was cultured in Ham`s F12 culture medium and HGC-27 was cultured in RPMI-1640 culture medium containing 10%FBS. Cells were placed in a 5% CO2 incubator at 37 °C, digested with 0.25% trypsin every 3–4 days, and passed through 1:3 cells with logarithmic growth phase for experiment.
Cell viability assay
Cell viability was assessed as previously described [6]. AGS cells were digested with trypsin, cell counts were carried out, and 1 × 104/100 µl cell suspension was prepared. 100 µl per well was added into 96-well plates and cultured in cell incubators for 24 h. After the cells were glued to the wall, drug treatment was administered. After two hours of incubation, the absorbance at 450 nm was measured using an enzyme label. Using the absorbance as a guide, the impact of medication treatment on cell activity was estimated.
Apoptosis assay
Cell apoptosis was evaluated as described in earlier study [7]. Briefly, 1 × 104 cells were seeded into 6-well plates and cultured until approximately 70% confluence. Cells were then treated with the appropriate drugs for 18 h. Following treatment, cells were harvested using 0.25% trypsin without ethylenediaminetetraacetic acid (EDTA) and stained with the Annexin V–fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis detection kit (Yeasen Biotechnology, Cat. #40302ES50), according to the manufacturer’s protocol. Stained cells were subsequently analyzed by flow cytometry (BD Biosciences, FACS Aria).
Immunofluorescence
Immunofluorescence was performed as previously described [8]. Briefly, 50,000 cells per well were seeded onto 12 mm glass coverslips in 24-well plates and subjected to the indicated treatments. After 14 h of incubation, cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS. Non-specific binding was blocked by incubation with 1% bovine serum albumin (BSA) in PBS for 2 h at room temperature. Cells were then incubated overnight at 4 °C with primary antibodies against γH2AX (ABclonal, Cat. #AP1555) (1:400 diluted), and PARP1 (Proteintech, Cat. #66520-1-Ig) (1:200 diluted). After washing, cells were incubated with fluorescently labeled secondary antibodies (1:200) for 2 h at room temperature. Nuclei were counterstained with DAPI. Coverslips were mounted face down onto microscope slides using an antifade mounting medium. Fluorescence images were acquired using a fluorescence microscope at 100 × or 400 × magnification. All experiments were performed in triplicate.
Transwell assay
Transwell migration assay was performed as previously described [7, 9]. Corning Transwell inserts (24-well format, 8 μm pore size; Cat. #3422) were used for both assays. A total of 1 × 105 cells suspended in 100 μL of serum-free medium were seeded into the upper chamber. The lower chamber was filled with 600 μL of medium containing 30% fetal bovine serum (FBS) as a chemoattractant. After 48 h of incubation, cells that had migrated or invaded through the membrane were fixed and stained with crystal violet (Solarbio, Cat. #C8470). Stained cells were visualized and quantified under an inverted microscope at 100 × magnification. All experiments were conducted in triplicate.
Western blot assay
Western blot was performed as previously described [7, 10]. Total protein was extracted using NP40 lysate buffer supplemented with phenylmethylsulfonyl fluoride and cocktail protease inhibitor (MedChemExpress, Cat. #HY-K0010). The quantified protein samples were added to a 10% polyacrylamide gel (SDS-PAGE) and the proteins were separated by electrophoresis according to their molecular weight. The isolated proteins on the gel were transferred to a polyvinylidene fluoride membrane. The membrane is treated with a sealer containing a non-specific protein (skim milk powder) to close the non-specific binding sites on the membrane and reduce the background signal. The membrane is soaked in a solution containing a primary antibody specific to the target protein and incubated overnight, usually at 4 °C. The membrane is soaked in 1:5000 horseradish peroxidase-linked secondary antibodies (ABclonal, Cat. #AS014) and incubated for 2.5 h. Finally, the membranes were washed three times and visualized using an SuperKine™ West Femto Maximum Sensitivity Substrate kit (Abbkine, Cat. #BMU102). Primary antibodies used in western blot assay were as follows: PARP1 (ABclonal, Cat. #A0010); LIG1 (ABclonal, Cat. #A1858); FEN1 (ABclonal, Cat. #A1175); E-cadherin (CST, Cat. # 3195S); Vimentin (CST, Cat. #5741S); β-actin Rabbit mAb (ABclonal,Cat. #AC038).
qPCR assay
The SteadyPure Universal RNA Extraction kit (ACCURATE, Cat. #AG21017) was used for total RNA extraction and reverse transcription was performed with HiScript II Q RT SuperMix for qPCR kit (Vazyme, Cat. #RR223-01) according to the manufacturer’s instructions. qPCR assay was performed using the ChamQ Universal SYBR qPCR Master Mix Kit (Vazyme, Cat.# Q711-02) in an ABI 7300Real-Time PCR System (Applied Biosystems, Foster City, CA, USA).GAPDH expression was used as an endogenous control, and the qPCR results were analyzed using the comparative Ct method (2−ΔΔCt). Primers used in qPCR assay were as follows:
LIG1:
Forward (5`-3`): GAAGGAGGCATCCAATAGCAG;
Reverse (5`-3`): ACTCTCGGACACCACTCCATT;
FEN1:
Forward (5`-3`): ATGACATCAAGAGCTACTTTGGC;
Reverse (5`-3`): GGCGAACAGCAATCAGGAACT;
PARP1:
Forward (5`-3`): CGGAGTCTTCGGATAAGCTCT;
Reverse (5`-3`): TTTCCATCAAACATGGGCGAC;
GAPDH:
Forward (5`-3`): GGAGCGAGATCCCTCCAAAAT;
Reverse (5`-3`): GGCTGTTGTCATACTTCTCATGG.
High-throughput RNA sequencing
The total RNA was collected from AGS cells treated with capsaicin (at a dose of 250 µM for 24 h) or DMSO using TRIzol reagent according to the manufacturer’s protocol (n = 3 per group). RNA was quantified using a NanoDrop ND-2000 (Thermo Scientific, USA), and RNA integrity was assessed using an Agilent Bioanalyzer 2100 (Agilent Technologies, USA). High-throughput sequencing was performed by TsingKe biotech Co., Ltd. according to the manufacturers` standard protocols.
The quality control and preliminary analysis of sequencing raw data was performed by Novogene biotech Co., Ltd. according to the standard pipeline. Gene expression level was measured by Fragments Per Kilobase of exon model per Million mapped fragments (FPKM). Differentially expressed genes were identified based on the fold change. The threshold set for upregulated and downregulated genes was a fold change more than 2 with p value < 0.01. Gene Ontology (GO) enrichment of the differentially expressed genes were performed using DAVID software (david.ncifcrf.gov). Protein–protein interaction analysis were performed using String program (string-db.org). The gene expression profile was analyzed using GSEA software (http:// software.broadinstitute.org/gsea).
Statistical analysis
All experiments were repeated three times (version 9.5.0 for Windows; GraphPad Software Inc., USA) was used for statistical analysis. All continuous data are presented as mean ± SD. Student’s t test and Analysis of variance (ANOVA) was used for statistical analysis and p < 0.05 was set as statistical significance.
Results
Capsaicin inhibits cell viability in AGS gastric cancer cell line
Cell viability assay was used for detection the effect of capsaicin on cell viability in gastric cancer cell lines. AGS cells were treated with capsaicin at different concentrations (0.1 µM, 1 µM, 10 µM, 25 µM, 50 µM, 100 µM, 200 µM, 300 µM) for 24 h, 48 h and 72 h respectively. The results showed that cell viability of AGS cells could be inhibited by capsaicin in a concentration-dependent manner, the IC50 of capsaicin for cell viability was calculated as 253.0 µM (Fig. 1A). Similarly, after 24 h of treatment, capsaicin inhibited HGC-27 cell viability in a concentration-dependent manner (IC₅₀: 89.98 µM) (Fig. 1B). In addition, capsaicin induced apoptosis in both AGS and HGC-27 cells (Fig. 1C, D). Although Transwell assays showed that capsaicin suppressed cell migration in AGS cells, no significant changes were observed in epithelial–mesenchymal transition (EMT) markers, including Vimentin and E-cadherin (Supplementary Fig. 1A, B). Taken together, these findings suggest that capsaicin reduces cell viability and promotes apoptosis in gastric cancer cells.
Fig. 1.
Capsaicin could inhibit cell viability in AGS cells. A Cell viability of AGS cells after treating with capsaicin for 24 h, 48 h and 72 h at different concentrations. DMSO was used as negative control. Histograms showed the mean ± SD of cell viability rate. The half-maximal inhibitory concentration (IC₅₀) of capsaicin after 24-h treatment was calculated. B Cell viability of HGC-27 cells after treating with capsaicin for 24 h at different concentrations. DMSO was used as negative control. Histograms showed the mean ± SD of cell viability rate. The half-maximal inhibitory concentration (IC₅₀) of capsaicin after 24-h treatment was calculated. C AGS cells were treated with capsaicin at a dose of 50 µM for 18 h, followed by apoptosis analysis. The total apoptosis rate (Annexin V⁺/PI⁻ and Annexin V⁺/PI⁺) was 1.72% in the DMSO group and increased to 7.66% in the capsaicin-treated group. D HGC-27 cells were treated with capsaicin at a dose of 30 µM for 18 h, followed by apoptosis analysis. The total apoptosis rate (Annexin V⁺/PI⁻ and Annexin V⁺/PI⁺) was 5.56% in the DMSO group and increased to 11.26% in the capsaicin-treated group
Capsaicin could inhibit DNA repair and chromosome assemble pathways in AGS cells
To elucidate the potential mechanisms of capsaicin mediated cell viability inhibition in gastric cancer cells, we collected mRNAs from AGS cells treated with either DMSO or capsaicin, and profiled gene expression using high-throughput sequencing. The differentially expressed gene (DEG) was defined as gene with expression fold change > 2 and p < 0.05. Based on this criterion, 1082 down-regulated DEGs and 1348 up-regulated DEGs in AGS cells treated with capsaicin were selected (Fig. 2A). Gene ontology (GO) enrichment was performed to explore the major function of these DEGs. We found that “chromosome segregation” and “DNA replication” occupied almost top ten GO categories of the downregulated DEGs in AGS cell treated with capsaicin (Fig. 2B). These results implied that capsaicin might down-regulate DNA replication and chromosome assemble genes in AGS cells.
Fig. 2.
Capsaicin could inhibit DNA repair and chromosome assemble pathways in AGS cells. A Volcano plot diagram of gene expression in AGS cell with control or capsaicin treatment. AGS cells were treated with capsaicin at a dose of 250 µM for 24 h (DMSO was used as control), then high throughput sequencing was performed (N = 3 pairs). The differentially expressed gene (DEG) was defined as gene with expression fold change > 2 and p < 0.05. B Top-10 Gene ontology (GO) enrichment categories of the up/down-regulated DEGs in AGS cells. Green, GO enrichment categories of down-regulated DEGs in capsaicin vs. DMSO; red, GO enrichment categories of up-regulated DEGs in capsaicin vs. DMSO; bar: Log10 p value; dot, gene counts. C Heatmap presented 101 DEGs, which were classified in “chromosome segregation”, “DNA replication”, “DNA-dependent DNA replication”, “nuclear chromosome segregation”, “sister chromatid segregation” and “DNA replication initiation” categories. FPKM, fragments per kilobase of exon model per million mapped fragments. D String program was used to annotate the functions and potential interactions of these 101 DEGs. The potential downstream of capsaicin in MMR (POLD3, RPA1, LIG1, PCNA, EXO1) and BER (POLE2, POLE, POLD3, LIG1, FEN1, PARP1, PCNA) were also identified. E. Gene set enrichment analysis (GSEA) of AGS cell with control (DMSO) or capsaicin treatment (n = 3 pairs). KEGG subset of “C2: curated gene sets” was used in this analysis. The normalized p values of the presented gene sets were less than 0.01. ES enrichment score, NES normalized enrichment score, FDR-q false discovery rate q value, FWER-p family-wise error rate p value
Next, we focused on the DEGs in the DNA replication and chromosome segregation categories, and identified 101 down-regulated genes in AGS cells treated with capsaicin (Fig. 2C). Using String program (string-db.org), we found that the function of these genes could be significantly enriched in mismatch repair (MMR) (rank 2) and base excision repair (BER) (rank 3) pathways (Fig. 2D). String analysis also identified the potential downstream genes of capsaicin in MMR (POLD3, RPA1, LIG1, PCNA, EXO1) and BER (POLE2, POLE, POLD3, LIG1, FEN1, PARP1, PCNA) pathways (Fig. 2D). To further verify whether capsaicin could regulate cell cycle and DNA repair in AGS cells, gene set enrichment analysis was performed. Our results revealed that, compared with capsaicin treatment group, cell cycle; DNA replication; and base excision repair could be enriched in control group with statistical significance (normalized p value < 0.01) (Fig. 2E). These evidences indicated that capsaicin could inhibit DNA repair in BER dependent manner and negatively regulated cell proliferation in gastric cancer cells.
Capsaicin suppresses LIG1, PARP1 and FEN1 expression in AGS cells
End-polishing by flap endonuclease 1 (FEN1), the DNA ligases 1 (LIG1) are the key enzymes in BER pathway, while poly ADP-ribose polymerase 1 (PARP1) is essential in DNA repair and maintaining genomic integrity [11, 12]. Based on the high-throughput sequencing data, capsaicin had potential regulatory effect of FEN1, LIG1 and PARP1, thus, these three genes were selected and validated. qPCR was used to detect the expression of RNA levels of these genes in AGS cell. After treatment with different concentrations of capsaicin (50 µM, 100 µM, 253 µM) for 24 h, capsaicin could significantly inhibit the expression of LIG1, PARP1 and FEN1 (Fig. 3A). Western blot analysis revealed that capsaicin reduced the protein levels of LIG1, PARP1, and FEN1 in a concentration-dependent manner in both AGS and HGC-27 cells (Fig. 3B, C). To assess whether capsaicin induces DNA damage, we performed immunofluorescence staining for the DNA damage marker γH2AX. Capsaicin treatment markedly increased γH2AX-positive cells in both cell lines (Fig. 3D, E). These findings suggest that capsaicin downregulates key DNA repair enzymes, thereby promoting DNA damage accumulation in gastric cancer cells.
Fig. 3.
Capsaicin suppresses LIG1, PARP1 and FEN1 expression in AGS cells. A AGS cells were treated with DMSO or capsaicin (50 µM, 100 µM, 253 µM) for 24 h, then qPCR was performed to detect the expression level of LIG1, PARP1 and FEN1. GAPDH was used as endogenous control. Three duplications were performed in each experiment. Data are represented as mean ± SD. **p < 0.01, ****p < 0.0001 by ANOVA. B Cell lysates from AGS cells treated with DMSO or capsaicin (50 µM, 100 µM, 253 µM) for 24 h, then immunoblot was performed. Lysates were probed for LIG1, PARP1, FEN1 antibodies and β-actin was used as a loading control. C Cell lysates from HGC-27 cells treated with DMSO or capsaicin (20 µM, 50 µM, 90 µM) for 24 h, then immunoblot was performed. Lysates were probed for LIG1, PARP1, FEN1 antibodies and β-actin was used as a loading control. D AGS cells were treated with control (DMSO) or capsaicin (50 µM) for 14 h. Then DNA damage was observed by immunofluorescence. DNA damage marker (γH2AX) were stained with Dylight 488 (green), and Nuclei were stained with DAPI (blue). Scale bar: 20 µm. E HGC-27 cells were treated with control (DMSO) or capsaicin (30 µM) for 14 h. Then DNA damage was observed by immunofluorescence. DNA damage marker (γH2AX) were stained with Dylight 488 (green), and Nuclei were stained with DAPI (blue). Scale bar: 20 µm
Capsaicin could induce drug sensitivity of 5-FU and oxaliplatin in gastric cancer cells
DNA damage response and DNA repair were essential in drug resistance of chemotherapy. To further validate whether capsaicin could affect chemo-sensitivity in gastric cancer cells, we first treated AGS cells with 5-Fluorouracil (5-FU) at different concentration and found the IC50 of 5-FU was 343.2 µM (Fig. 4A). Interesting, combine treating with low dose of capsaicin (50 µM), the 5-FU IC50 in AGS decreased to 195.2 µM (Fig. 4A). Treating with low dose of capsaicin could also decrease the IC50 of Oxalipatin in AGS cells from 54.2 µM to 27.6 µM (Fig. 4B). Moreover, capsaicin significantly increased the proportion of apoptotic cells (Annexin V⁺/PI⁻ and Annexin V⁺/PI+) in AGS cells treated with 5-FU or oxaliplatin (Fig. 4C). Consistently, low-dose capsaicin (50 µM) reduced the IC₅₀ of 5-FU and oxaliplatin in HGC-27 cells from 31.94 µM to 13.36 µM and from 56.55 µM to 19.55 µM, respectively (Fig. 4D). In HGC-27 cells, capsaicin could also enhance apoptosis under 5-FU or oxaliplatin treatment (Fig. 4E). The results indicated that capsaicin could enhance the chemo-sensitivity of 5-FU and Oxalipatin in gastric cancer cells.
Fig. 4.
Capsaicin could induce drug sensitivity of 5-FU and oxaliplatin in AGS cells. A AGS cells were treated with varying concentrations of 5-FU with or without capsaicin (50 µM) for 24 h. Then cell viability assay was performed to and the IC50 of 5-FU was calculated. DMSO was used as negative control. All experiments were performed in three biological replicates. B AGS cells were treated with varying concentrations of Oxaliplatin with or without capsaicin (50 µM) for 24 h. Then cell viability assay was performed to and the IC50 of 5-FU was calculated. DMSO was used as negative control. All experiments were performed in three biological replicates. C AGS cells were treated for 18 h with 5-FU alone (195.2 µM), 5-FU combined with capsaicin (50 µM), oxaliplatin alone (27.6 µM), or oxaliplatin combined with capsaicin (50 µM). The total apoptosis rate (Annexin V⁺/PI⁻ and Annexin V⁺/PI⁺) were: 20.9% in 5-FU alone group, 57.1% in 5-FU combined with capsaicin group, 27.7% in oxaliplatin alone group, and 41.0% in oxaliplatin combined with capsaicin group. D IC₅₀ values of 5-FU and oxaliplatin were measured in HGC-27 cells treated with or without capsaicin (50 µM) for 24 h. DMSO was used as the negative control. All experiments were performed in three biological replicates. E HGC-27 cells were treated for 18 h with 5-FU alone (30 µM), 5-FU combined with capsaicin (30 µM), oxaliplatin alone (20 µM), or oxaliplatin combined with capsaicin (30 µM). The total apoptosis rate (Annexin V⁺/PI⁻ and Annexin V⁺/PI⁺) were: 23.3% in 5-FU alone group, 39.7% in 5-FU combined with capsaicin group, 16.5% in oxaliplatin alone group, and 22.8% in oxaliplatin combined with capsaicin group
Capsaicin enhances chemotherapy-induced DNA damage in gastric cancer cells
To determine whether capsaicin enhances chemotherapy sensitivity by impairing DNA repair, we assessed DNA damage levels in gastric cancer cells using immunofluorescence. As shown in Fig. 5A, capsaicin markedly increased DNA damage in AGS cells compared to treatment with 5-FU or oxaliplatin alone (Fig. 5A). Similarly, in HGC-27 cells, capsaicin co-treatment further elevated DNA damage induced by oxaliplatin (Fig. 5B). Immunofluorescence analysis revealed that 5-FU-induced DNA damage promoted nuclear accumulation of the DNA repair enzyme PARP1 in AGS cells, whereas capsaicin inhibited this process (Fig. 5C). In addition, capsaicin could also reverse oxaliplatin-induced PARP1 nuclear localization in AGS cells (Fig. 5D). These findings suggest that capsaicin impairs the DNA repair process, thereby enhancing chemotherapy-induced DNA damage in gastric cancer cells.
Fig. 5.
Capsaicin enhances chemotherapy-induced DNA damage in gastric cancer cells. A AGS cells were treated for 14 h with 5-FU alone (195.2 µM), 5-FU plus capsaicin (50 µM), oxaliplatin alone (27.6 µM), or oxaliplatin plus capsaicin. DNA damage was assessed by immunofluorescence staining. The DNA damage marker γH2AX was labeled with DyLight 488 (green), and nuclei were counterstained with DAPI (blue). Scale bar: 20 µm. B HGC-27 cells were treated for 14 h with oxaliplatin alone (20 µM), or oxaliplatin plus capsaicin (30 µM). DNA damage was assessed by immunofluorescence staining. The DNA damage marker γH2AX was labeled with DyLight 488 (green), and nuclei were counterstained with DAPI (blue). Scale bar: 20 µm. C AGS cells were treated for 14 h with DMSO, 5-FU alone (195.2 µM) or 5-FU combined with capsaicin (50 µM). Immunofluorescence staining was performed to assess DNA damage and PARP1 localization. γH2AX was labeled with DyLight 488 (green), PARP1 with DyLight 649 (red), and nuclei were counterstained with DAPI (blue). Scale bar: 20 µm. D AGS cells were treated for 14 h with Oxalipatin alone (27.6 µM) or Oxalipatin combined with capsaicin (50 µM). Immunofluorescence staining was performed to assess DNA damage and PARP1 localization. γH2AX was labeled with DyLight 488 (green), PARP1 with DyLight 649 (red), and nuclei were counterstained with DAPI (blue). Scale bar: 20 µm
Discussion
Previous studies unveiled an epidemiological evidence that spicy diet exhibited effects against cancer initiation and progression [13]. Among the phytochemical components of the spicy food, capsaicin has been demonstrated to play an important role in regulation of cell survival, growth arrest, angiogenesis and tumor metastasis [3]. Several researches evaluating the effect of capsaicin, and found capsaicin could increase of cell-cycle arrest and induce apoptosis in various cancer types [14]. Although the potential antitumor characteristics of capsaicin exhibited a good application prospect in cancer therapy, the effect of capsaicin on gene expression and its mechanism on chemotherapy sensitization were still uncertain.
In this current research, we provided evidence that capsaicin could significantly inhibit cell viability and induce apoptosis in gastric cancer cells. Through high-throughput sequencing, we found capsaicin could significantly inhibited the expression of genes, which were involved in DNA replication, especially in base excision repair pathway. Base excision repair is the main pathway for the repair of small base lesions in the DNA damage response of mammalian cells [15]. Briefly, BER is initiated by DNA glycosylases which recognize and excise the aberrant base, then AP endonuclease 1 (APE1) recognizes these abasic sites, incises DNA backbone and cooperates with DNA polymerases to inserts one or more nucleotides [12]. Following end-polishing by FEN1, the DNA ligases (e.g., LIG1, LIG3) reconstitute the integrity of the DNA backbone and complete BER process. Our data demonstrated that capsaicin could downregulated the expression level of FEN1 and LIG1 in AGS cells. This may provide a new insight on the findings which capsaicin could block BER pathway and induce cell cycle arrest in tumor cells. The mechanism of how capsaicin regulated FEN1/LIG1 expression still need to be elucidated in further studies.
5-Fluorouracil plus platinum agent (oxalipatin) is still the first-line chemotherapy for gastric cancer [1]. 5-FU induces cytotoxicity by inhibiting thymidylate synthase and disrupting essential biosynthetic processes in DNA replication, while platinum forms intra-/inter-strand crosslinks with DNA thus leading to the inhibition of DNA synthesis [16, 17]. With a widespread usage of these agents, an increasing number of drug resistance have emerged [2]. Therefore, overcoming chemotherapy resistance has become crucial in cancer therapy. Evidences showed that DNA lesions associated with 5-fluorouracil therapy could be repaired by BER [18], meanwhile FEN1 could block platinum chemo-sensitization and synthetic lethality through suppressing double-strand breaks accumulation [19]. Our study unveiled a novel function of capsaicin in inhibiting FEN1 expression. In vitro assay also demonstrated that capsaicin could significant induce cyto-toxicity of 5-FU and Oxaliplatin in gastric cancer cell line. These results indicated a potential pharmacobiology application of capsaicin in anticancer chemotherapy.
Another interesting finding in our study is that capsaicin could act as a potential inhibitor of PARP1 expression. PARP1 is a well-studied enzyme in the response to DNA damage by loosening chromatin at specific sites to promote DNA repair and maintain genomic integrity [11]. Due to the central role in DNA damage repair cascade, PARP1 inhibition is significantly more toxic in cancer cells with homologous recombination (HR) deficiency than in normal cells [20]. Currently, PARP inhibitors (PARPi), such as Olaparib, Rucaparib Niraparib and Talazoparib, have been emerged as a therapeutic strategy for tumors with high genomic instability [21]. However, artificial PARPi frequently exhibits hematological and gastrointestinal side-effects, meanwhile, multiple mechanisms (e.g., restoration of HR repair, alternative DNA repair pathways, decreased PARPi pharmacodynamic effect) contributing to PARPi resistance limit its usage in clinical practice [22]. In this study, we found that capsaicin presents a latent capacity to inhibit both PARP1 expression and nuclear accumulation. Thus, capsaicin may act as a new breakthrough in antitumor therapeutic strategy.
Through RNA sequencing data, we also found that up-regulated genes triggered by capsaicin could enrich in immune response signals, such as cell defense to virus, cell response to bacterium and type-I interferon pathways. Likewise, the receptor of capsaicin, TRPV1, has been reported to induce pro-inflammatory cytokine production when activated [23]. Till now, researches on the immunological regulation of TRPV1 is focused on neuro-immune interactions [24]. The effect of capsaicin/TRPV1 in tumor immunology is still uncertain. Our data provided a new hypothesis that capsaicin could play an effect on tumor immune response in gastric cancer. Further research on the characteristics and function of capsaicin in regulating tumor immunology is required.
In conclusion, our study demonstrated that capsaicin could inhibit DNA repair, thereby inhibited cell viability and improved the sensitivity of chemotherapy in gastric cancer cells. These findings revealed the biological function of capsaicin in tumor suppression and provided potential targets in cancer therapy.
Supplementary Information
Acknowledgements
We would like to thank the Experimental Medicine Center of Tongji Hospital for providing support to our experiments. We thank Sophia Xie (Wuhan Britain-China School) for her assistance with experimental work, data analysis, and manuscript editing during the early stages of this study.
Abbreviations
- 5-FU
5-Fluorouracil
- ANOVA
Analysis of variance
- BER
Base excision repair
- DEG
Differentially expressed gene
- DMEM
Dulbecco’s minimum essential medium
- EMT
Epithelial–mesenchymal transition
- FEN1
Flap endonuclease 1
- FBS
Fetal bovine serum
- GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
- GO
Gene ontology
- GSEA
Gene set enrichment analysis
- HR
Homologous recombination
- LIG1
DNA ligases 1
- MMR
Mismatch repair
- NP40
Nonidet P40 substitute 4
- PARP1
Poly ADP-ribose polymerase 1
- PI
Propidium iodide
- qPCR
Quantitative real-time polymerase chain reaction
- SD
Standard deviation
- SDS-PAGE
Sodium dodecyl sulfate -polyacrylamide gel electrophoresis
Author contributions
J.S. was responsible for study design and project administration. W.M., K.X., and Z.Q. were responsible for performing experiments and data collecting; W.M, K.X., Z.Q., and R.Z. contributed to extracting and analyzing data; W.M. and J.S. wrote the manuscript; J.S. revised and edited manuscript; J.S. contributed to funding acquisition.
Funding
This work was supported by Hubei Provincial Natural Science Foundation of China (Grant numbers: 2023 AFB118) and National Natural Science Foundation of China (Grant numbers: 32400582).
Data availability
All data generated or analyzed during this study are included in this article. The high-throughput sequencing data could be found in the ArrayExpress database (https://www.ebi.ac.uk/arrayexpress/) with accession number: E-MTAB-14511. The datasets used and/or analyzed during the current study are available from the first author and corresponding author upon reasonable request.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Weijian Meng and Kun Xie have equally contributed to this work.
References
- 1.Yamashita K, Hosoda K, Niihara M, Hiki N. History and emerging trends in chemotherapy for gastric cancer. Ann Gastroenterol Surg. 2021;5:446–56. 10.1002/ags3.12439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Liu J, Yuan Q, Guo H, Guan H, Hong Z, Shang D. Deciphering drug resistance in gastric cancer: potential mechanisms and future perspectives. Biomed Pharmacother. 2024;173:116310. 10.1016/j.biopha.2024.116310. [DOI] [PubMed] [Google Scholar]
- 3.Chapa-Oliver AM, Mejia-Teniente L. Capsaicin: from plants to a cancer-suppressing agent. Molecules. 2016. 10.3390/molecules21080931. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hacioglu C. Capsaicin inhibits cell proliferation by enhancing oxidative stress and apoptosis through SIRT1/NOX4 signaling pathways in HepG2 and HL-7702 cells. J Biochem Mol Toxicol. 2022;36:e22974. 10.1002/jbt.22974. [DOI] [PubMed] [Google Scholar]
- 5.Radhakrishna GK, Ammunje DN, Kunjiappan S, Ravi K, Vellingiri S, Ramesh SH, et al. A comprehensive review of capsaicin and its role in cancer prevention and treatment. Drug Res. 2024;74:195–207. 10.1055/a-2309-5581. [DOI] [PubMed] [Google Scholar]
- 6.Dong H, Jia W, Meng W, et al. DAB2IP inhibits glucose uptake by modulating HIF-1α ubiquitination under hypoxia in breast cancer. Oncogenesis. 2024;13(1):20. 10.1038/s41389-024-00523-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Feng S, Huang Q, Deng J, Jia W, Gong J, Xie D, et al. DAB2IP suppresses tumor malignancy by inhibiting GRP75-driven p53 ubiquitination in colon cancer. Cancer Lett. 2022;532:215588. 10.1016/j.canlet.2022.215588. [DOI] [PubMed] [Google Scholar]
- 8.Shen J, Cao B, Wang Y, et al. Hippo component YAP promotes focal adhesion and tumour aggressiveness via transcriptionally activating THBS1/FAK signalling in breast cancer. J Exp Clin Cancer Res. 2023. 10.1186/s13046-023-02864-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Shen J, Huang Q, Jia W, et al. YAP1 induces invadopodia formation by transcriptionally activating TIAM1 through enhancer in breast cancer. Oncogene. 2022;41(31):3830–45. 10.1038/s41388-022-02344-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Zhao H, Cao N, Liu Q, et al. Inhibition of the E3 ligase UBR5 stabilizes TERT and protects vascular organoids from oxidative stress. J Transl Med. 2024;22(1):1080. 10.1186/s12967-024-05887-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sinha S, Molla S, Kundu CN. PARP1-modulated chromatin remodeling is a new target for cancer treatment. Med Oncol. 2021;38:118. 10.1007/s12032-021-01570-2. [DOI] [PubMed] [Google Scholar]
- 12.Visnes T, Grube M, Hanna BMF, Benitez-Buelga C, Cazares-Korner A, Helleday T. Targeting BER enzymes in cancer therapy. DNA Repair. 2018;71:118–26. 10.1016/j.dnarep.2018.08.015. [DOI] [PubMed] [Google Scholar]
- 13.Aggarwal BB, Shishodia S. Molecular targets of dietary agents for prevention and therapy of cancer. Biochem Pharmacol. 2006;71:1397–421. 10.1016/j.bcp.2006.02.009. [DOI] [PubMed] [Google Scholar]
- 14.Szallasi A. Capsaicin and cancer: guilty as charged or innocent until proven guilty? Temperature. 2023;10:35–49. 10.1080/23328940.2021.2017735. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Curtin NJ. DNA repair dysregulation from cancer driver to therapeutic target. Nat Rev Cancer. 2012;12:801–17. 10.1038/nrc3399. [DOI] [PubMed] [Google Scholar]
- 16.Sethy C, Kundu CN. 5-fluorouracil (5-FU) resistance and the new strategy to enhance the sensitivity against cancer: implication of DNA repair inhibition. Biomed Pharmacother. 2021;137:111285. 10.1016/j.biopha.2021.111285. [DOI] [PubMed] [Google Scholar]
- 17.Zhang C, Xu C, Gao X, Yao Q. Platinum-based drugs for cancer therapy and anti-tumor strategies. Theranostics. 2022;12:2115–32. 10.7150/thno.69424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Vodenkova S, Jiraskova K, Urbanova M, Kroupa M, Slyskova J, Schneiderova M, et al. Base excision repair capacity as a determinant of prognosis and therapy response in colon cancer patients. DNA Repair. 2018;72:77–85. 10.1016/j.dnarep.2018.09.006. [DOI] [PubMed] [Google Scholar]
- 19.Mesquita KA, Ali R, Doherty R, Toss MS, Miligy I, Alblihy A, et al. Fen1 blockade for platinum chemo-sensitization and synthetic lethality in epithelial ovarian cancers. Cancers. 2021. 10.3390/cancers13081866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson TB, et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature. 2005;434:917–21. 10.1038/nature03445. [DOI] [PubMed] [Google Scholar]
- 21.Bohi F, Hottiger MO. Expanding the perspective on PARP1 and its inhibitors in cancer therapy: from DNA damage repair to immunomodulation. Biomedicines. 2024. 10.3390/biomedicines12071617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Mitri Z, Goodyear SM, Mills G. Strategies for the prevention or reversal of PARP inhibitor resistance. Expert Rev Anticancer Ther. 2024. 10.1080/14737140.2024.2393251. [DOI] [PubMed] [Google Scholar]
- 23.Socala K, Jakubiec M, Abram M, Mlost J, Starowicz K, Kaminski RM, et al. TRPV1 channel in the pathophysiology of epilepsy and its potential as a molecular target for the development of new antiseizure drug candidates. Prog Neurobiol. 2024;240:102634. 10.1016/j.pneurobio.2024.102634. [DOI] [PubMed] [Google Scholar]
- 24.Maximiano TKE, Carneiro JA, Fattori V, Verri WA. TRPV1: receptor structure, activation, modulation and role in neuro-immune interactions and pain. Cell Calcium. 2024;119:102870. 10.1016/j.ceca.2024.102870. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analyzed during this study are included in this article. The high-throughput sequencing data could be found in the ArrayExpress database (https://www.ebi.ac.uk/arrayexpress/) with accession number: E-MTAB-14511. The datasets used and/or analyzed during the current study are available from the first author and corresponding author upon reasonable request.