Skip to main content
Foods logoLink to Foods
. 2025 Sep 21;14(18):3275. doi: 10.3390/foods14183275

Exploiting Marker Genes for Reliable Botanical Authentication of Bacopa monnieri Products

Rita Biltes 1, Caterina Villa 1, Joana Costa 1, Isabel Mafra 1,*
Editor: Oscar Núñez1
PMCID: PMC12469326  PMID: 41008247

Abstract

Bacopa monnieri, commonly known as Brahmi, is a perennial herbaceous plant used in Ayurvedic medicine owing to its nootropic properties. The increased demand for bacopa-derived herbal/food products has motivated adulteration practices through plant substitution. This work is aimed at developing a new method for B. monnieri detection and quantification in herbal products. The chloroplast gene encoding the Ycf1 photosystem I assembly protein (Ycf1) and the nuclear gene coding for the flavonoid glucosyltransferase (Flag) were selected as candidate markers to develop a real-time PCR assay with EvaGreen dye for B. monnieri detection. Both markers were specific to the target species, with Ycf1 providing the best real-time PCR kinetics and highest sensitivity. Therefore, a new method targeting the Ycf1 barcode was developed, exhibiting high specificity and a sensitivity of 1 pg of bacopa DNA. Additionally, a calibration model was proposed using reference mixtures of B. monnieri in Ginkgo biloba with a linear dynamic range of 25–0.1% (w/w). The curve parameters of slope, PCR efficiency and correlation coefficient met the acceptance criteria. The method was successfully validated with blind mixtures and further applied to commercial herbal products, revealing an important level of adulteration in bacopa/Brahmi-labelled products (60%) due to absence of or reduction in bacopa content. In this work, the first quantitative real-time PCR method for the botanical authentication of B. monnieri in herbal products is proposed as a powerful tool, which can be used by quality control laboratories and regulatory authorities to ensure labelling compliance.

Keywords: Bacopa monnieri, Brahmi, real-time PCR, authentication, botanical adulteration, quantification

1. Introduction

Bacopa monnieri (L.) Pennell, commonly known as Brahmi, hyssop, herb of grace or water hyssop, is a small, non-aromatic perennial herbaceous plant belonging to the Plantaginaceae family [1]. It is commonly found growing in South and Southeast Asia, Africa, America and Australia, typically in warm marsh habitats [2]. B. monnieri has a long history in traditional medicine, being used for thousands of years as a therapeutic herb in Ayurvedic medicine in India, mainly as a nerve tonic and nootropic booster [1]. Additionally, it has been reported to have other pharmacological actions such as antioxidant, anticancer, antidiabetic, analgesic, hepatoprotective, cardiotonic and diuretic activity [2,3]. B. monnieri contains bioactive compounds such as alkaloids, saponins, glycosides, flavonoids, triterpenes and cucurbitacin [4]. Specifically, some examples are brahmine, bacosides A and B, saponins A, B, and C, aspartic acid, brahmic acid, betulinic acid, beta-sitosterol, apigenin and serine [5], of which bacoside A and betulinic acid are believed to have the main therapeutic action [5,6].

B. monnieri can be used as a whole plant or an extract, on its own or in combination with other nootropic herbs in various dosage forms, including as a fresh juice, soft paste of fresh herbs, product processed with clarified butter, oil or fine dry powder or tablet [7]. Additionally, novel product formulations have been tested to incorporate B. monnieri plant or its extracts into different food products such as candy, cereals, dried food products, soup mixes, herbal whey beverages and meat products, some being already available in the Indian market [8,9,10]. The primary cultivation countries of B. monnieri are India, Nepal and Sri Lanka [11]. The market is dominated by the Asian Pacific region (33%), followed by North America (25%), and the “Brahmi market” is forecasted to reach $320 million by 2026, with a compound annual growth rate (CAGR) of 6.1% during 2021 to 2026 [12]. Corroborating this data forecast, in 2022, the global market for brain health supplements, including B. monnieri health products, was valued at $8.2 billion and is expected to nearly double by 2030, with a CAGR of 8.3% [13,14]. The expansion of the market size suggests a growing demand for herbal products, which may lead to an increased risk of adulteration, involving unintended or deliberate plant swaps, contamination or addition of illegal substances or admixtures [15]. In India, B. monnieri and Centella asiatica are often sold under the same common name – Brahmi – leading to confusion between the two species [16]. Moreover, B. monnieri is by itself a common adulterant of Portulaca oleracea due to the morphological similarities of both plants [17,18].

Health products containing botanicals such as B. monnieri primarily fall under the category of food supplements, thus being regulated as foods by the European Food Safety Authority and not requiring any approval before commercialisation by the Food and Drug Administration (FDA) [15]. Additionally, the European Union (EU) novel catalogue [19] does not classify B. monnieri as a novel food, since it has been used as such before 15 May 1997. Therefore, it is not subject to pre-market authorisation according to Regulation (EU) 2015/2283. However, these products must comply with Regulation (EU) No 1169/2011 on the provision of food information to consumers and Directive 2004/24/EC regarding traditional herbal medicinal products [20]. On the other hand, the FDA has not approved products containing this plant for medical purposes. In fact, in 2019, warnings were issued to dietary supplement manufacturers who produce products containing B. monnieri, cautioning against making any therapeutic claims regarding its use [21]. Considering this, ensuring the safety, quality and trustworthiness of the B. monnieri health products is essential.

Therefore, the development of analytical methodologies for the botanical authentication of herbal products and plant food supplements are of utmost importance to ensure their safety and quality. Several methodologies have been currently proposed for this purpose, including morphological identification, chromatographic analysis of phytochemical compounds and genetic approaches based on DNA markers. DNA-based methods have been proposed as highly suitable for the botanical authentication of complex and processed matrices such as raw and processed botanicals, herbal products, and plant food supplements [22]. They provide highly specific, sensitive, robust and reliable tools targeting markers ubiquitous in all tissues, independent from the part of the plant, physiological conditions and environment, in opposition to phenotypic and chemical markers. Several DNA-based approaches have been successfully applied to authenticate herbal products, namely DNA barcoding, species-specific PCR, real-time PCR, sequence-characterised amplified region (SCAR) and high-resolution melting (HRM) analysis, among others [22,23]. Real-time PCR is the technique of choice of many laboratories because of its quantitative aptitude and applicability to highly processed food matrices.

To date, few studies using DNA-based methodologies have been conducted to authenticate B. monnieri plant or herbal commercial products. A randomly amplified polymorphic DNA (RAPD)-based SCAR method was proposed for the identification of B. monnieri from its potential adulterants, namely Centella asiatica, Eclipta alba and Malva rotundifolia [24]. Tungphatthong et al. [25] developed a HRM analysis targeting a barcode marker (trnL-F) to differentiate B. monnieri from B. caroliniana and B. floribunda species. Thakur et al. [26] exploited amplicon length polymorphisms using several universal DNA barcode regions, of which atpF-atpH, trnH-psbA and trnL allowed for discrimination of 46 medicinal plant species, including B. monnieri and C. asiatica. Shah et al. [16] aimed to develop SCAR marker-based PCR and metabarcoding methods to authenticate Brahmi herbal products, comparing them with chemical approaches. Results showed a relatively low success rate for SCAR marker PCR amplification, while the metabarcoding approach was able to detect the target and non-target species. Xu et al. [18] developed species-specific PCR and real-time PCR assays to detect B. monnieri as a potential adulterant of Portulaca oleracea. The qualitative PCR assay was successfully applied to analyse commercial herbal products, but without providing any quantitative determination.

This work aimed at developing a new real-time PCR method for B. monnieri detection and quantification in herbal products. For this purpose, several DNA sequences were in silico analysed to identify candidate marker sequences specific for the target species. The best marker was selected to propose a sensitive, specific and cost-effective tool. Accordingly, a calibration model was developed using model mixtures of B. monnieri in Ginkgo biloba leaf material. The choice of G. biloba was due to its most popular use for medicinal purposes, having properties against cognitive impairment in the elderly [27], thus making it a nootropic herb [13]. The method was further validated with blind mixtures and applied to commercial herbal products to verify labelling compliance.

2. Materials and Methods

2.1. Plant Species and Commercial Samples

Leaf and stem tissues from B. monnieri were kindly provided by the Botanic Garden of Helsinki (Finland) and Berlin (Germany). Plant tissues were oven-dried at 30 °C in the dark for 5 days. After drying, the plant tissue was submerged in liquid nitrogen and then ground with a mortar and pestle. In addition, 72 non-target species, including medicinal plants, herbs and spices, as well as legumes, cereals and animal species used as food, were assessed for the specificity of the designed molecular markers (Table 1). Plant and animal tissues were acquired from commercial shops and botanic gardens. Commercial herbal products labelled as Bramhi or B. monnieri (6 samples), Gotu Kola or C. asiatica (11 samples) and G. biloba (1 sample) were acquired at local stores and through the internet.

Table 1.

Animal and plant species used in specificity testing using primers targeting the genes coding for the flavonoid glucosyltransferase (Flag) and Ycf1 photosystem I assembly protein (Ycf1) of B. monnieri.

Common Name Species Qualitative PCR a
18S rRNA Flag Ycf1
Bacopa Bacopa monnieri b +++ +++ +++
Bacopa B. monnieri c +++ +++ +++
House cricket Acheta domestica +++ - -
Onion Allium cepa +++ - -
Garlic Allium sativum +++ - -
Lemon verbena Aloysia citrodora +++ - -
Ananas Ananas comosus +++ - -
Daisy-leaved toadflax Anarrhinum bellidifolium +++ - -
Carniolan honeybee Apis mellifera carnica +++ - -
Celery Apium graveolens +++ - -
Common bearberry Arctostaphylos uva-ursi +++ - -
Argan Argania spinosa L. +++ - -
Spirulina Arthrospira platensis +++ - -
Cow Bos taurus +++ - -
Green tea Camellia sinensis +++ - -
Spanish chestnut Castanea sativa +++ - -
Gotu kola Centella asiatia +++ - -
Bitter orange Citrus aurantium +++ - -
Borututu Cochlospermum angolense +++ - -
Coriander Coriandrum sativum +++ - -
Oysters Crassostrea angulata +++ - -
Hawthorn Crataegus monogyna +++ - -
Turmeric Curcuma longa +++ - -
Lemongrass Cymbopogon citratus +++ - -
Artichoke Cynara cardunculus var. scolymus +++ - -
Scotch broom Cytisus scoparius +++ - -
Truncate donax Donax trunculus +++ - -
Siberian ginseng Eleutherococcus senticosus +++ - -
Common horsetail Equisetum arvense +++ - -
Messmate stringybark Eucalyptus obliqua L’Hér +++ - -
Common fennel Foeniculum vulgare +++ - -
Cod Gadus morhua +++ - -
Chicken Gallus gallus domesticus +++ - -
Herb-robert Geranium robertianium +++ - -
Ginkgo Ginkgo biloba +++ - -
Soybean Glycine max L. +++ - -
St. John’s wort Hypericum perforatum +++ - -
Laurel Laurus nobilis +++ - -
White leg shrimp Litopenaeus vannamei +++ - -
Chamomile Matricaria chamomilla +++ - -
Lemon balm Melissa officinalis +++ - -
Peppermint Mentha piperita L. +++ - -
Common ling Molva molva +++ - -
Incense Pittosporum undulatum Vent. +++ - -
Olive Olea europaea L. +++ - -
Domestic sheep Ovis aries +++ - -
Asian ginseng Panax ginseng +++ - -
Passion fruit Passiflora edulis +++ - -
Avocado Persea americana +++ - -
Parsley Petroselinum crispum +++ - -
Forkbeard Phycis phycis +++ - -
Stone pine Pinus pinea +++ - -
Common plum Prunus domestica +++ - -
Guava Psidium guajava +++ - -
Sea radish Raphanus raphanistrum subsp. maritimus +++ - -
Blackberry Rubus fruticosus L. +++ - -
Sage Salvia officinalis +++ - -
Rosemary Salvia rosmarinus +++ - -
Atlantic chub mackerel Scomber colias +++ - -
Egyptian senna Senna alexandrina +++ - -
Common cuttlefish Sepia officinalis +++ - -
White mustard Sinapis alba +++ - -
Tomato Solanum lycopersicum +++ - -
Arizona necklacepod Sophora arizonica +++ - -
Common dandelion Taraxacum officinale +++ - -
Yellow mealworm Tenebrio molitor +++ - -
White garden snail Theba pisana +++ - -
European white lime Tilia tomentosa +++ - -
Hare’s-foot clover Trifolium arvense +++ - -
Trefoil Trifolium sp. +++ - -
Broad bean Vicia faba +++ - -
Grape vine Vitis vinífera L. +++ - -
Maize Zea mays +++ - -
Ginger Zingiber officinale +++ - -

a +++, strong PCR fragment; -, no PCR fragment. b Origin: Botanic Garden of Helsinki; c Origin: Botanic Garden of Berlin.

For method development, a reference mixture containing 25% B. monnieri dried leaves in G. biloba was prepared and further used for the subsequent mixtures of 10 to 0.1% by serial additions of ground G. biloba material. For method validation, seven blind mixtures were independently prepared as described for the reference mixtures, containing 20 to 0.2% (w/w) B. monnieri in G. biloba (Figure 1). The tissues were ground with a mortar/pestle or using a Grindomix GM200 laboratory mill (Retsch, Haan, Germany).

Figure 1.

Figure 1

Schematic representation of the experimental workflow for real-time PCR method development targeting B. monnieri.

2.2. DNA Extraction

DNA extracts of plant material (50 mg), including reference and blind mixtures, commercial samples and cross-reactivity species were obtained using the NucleoSpin Plant II kit (Macherey-Nagel, Düren, Germany) with PL1 lysis buffer, according to the manufacturer’s protocol with minor adjustments as described by Biltes et al. [28]. DNA from animal tissues was extracted with the NucleoSpin Food kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s instructions with minor adjustments. The extracts were stored at −20 °C until further analysis. The purity and yield of the DNA extracts were measured using UV spectrophotometry [28].

2.3. Screening of Molecular Markers

Firstly, a screening of 133 sequences available in the NCBI database (https://www.ncbi.nlm.nih.gov/ accessed on 31 January 2023) was performed to identify candidate markers specific to B. monnieri. The selection criteria were based on sequence identity: sequences showing more than 85% identity with non-target species were discarded, and the remaining sequences were evaluated for the design of specific, high-performance primers. Accordingly, the nuclear gene coding for the flavonoid glucosyltransferase (Flag) and the chloroplast gene Ycf1 photosystem I assembly protein (Ycf1) were selected for primer design (Table 2). In silico analysis of sequences and primers was conducted using Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 30 May 2024) and primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 30 May 2024) tools. Additionally, the absence of hairpin formation and self-hybridisation, as well as primer properties, were checked using the Oligo Calculator software v3.19 (http://oligocalc.eu/, accessed on 30 May 2024).

Table 2.

Primer sequences targeting B. monnieri gene markers and a conserved eukaryotic region, respective PCR products and PCR conditions.

Target Gene Primers Sequence (5→3) Amplicon Annealing Temperature Concentration (nM) NCBI Accession/
Reference
Flavonoid glucosyltransferase BMflagA-F
BMflagA-R
CGATTAAGGTTGTCGCTGCG
TATCCCTGTTCCAGCTCCTCA
100 bp 58 °C 200 FJ586246.1
Ycf1 photosystem I assembly protein BMYcf1-F
BMYcf1-R
ACGAATACGACCGATCCACC
ATTTTACGCCTTTGAGCTCGT
110 bp 62 °C 200 NC_047469.1
BMYcf1S-F
BMYcf1S-R
ATCAGGAGAACGTCAAGAAGATGTA
TGATTCTTTTGTCCCTACCCAATTTTG
370 bp 60 °C 200 NC_047469.1
Nuclear 18S rRNA 18SRG-F
18SRG-R
CTGCCCTATCAACTTTCGATGGTA
TTGGATGTGGTAGCCGTTTCTCA
113 bp 65 °C 240 [29]
EG-F
EG-R
TCGATGGTAGGATAGTGGCCTACT
TGCTGCCTTCCTTGGATGTGGTA
109 bp 63 °C 240 [30]
18SEU-F
18SEU-R
TCTGCCCTATCAACTTTCGATGG
TAATTTGCGCGCCTGCTG
140 bp 60 °C 240 [31]

To verify the amplification capacity of DNA extracts, primers targeting the nuclear 18S rRNA genes were used as universal eukaryotic markers (Table 2). Primers were synthesised by Eurofins MWG Operon (Ebersberg, Germany).

2.4. Qualitative PCR

Qualitative PCR assays were performed in a total reaction volume of 25 μL, containing 10–20 ng of DNA, 1 U of SuperHot Taq DNA Polymerase, 1× PCR buffer (67 mM Tris-HCl, pH 8.8, 16 mM (NH4)2SO4, 0.01% Tween 20; Genaxxon Bioscience GmbH, Ulm, Germany), 3.0 mM of MgCl2 (Genaxxon Bioscience GmbH, Ulm, Germany), 200 µM of each dNTP (Grisp, Porto, Portugal), and 200 to 240 nM of each primer (Table 2). The reactions were performed in a thermal cycler MJ Mini (Bio-Rad, Hercules, CA, USA) using the following program: initial denaturation at 95 °C for 5 min, followed by 40 cycles (except for primers 18SRG-F/18SRG-R with 33 cycles, and 35 cycles for EG-F/EG-R and 18SEU-F/18SEU-R) at 95 °C for 30 s, 58 to 65 °C (according to Table 2) for 30 s and 72 °C for 30 s, with a final extension at 72 °C for 5 min. The amplified fragments were analysed by electrophoresis in a 1.5% agarose gel as described by Biltes et al. [28].

2.5. Sequencing

For confirmation purposes, a region of the Ycf1 gene was partially sequenced using the primers BMYcf1S-F/BMYcf1S-R (Table 2). The reaction mix followed the same protocol as described above, containing 60 ng of B. monnieri DNA. The PCR fragments were purified using the GRS PCR & Gel Band Purification Kit (GRISP, Porto, Portugal) to remove any eventual interfering components and sent to a specialised facility for sequencing (Eurofins Genomics, Ebersberg, Germany). The fragment was double sequenced, which involved the direct sequencing of both strands in opposite directions to allow for production of two complementary sequences with high quality. BioEdit v7.2.5 software (Ibis Biosciences, Carlsbad, CA, USA) and FinchTV v1.4.0 software (Geospiza, Seattle, WA, USA) were used to align sequencing data and to analyse the electropherograms, respectively.

2.6. Real-Time PCR

For real-time PCR amplifications, the reactions were carried out in a total volume of 20 µL, containing 2 µL of DNA (10 ng or 10 ng to 1 pg for 10-fold serial dilution curve), 1× SsoFast EvaGreen Supermix (Bio-Rad Laboratories, Hercules, CA, USA) and 300 nM of BMYcf1-F/BMYcf1-R primers (Table 2). A fluorometric CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) was used to perform the amplifications under the following conditions: 95 °C for 5 min, followed by 50 cycles at 95 °C for 10 s, 62 °C for 20 s, and 72 °C for 30 s, with the fluorescent signal being collected at the end of each cycle. For melting curve analysis, the following program was used: 95 °C for 1 min, 65 °C for 3 min; melting curve ranging from 70.0 to 95.0 °C, with temperature increments of 0.2 °C/10 s. The fluorescence signal was collected at the end of each increment. Real-time PCR data and melting curve data were analysed using Bio-Rad CFX Maestro 2.3 (Bio-Rad Laboratories, Hercules, CA, USA). Samples were amplified in triplicate at least in three independent runs.

Real-time PCR calibration curves were constructed with amplified 10-fold serially diluted B. monnieri DNA extracts (10 ng–1 pg), which plotted the Cq values versus the log of B. monnieri DNA for the determination of the absolute limit of detection (LOD) and quantification (LOQ). In addition, a calibration model accounting for matrix and processing effects was constructed using the extracts of reference mixtures of B. monnieri in G. biloba (0.1–25%) amplified with an identical DNA concentration (5 ng/µL), targeting the best performing gene. Therefore, the Cq values of reference mixtures as individual calibrators versus the log of the B. monnieri percentage were plotted and used to estimate B. monnieri content in blind and commercial samples by curve interpolation. For the development and validation of the real-time PCR method, the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines [32] and the minimum performance requirements set by the European Network of GMO Laboratories were carefully considered [33]. Accordingly, acceptable PCR efficiency should fall within 90–110%, the slope in the range of −3.6 and −3.1, and the correlation coefficient (R2) ≥ 0.98. The LOD indicates the lowest amount or concentration of the analyte in a sample detectable with a 95% confidence level to ensure no more than 5% false negative results. The LOQ should be equal to or lower than the minimum amount or concentration covered by the dynamic range. The dynamic range should cover a minimum of 3–4 orders of magnitude [33].

3. Results

3.1. DNA Quality, Selection of Target Markers and Specificity

Generally, DNA extracts of plant material, including reference mixtures and commercial samples, exhibited suitable yields and purities for PCR amplification, which were in the ranges of 50.3–79.4 ng/µL and 1.6–1.7, respectively. The results of PCR assays targeting the 18S rRNA as a universal eukaryotic region demonstrated the high amplification capacity of all extracts, which is particularly relevant for commercial samples and DNA extracts for specificity testing to discard any false negatives.

In silico analysis revealed that the designed new primers targeting the Flag (BMFlagA-F/BMFlagA-R) and Ycf1 (BMYcf1-F/BMYcf1-R) genes (Table 2) are suitable candidate markers for the specific detection of B. monnieri. The first is a nuclear gene, while the latter is a chloroplast gene and a multicopy region that provides higher sensitivity. The results of PCR assay optimisation targeting both gene markers demonstrate their adequacy in detecting B. monnieri, with superior sensitivity for the Ycf1 gene (0.1 pg of DNA) as expected (Figure S1, Supplementary Materials).

For specificity testing, both primer pairs were assayed using 72 non-target species commonly found as ingredients of plant food supplements, herbal products and foods. The results showed that both PCR assays are specific for B. monnieri (Table 1).

3.2. Real-Time PCR Method Development

Based on the previous results, BMFlagA-F/BMFlag-R and BMYcf1-F/BMYcf1-R were considered suitable primer pairs for B. monnieri-specific detection. Thereafter, real-time PCR assays with EvaGreen dye were developed and their performance evaluated and compared. Figure 2 shows the amplification curves, melting peaks and respective calibration curve for both targets using a 10-fold serially diluted B. monnieri DNA extract (10 ng to 1 pg). While the Ycf1 marker provided melting curves with single melt peaks at 77.90 ± 0.27 °C (Figure 2D), inferring the amplification of single PCR products, the Flag gene displayed melt peaks at 81.10 ± 0.14 °C (Figure 2C), but with slight shoulders that suggest more than one type of amplicon. This finding negatively affected the calibration curve slope (−2.841), with a consequent effect on PCR efficiency (124.9%); both parameters were out of acceptable intervals, though linearity was not compromised (R2 = 0.9969) (Figure 2E).

Figure 2.

Figure 2

Real-time PCR amplification (A,B), melting (C,D) and calibration curves (E,F) targeting the genes coding for flavonoid glucosyltransferase (A,C,E) and Ycf1 photosystem I assembly protein (B,D,F) using a 10-fold serially diluted B. monnieri DNA extract ranging from 10 ng to 10 pg (n = 12 replicates). Legend: Green horizontal line, threshold line.

On the other hand, the calibration curve targeting the Ycf1 gene exhibited acceptable parameters regarding slope (−3.261), PCR efficiency (102.6%) and coefficient correlation (R2 = 0.9995) (Figure 2F), suggesting high performance of the assay. Additionally, it reached a higher sensitivity than the Flag gene with an absolute LOD of 1 pg of bacopa DNA, as it was the lowest level that amplified all the replicates (n = 12) (Table S1, supplementary data). The absolute LOQ was established as equal to the absolute LOD since it was within the linear range. The dynamic range covered four orders of magnitude, which is according to the recommended for this type of assay.

To confirm the sequence identity of the Ycf1 fragment, new primers were designed to amplify a 370 bp amplicon encompassing the target region of 110 bp, thus enabling its reliable sequencing. The alignment of the amplicon with the sequence retrieved from the NCBI revealed an almost full homology of sequences, confirming the target fragment (Figure 3). The specificity of the target Ycf1 sequence was further complemented following sequence alignment of B. monnieri with all the available sequence species of the same family retrieved from the NCBI. The alignment results are displayed in Figure S2 (Supplementary Material), showing the substantial differences among sequences, which prevent their amplification with the designed new primers.

Figure 3.

Figure 3

Alignment of sequences of NCBI database (NCBI accession no. NC_04746) and the amplicon of B. monnieri specimen obtained using BMYcf1S-F/BMYcf1S-R primers targeting the gene coding for the Ycf1 photosystem I assembly protein. The black text boxes represent the BMYcf1-F and BMYcf1-R primers, respectively.

Considering the optimum performance of the real-time PCR assay targeting the Ycf1 gene, a quantitative model was developed using the reference mixtures of dried B. monnieri leaves in G. biloba (25%, 10%, 5%, 1%, 0.5% and 0.1%). Figure 4 shows the amplification curves, melting peaks and respective calibration curve. The results of melting curve analysis suggest the amplification of single amplicons with melting temperatures of 77.96 ± 0.12 °C (Figure 4B), which agrees with previous findings using serially diluted bacopa DNA (Figure 2D). The obtained calibration curve (Figure 4C) exhibited high performance as inferred from the parameters of slope (−3.549), PCR efficiency (91.3%) and R2 (0.993), with a dynamic range covering six reference mixtures and three orders of magnitude, which were all within the acceptance criteria. The assay achieved LOD and LOQ values of 0.1%, as all the 12 replicates of 3 independent assays amplified within the linear range.

Figure 4.

Figure 4

Real-time PCR amplification (A), melting (B) and calibration curves (C) targeting the gene coding for Ycf1 photosystem I assembly protein using primers BMYcf1-F/BMYcf1-R and DNA extracts of reference mixtures of dried B. monnieri leaves in G. biloba. Legend: (●) reference mixtures (25.0% 10.0%, 5.0%, 1.0%, 0.5% and 0.1%), (▲) blind samples (20.0%, 15.0%, 7.5%, 3.75%, 2.0%, 0.375% and 0.2%) (n = 3 replicates, 3 independent runs).

3.3. Validation of Method

To validate the method, seven blind mixtures of B. monnieri in G. biloba (20.0%, 15.0%, 7.50%, 3.75%, 2.0%, 0.375% and 0.20% (w/w)) were quantified using the real-time PCR calibration curve targeting the Ycf1 gene (Figure 4C). The comparison of actual and estimated bacopa contents, as well as precision and accuracy data, are summarised in Table 3. The precision was expressed by the coefficient of variation (CV), representing the relative standard deviation of estimates under repeatability conditions. CV data varied between 7.0 and 24.6% and were within the acceptance criteria (≤25%) [33], with the highest value attributed to the lowest tested concentration level (0.20%), where less reliability is normally expected. The trueness of the assay was expressed by the bias or error, demonstrating the closeness of agreement between the actual and estimated bacopa contents. The calculated bias values were between −11.4 and 23.8%, which complied with the acceptable range of ±25% [33].

Table 3.

Validation data using quantitative real-time PCR applied to blind samples of B. monnieri in G. biloba using BMYcf1-F/BMYcf1-R primers.

Sample Cq a
(Mean ± SD)
B. monnieri (% w/w) SD CV b (%) Bias c (%)
Actual Mean
Predicted
A 20.92 ± 0.32 20.0 17.7 2.10 11.8 −11.4
B 21.09 ± 0.15 15.0 14.3 1.00 7.0 −4.7
C 21.92 ± 0.26 7.5 8.19 1.00 12.2 9.2
D 23.06 ± 0.23 3.75 3.87 0.59 15.3 3.2
E 24.17 ± 0.31 2.0 1.83 0.32 17.5 −8.4
F 27.09 ± 0.58 0.375 0.45 0.08 18.8 19.3
G 26.37 ± 0.37 0.20 0.25 0.06 24.6 23.8

a Mean cycle of quantification (Cq) values ± standard deviation (SD) (n = 4) of three independent assays. b Coefficient of variation (CV). c Bias = ((mean estimated value—real value)/real value) × 100.

3.4. Authentication of Commercial Herbal Products

The applicability of the proposed real-time PCR method was then assessed by analysing commercial herbal products. The B. monnieri contents were determined interpolating the calibration curve of Figure 4C. The samples included products labelled with bacopa or Brahmi (6), products labelled as Gotu kola or C. asiatica (11) and one sample without any of the two species (G. biloba) (Table 4). Of the six samples labelled with bacopa/Brahmi, the presence of B. monnieri was confirmed in only three; two of them (P1 and P2) had estimates above the quantitative range and thus likely containing 100% content, while in one (P5), the content (4.19%) was much smaller than the labelled content (100% Brahmi). Concerning the samples labelled with C. asiatica, none of them was positive to B. monnieri as would be anticipated. As expected, the ginkgo-containing sample (P18) was negative to B. monnieri. It is important to highlight that all the samples tested positively for the 18S rRNA gene marker using the EG-F/EG-R primers (Table 4), thus discarding any false negative results. Therefore, out of the 6 samples labelled with bacopa or Brahmi, 4 suggest (P3 to P6) adulteration practices by the absence of or substantial reduction in B. monnieri. All the other non-bacopa declaring samples did not indicate any adulteration by addition of B. monnieri.

Table 4.

Application of the quantitative real-time PCR assay using BMYcf1-F/BMYcf1-R primers for the detection and quantification of B. monnieri in commercial samples.

Sample Origin Relevant Label Information Qualitative PCR a Real-Time PCR
EG-F/
EG-R
BMYcf1-F/
BMYcf1-R
BMYcf1-F/BMYcf1-R
(Cq ± SD) b
Estimated Content (w/w, %) (Mean ± SD) c
P1 Germany 100% Organically grown Bacopa powder + + 18.72 ± 0.07 >25%
P2 India 100% B. monnieri leaf powder + + 19.95 ± 0.01 >25%
P3 India 100% B. monnieri powder + + 31.64 ± 0.15 <LOD
P4 India 100% Bacopa leaf powder + ND d
P5 India 100% Brahmi + + 22.94 ± 0.09 4.19 ± 0.22
P6 India 100% Brahmi whole plant powder + ND
P7 EU 25% Gotu kola (Hydrocotyle asiatica) + ND
P8 Portugal 100% Centella asiatica leaves + ND
P9 India 30% Gotu Kola (C. asiatica) + ND
P10 Portugal 10% C. asiatica aerial parts + ND
P11 Portugal 15% C. asiatica aerial parts + ND
P12 Portugal 100% C. asiatica leaves + ND
P13 India 100% C. asiatica leaves + ND
P14 Portugal 100% C. asiatica leaves + ND
P15 India 10% C. asiatica leaves + ND
P16 India 6.76% Brahmi (C. asiatica) leaves + ND
P17 Portugal 100% C. asiatica leaves + ND
P18 Portugal 15% Ginkgo biloba leaves + ND

a (+) Positive amplification; (−) Negative amplification. b Mean cycle of quantification (Cq) values ± standard deviation (SD) (n = 4 replicates). c Mean content (%) values ± SD (n = 4). d ND, not detected.

Moreover, following the development of a new real-time PCR method to detect and quantify C. asiatica in herbal products, we were able to complement results for some samples regarding this species [28]. Accordingly, the five samples labelled as 100% C. asiatica (P8, P12–P14, P17) contained high amounts of C. asiatica (>25%), while in those labelled as containing between 10 and 30% C. asiatica (P7, P9–P11), the species was not detected, except for P16, which was estimated to contain 17% C. asiatica [28]. These data further suggest the absence of both B. monnieri and C. asiatica in samples (P7, P9–P11), while others (P8, P12–P14, P16, P17) complied with the labelled amount of C. asiatica.

4. Discussion

In the present work, a real-time PCR-based method was developed to establish a true quantitative model of B. monnieri in herbal material. For this purpose, a reference curve was constructed using binary mixtures with known concentrations of the target plant mixed in G. biloba. G. biloba was selected due to its popularity and known nootropic effects [13,27]. Given its widespread use as one of the most popular medicinal plants globally, it is frequently included as a co-ingredient in neurological herbal formulations. Using G. biloba as a standardised and controlled matrix for method validation ensures reproducibility and reliable quantification of B. monnieri in complex herbal products. The developed method, based on matrix-adapted standards, accounted for the matrix effect since all the standards were individual plant extracts [34], not serially diluted DNA. Despite that, a calibration curve within 25–0.1% bacopa in ginkgo plant material was set, showing acceptable performance parameters of slope, linearity, PCR efficiency and dynamic range coverage. To validate the method, the precision and accuracy were assessed based on seven blind mixtures. According to Kang [34], for food analysis using real-time PCR methods, bias and CV are generally considered acceptable within a maximum range of 25–30%. The herein proposed method based on matrix-adapted standards exhibited CV and bias data below 25%, which confirms its precision and trueness to estimate bacopa in herbal products. However, the application of this approach to other plant matrices might affect the target species amplification due to matrix effects and the presence of inhibitor compounds [28,35]. This can be noted during real-time PCR amplification, when observing fallen curve profiles. To overcome this problem, different DNA extraction protocols should be attempted, and/or a new calibration curve should be prepared, simulating as closely as possible the plant matrix to be evaluated.

To advance a real-time PCR method suitable for authenticating plants or commercial products, parameters such as specificity, sensitivity, PCR efficiency, linearity and dynamic range must be addressed and aligned with the specified criteria outlined in the international guidelines or standards [32,33,34]. In this regard, to guarantee the specificity of the method, a nuclear and a chloroplast gene marker were selected among several sequences in the NCBI and scrutinised by in silico and in vitro approaches using 72 non-target relevant species as ingredients normally used in herbal products and/or food supplements [36]. Both the Flag and Ycf1 gene markers were revealed to be specific, as confirmed by the in silico screening results and by the absence of any PCR amplicon besides the target plant species. The Flag gene was selected as a nuclear marker coding for the flavonoid glucosyltransferase, while Ycf1 is a chloroplast gene considered as a promising barcode marker for land plants [37]. Thereafter, both markers were assessed by real-time PCR with EvaGreen dye as a more economic and simple approach than a probe system. Melting curve analysis confirmed fragment specificity for the Ycf1 gene marker, while Flag exhibited neither single melt peaks nor adequate real-time PCR kinetics. The amplicon identity was further confirmed by sequencing analysis, though with minor variability, which was anticipated, as this is a multicopy region [38]. The developed real-time PCR assay targeting the Ycf1 gene complied with the minimum performance requirements regarding the slope of the standard curve, linearity, PCR efficiency and dynamic range for the detection and quantification of B. monnieri DNA, achieving an absolute LOD and LOQ of 1 pg of bacopa DNA. This sensitivity was similar to the one obtained by Xu et al. [18], who targeted a multicopy region (ITS2) by species-specific PCR and real-time PCR with SYBR Green dye. However, the referred authors neither provided a calibration curve nor any performance parameter data to further compare the results.

The application of the developed real-time PCR method to commercial herbal products suggests an important level of adulteration due to full or partial substitution of B. monnieri with other plant(s) in four out of six Brahmi/bacopa products. Nonetheless, the potential addition of B. monnieri to C. asiatica products, which can also be called Brahmi, was not detected in any of the 11 tested products. This finding agrees with the high level of adulteration (55.6%) identified in Brahmi products by DNA metabarcoding [16]. DNA metabarcoding is a high-throughput sequencing approach that allows for the simultaneous detection of multiple taxa, including B. monnieri and C. asiatica. Despite the high sensitivity of high-throughput sequencing, it is a rather qualitative approach as it relies on the percentage of reads to estimate plant species, which is affected by several factors, such as the quality and integrity of extracted DNA, the library preparation method in PCR and sequencing platform [16]. Additionally, DNA metabarcoding requires bioinformatic experts and much more costly equipment and consumables than real-time PCR. Therefore, the herein-developed method allows for the quantification of B. monnieri in herbal products, and it is one of the most comprehensive and fully validated approaches available so far. Keeping in mind the current presence of C. asiatica in herbal products and the high level of adulteration detected in the analysed bacopa/Brahmi products, we have already advanced the development of a real-time PCR method to detect and quantify this species, which further complements the results of some samples, suggesting that those declared to be 100% C. asiatica comply with the declared species, but those with lower C. asiatica proportions mostly indicate the absence of the species [28].

The development of a novel real-time PCR-based tool to authenticate B. monnieri commercial products represents a new achievement in the field. To our knowledge, such a tool has not been previously developed. As highlighted earlier, the Brahmi market is expanding, with various herbal products being globally commercialised or developed in different forms and dosages containing this nootropic plant. This increases the risk of plant substitution or addition of illegal substances, leading to adulteration practices. In response to these challenges, a robust, accurate, sensitive and reproducible real-time PCR method was developed to address these concerns.

5. Conclusions

In the present work, a novel molecular marker was proposed for the species-specific detection of B. monnieri by qualitative PCR and real-time PCR. To our knowledge, the developed real-time PCR method is one of the most comprehensive and fully validated approaches available so far to detect/quantify B. monnieri, demonstrating high specificity and sensitivity for the target species, down to 1 pg of bacopa DNA. Additionally, a calibration model was proposed using reference mixtures as matrix-adapted standards of B. monnieri in G. biloba. The method exhibited high analytical performance, meeting the acceptance criteria regarding calibration curve slope, PCR efficiency and coefficient of correlation amd covering a linear dynamic range of 25–0.1% (w/w) of B. monnieri in G. biloba. Validation of the quantitative real-time PCR method with blind mixtures highlights the high precision and accuracy of the proposed method to estimate bacopa in herbal products. Its applicability was further demonstrated by analysing commercial herbal products, which revealed an important level of adulteration in bacopa/Brahmi-labelled products (60%) by the absence of or reduction in bacopa. This study proposes a comprehensive and validated quantitative real-time PCR method for the botanical authentication of B. monnieri in herbal products as a powerful tool for control laboratories and regulatory authorities to ensure labelling compliance.

Acknowledgments

The authors are grateful for the supply of leaves from the Botanic Garden of Helsinki (Helsinki, Finland) and Botanic Garden of Berlin (Berlin, Germany).

Abbreviations

The following abbreviations are used in this manuscript:

CAGR Compound annual growth rate
Cq Cycle of quantification
CV Coefficient of variation
EU European Union
FDA Food and Drug Administration
Flag Flavonoid glucosyltransferase gene
GMO Genetically modified organisms
HRM High resolution melting
LOD Limit of detection
LOQ Limit of quantification
MIQE Minimum information for publication of quantitative real-time PCR experiments
PCR Polymerase chain reaction
RAPD Randomly amplified polymorphic DNA
SCAR Sequence-characterised amplified region
SD Standard deviation
Ycf1 Ycf1 photosystem I assembly protein gene

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/foods14183275/s1. Table S1: Amplification and calibration curve data of real-time PCR assays targeting the genes coding for the flavonoid glucosyltransferase (Flag) and Ycf1 photosystem I assembly protein (Ycf1) using a 10-fold serially diluted B. monnieri DNA extract; Figure S1: Agarose gel electrophoresis of PCR products targeting the flavonoid glucosyltransferase (A) and Ycf1 photosystem I assembly protein (B) genes using 10-fold serially diluted B. monnieri DNA amplified with different annealing temperatures. Legend: M, 100 bp DNA Ladder; lane 1, 10 ng; lane 2, 1 ng; lane 3, 0.1 ng; lane 4, 0.01 ng; lane 5, 1 pg; lane 6, 0.1 pg; NC, negative control. Figure S2: Alignment of NCBI blast sequences from Plantaginaceae (actual family for B. monnieri) and Scrophulariaceae (former family for B. monnieri) families showing nucleotide differences in the amplicon region of BMYcf1-F/BMYcf1-R between Bacopa monnieri and related species.

foods-14-03275-s001.zip (773.3KB, zip)

Author Contributions

Conceptualization, R.B., C.V. and I.M.; methodology, R.B., C.V., J.C. and I.M.; formal analysis, R.B., C.V. and I.M.; investigation, R.B., C.V., J.C. and I.M.; writing—original draft preparation, R.B.; writing—review and editing, C.V., J.C. and I.M.; supervision, I.M.; funding acquisition, I.M. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This work was supported by national funds from FCT (Fundação para a Ciência e Tecnologia) through the project “POIROT: novel methods and approaches for detecting the illegal addition of Pharmaceutical drugs and bOtanIcal adulteRatiOn in planT food supplements” (PTDC/SAU-PUB/3803/2021 https://doi.org/10.54499/PTDC/SAU-PUB/3803/2021) and the strategic funding of UIDB/50006/2020 (https://doi.org/10.54499/UIDB/50006/2020) from FCT/MCTES. C. Villa, J. Costa and I. Mafra thank FCT for funding through the Individual Call to Scientific Employment Stimulus (2023.07644.CEECIND/CP2842/CT0011, 2021.03583.CEECIND/CP1662/CT0012 and 2021.03670.CEECIND/CP1662/CT0011, respectively).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Pandey A.K. Bacopa monnieri (Linn.) Pennell—A possible plant for impossible diseases. Adv. Pharmacol. Pharm. 2022;10:35–53. doi: 10.13189/app.2022.100104. [DOI] [Google Scholar]
  • 2.Kuruvalli G., Wankhade I., Wankhede S., Ramesh S.B., Narayanaswamy C.K., Munikrishnappa G.N., Reddy V.D. A comprehensive review on the ethno-medicinal and pharmacological properties of Bacopa monnieri. Pharmacogn. Rev. 2023;17:418–425. doi: 10.5530/phrev.2023.17.17. [DOI] [Google Scholar]
  • 3.Nemetchek M.D., Stierle A.A., Stierle D.B., Lurie D.I. The Ayurvedic plant Bacopa monnieri inhibits inflammatory pathways in the brain. J. Ethnopharmacol. 2017;197:92–100. doi: 10.1016/j.jep.2016.07.073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mathur D., Goyal K., Koul V., Anand A. The molecular links of re-emerging therapy: A review of evidence of Brahmi (Bacopa monnieri) Front. Pharmacol. 2016;7:44. doi: 10.3389/fphar.2016.00044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Jeyasri R., Muthuramalingam P., Suba V., Ramesh M., Chen J.-T. Bacopa monnieri and their bioactive compounds inferred multi-target treatment strategy for neurological diseases: A cheminformatics and system pharmacology approach. Biomolecules. 2020;10:536. doi: 10.3390/biom10040536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ritter S., Urmann C., Herzog R., Glaser J., Bieringer S., Geisberger T., Eisenreich W., Riepl H. Where is bacosine in commercially available Bacopa monnieri? Planta Medica. 2020;86:565–570. doi: 10.1055/a-1137-4289. [DOI] [PubMed] [Google Scholar]
  • 7.Shalini V.T., Neelakanta S.J., Sriranjini J.S. Neuroprotection with Bacopa monnieri—A review of experimental evidence. Mol. Biol. Rep. 2021;48:2653–2668. doi: 10.1007/s11033-021-06236-w. [DOI] [PubMed] [Google Scholar]
  • 8.Shankar P.S., Preeti B., Santanu B., Gajanan D., Rupesh D. Brahmi (Bacopa monnieri) as functional food ingredient in food processing industry. J. Pharmacogn. Phytochem. 2018;7:189–194. [Google Scholar]
  • 9.Gouthami N., Jain S., Jain N., Wadhawana N., Agarwal C., Panwar N. Innovative approaches for incorporating brahmi (Bacopa monnieri) in postharvest food processing. J. Postharvest Technol. 2023;11:122–131. [Google Scholar]
  • 10.Saloni S.M., Rai D.C., Panda P., Kumar S. A comprehensive review on Bacopa monnieri (L.) Pennell (Brahmi): Utilization as a functional food ingredient and health-promoting attributes. Ann. Phytomed. 2022;11:142–150. doi: 10.54085/ap.2022.11.1.14. [DOI] [Google Scholar]
  • 11.Goraya G., Ved D. Medicinal Plants in India: An Assessment of Their Demand and Supply. National Medicinal Plants Board; New Delhi, India: Ministry of AYUSH; New Delhi, India: Government of India; New Delhi, India: New Delhi and Indian Council of Forestry Research & Education; New Delhi, India: 2017. [Google Scholar]
  • 12.IndustryARC . Brahmi Market Forecast (2021–2026) IndustryARC; Hyderabad, India: 2021. [Google Scholar]
  • 13.Jędrejko K., Catlin O., Stewart T., Anderson A., Muszyńska B., Catlin D.H. Unauthorized ingredients in “nootropic” dietary supplements: A review of the history, pharmacology, prevalence, international regulations, and potential as doping agents. Drug Test. Anal. 2023;15:803–839. doi: 10.1002/dta.3529. [DOI] [PubMed] [Google Scholar]
  • 14.Chaudhari K.S., Tiwari N.R., Tiwari R.R., Sharma R.S. Neurocognitive effect of nootropic drug Brahmi (Bacopa monnieri) in Alzheimer’s Disease. Ann. Neurosci. 2017;24:111–122. doi: 10.1159/000475900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rocha T., Amaral J.S., Oliveira M.B.P.P. Adulteration of dietary supplements by the illegal addition of synthetic drugs: A review. Compr. Rev. Food Sci. Food Saf. 2016;15:43–62. doi: 10.1111/1541-4337.12173. [DOI] [PubMed] [Google Scholar]
  • 16.Shah A.P., Travadi T., Sharma S., Pandit R., Joshi C., Joshi M. Comprehensive analysis using DNA metabarcoding, SCAR marker based PCR assay, and HPLC unveils the adulteration in Brahmi herbal products. Mol. Biol. Rep. 2023;50:7605–7618. doi: 10.1007/s11033-023-08653-5. [DOI] [PubMed] [Google Scholar]
  • 17.Xu M.-R., Lee M.-S., Yang B.-C., Chang H.-C., Kuo C.-L., Lin C.-H., Chen H.-J., Cheng J.-H., Sun F.-C. Development of a specific and sensitive diagnostic PCR for rapid molecular authentication of the medicinal plant Portulaca oleracea. Mol. Cell. Probes. 2023;67:101890. doi: 10.1016/j.mcp.2022.101890. [DOI] [PubMed] [Google Scholar]
  • 18.Xu M.-R., Sun F.-C., Yang B.-C., Chen H.-J., Lin C.-H., Cheng J.-H., Lee M.-S. Genetic authentication of the medicinal plant Portulaca oleracea using a quick, precise, and sensitive isothermal DNA amplification assay. Int. J. Mol. Sci. 2023;24:10730. doi: 10.3390/ijms241310730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.European Commission EU Novel Food Status Catalogue: Bacopa monnieri (L.) Wettst. 2023. [(accessed on 30 May 2024)]. Available online: https://ec.europa.eu/food/food-feed-portal/screen/novel-food-catalogue/search.
  • 20.Morán J., Kilasoniya A. Application of the “novel foods” regulation to botanicals in the European Union. Laws. 2024;13:10. doi: 10.3390/laws13010010. [DOI] [Google Scholar]
  • 21.FDA . FDA Takes Action Against 17 Companies for Illegally Selling Products Claiming to Treat Alzheimer’s Disease. FDA; Silver Spring, MD, USA: 2019. [Google Scholar]
  • 22.Grazina L., Amaral J.S., Mafra I. Botanical origin authentication of dietary supplements by DNA-based approaches. Compr. Rev. Food Sci. Food Saf. 2020;19:1080–1109. doi: 10.1111/1541-4337.12551. [DOI] [PubMed] [Google Scholar]
  • 23.Fanelli V., Mascio I., Miazzi M.M., Savoia M.A., De Giovanni C., Montemurro C. Molecular approaches to agri-food traceability and authentication: An updated review. Foods. 2021;10:1644. doi: 10.3390/foods10071644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yadav A., Ahmad J., Chaudhary A.A., Ahmad A. Development of sequence characterized amplified region (SCAR) marker for the authentication of Bacopa monnieri (L.) Wettst. Eur. J. Med. Plants. 2012;2:186–198. doi: 10.9734/EJMP/2012/1192. [DOI] [Google Scholar]
  • 25.Tungphatthong C., Somnuek J., Phadungcharoen T., Ingkaninan K., Denduangboripant J., Sukrong S. DNA barcoding of species of Bacopa coupled with high-resolution melting analysis. Genome. 2018;61:867–877. doi: 10.1139/gen-2018-0059. [DOI] [PubMed] [Google Scholar]
  • 26.Thakur V.V., Tiwari S., Tripathi N., Tiwari G. Molecular identification of medicinal plants with amplicon length polymorphism using universal DNA barcodes of the atpF–atpH, trnL and trnH–psbA regions. 3 Biotech. 2019;9:188. doi: 10.1007/s13205-019-1724-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gargouri B., Carstensen J., Bhatia H.S., Huell M., Dietz G.P.H., Fiebich B.L. Anti-neuroinflammatory effects of Ginkgo biloba extract EGb761 in LPS-activated primary microglial cells. Phytomedicine. 2018;44:45–55. doi: 10.1016/j.phymed.2018.04.009. [DOI] [PubMed] [Google Scholar]
  • 28.Biltes R., Villa C., Costa J., Mafra I. Molecular authentication of Centella asiatica products by a novel real-time PCR approach: Influence of plant matrix. Food Biosci. 2025;68:106395. doi: 10.1016/j.fbio.2025.106395. [DOI] [Google Scholar]
  • 29.Costa J., Oliveira M.B.P.P., Mafra I. Effect of thermal processing on the performance of the novel single-tube nested real-time PCR for the detection of walnut allergens in sponge cakes. Food Res. Int. 2013;54:1722–1729. doi: 10.1016/j.foodres.2013.09.047. [DOI] [Google Scholar]
  • 30.Villa C., Costa J., Oliveira M.B., Mafra I. Novel quantitative real-time PCR approach to determine safflower (Carthamus tinctorius) adulteration in saffron (Crocus sativus) Food Chem. 2017;229:680–687. doi: 10.1016/j.foodchem.2017.02.136. [DOI] [PubMed] [Google Scholar]
  • 31.Fajardo V., Gonzalez I., Martin I., Rojas M., Hernandez P.E., Garcia T., Martin R. Real-time PCR for detection and quantification of red deer (Cervus elaphus), fallow deer (Dama dama), and roe deer (Capreolus capreolus) in meat mixtures. Meat Sci. 2008;79:289–298. doi: 10.1016/j.meatsci.2007.09.013. [DOI] [PubMed] [Google Scholar]
  • 32.Bustin S.A., Benes V., Garson J.A., Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M.W., Shipley G.L., et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  • 33.ENGL Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing. European Network of GMO Laboratories, Join Research Centre, EURL, 2015. [(accessed on 30 May 2024)]. Available online: https://gmo-crl.jrc.ec.europa.eu/doc/MPR%20Report%20Application%2020_10_2015.pdf.
  • 34.Kang T.S. Basic principles for developing real-time PCR methods used in food analysis: A review. Trends Food Sci. Technol. 2019;91:574–585. doi: 10.1016/j.tifs.2019.07.037. [DOI] [Google Scholar]
  • 35.Behr M., Garlant L., Pietretti D., Pellegrin C., Lievens A., Sanfeliu A.B., Maquet A., Alvarellos L. A robust set of qPCR methods to evaluate adulteration in major spices and herbs. Food Control. 2024;165:110623. doi: 10.1016/j.foodcont.2024.110623. [DOI] [Google Scholar]
  • 36.Franz C., Chizzola R., Novak J., Sponza S. Botanical species being used for manufacturing plant food supplements (PFS) and related products in the EU member states and selected third countries. Food Funct. 2011;2:720–730. doi: 10.1039/c1fo10130g. [DOI] [PubMed] [Google Scholar]
  • 37.Dong W., Xu C., Li C., Sun J., Zuo Y., Shi S., Cheng T., Guo J., Zhou S. ycf1, the most promising plastid DNA barcode of land plants. Sci. Rep. 2015;5:8348. doi: 10.1038/srep08348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cantsilieris S., Western P.S., Baird P.N., White S.J. Technical considerations for genotyping multi-allelic copy number variation (CNV), in regions of segmental duplication. BMC Genom. 2014;15:329. doi: 10.1186/1471-2164-15-329. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

foods-14-03275-s001.zip (773.3KB, zip)

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.


Articles from Foods are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES