Skip to main content
Journal of Fungi logoLink to Journal of Fungi
. 2025 Aug 29;11(9):635. doi: 10.3390/jof11090635

Evaluation of the Potential Risk Posed by Emerging Yr5-Virulent and Predominant Races of Puccinia striiformis f. sp. tritici on Bread Wheat (Triticum aestivum L.) Varieties Grown in Türkiye

Kadir Akan 1, Ahmet Cat 2, Medine Yurduseven 3,4, Yesim Sila Tekin 3,5, Mehmet Zahit Yeken 6, Mehmet Tekin 7,*
Editors: Leandro José Dallagnol, Alfonso Daniel Victoria Arellano
PMCID: PMC12470476  PMID: 41003181

Abstract

In this study, the reactions of 70 bread wheat varieties released in Türkiye to five prevalent Pst races, including the Yr5-virulent PSTr-27, were evaluated. Reaction tests of wheat varieties to all races revealed PSTr-27 as the most aggressive race, followed by PSTr-31, PSTr-28, PSTr-29, and PSTr-30. Notably, only seven varieties (Kıraç 66, İkizce 96, Dinç, Altındane, Ziyabey 98, Bayraktar 2000, and Shiro) exhibited moderately resistant reactions to PSTr-27, while the remaining varieties were susceptible. The presence of nine important resistance (Yr) genes in these varieties was also screened at the molecular level. Yr5, Yr15, and Yr26 genes were not detected in any of the varieties and Yr10 and YrSP genes were each detected in only one variety, while the other genes were detected in different ratios. Molecular screening showed that 19 varieties with no resistance genes used in this study displayed susceptible reactions; however, ten varieties that did not carry any resistance genes showed resistant reactions to one or more races, suggesting the presence of unknown or novel resistance sources. Furthermore, gene combinations, particularly Yr10 + Yr18, significantly provided resistance to all Pst races studied. These findings highlight that continual monitoring of PSTr-27, and other Pst races is needed, since it can be a serious threat to wheat production in Türkiye and neighboring countries.

Keywords: bread wheat, Puccinia striiformis f. sp. tritici, resistance, stripe rust

1. Introduction

Wheat (Triticum L.) is one of the most important cereals worldwide and ranks third in production, followed by maize and rice. Global wheat production in 2023 was approximately 800 million tons [1]. Wheat is also the most strategic crop in Türkiye, and the country is one of the largest producers of wheat globally. At the same time, Türkiye is one of the leading countries in the consumption of wheat products, with approximately 160 kg per capita [1]. However, wheat production is threatened by many diseases both in Türkiye and worldwide. Among them, wheat stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is the most devastating disease. This disease has been reported in at least 60 countries, and it is known that 88% of global wheat-growing areas are susceptible to this disease [2]. Epidemics caused by this disease have been known to occur regularly every two years, affecting more than 25% of wheat-growing areas in many European, North African, and Middle Eastern countries, including Türkiye [3].

Historically, epidemics have occurred at varying intensities throughout Türkiye, depending on weather conditions and host resistance [4,5,6]. Although several epidemics were recorded in the inner regions of the country before the 1960s, yield losses of up to 80% were reported in some areas between the 1960s and 1990s [7]. Between the 1990s and 2010s, Pst epidemics lead to dramatic yield and quality losses [5,8]. Despite these epidemics, studies focusing on race detection causing the epidemics were very few until recent years. In these studies, resistance genes such as Yr2, Yr6, Yr7, and Yr9 were determined to be ineffective against Pst populations in the country [5,9,10]. Additionally, the differential lines used in these studies for race detection commonly include genotypes with more than one Yr gene. However, it is known that using near isogenic lines (NILs) with the same genetic background but each containing different resistance genes provides more reliable results. The use of such differentials also facilitates global standardization when detecting races accurately. Recently, with the use of Avocet NILs, developed by Wellings et al. [11], Cheng and Chen [12] and Wan and Chen [13], 25 races were identified in the coastal regions of Türkiye [14], and 38 races were detected throughout the country [6]. The most frequently detected races are PSTr-29, PSTr-30, PSTr-31, and PSTr-28, respectively. The virulence formula of PSTr-29 is identical to that of PSTv-36, which was reported in the USA by Wan and Chen [13] and Chen et al. [15], exemplifying the intercontinental migration of races.

Until now, over 80 resistance genes and many QTLs have been identified against Pst [16]. Among them, Yr5 and Yr15 confer resistance to Pst races worldwide. Although no races virulent to Yr15 have been reported, several cases of virulence to Yr5 have been reported, particularly in recent years. One such case was reported in Türkiye [6,17], with others reported in India [18], Australia [19], China [20], and Syria [21].

The virulence to Yr5 has been reported in China, Turkey and Syria over the last five years. This indicates that a virulent race or other variants to Yr5 have spread or evolved spontaneously. Therefore, studying virulence to Yr5 is a high-priority issue, both strategically and economically, particularly in regions such as Türkiye and Syria where primary/alternate host populations, including Berberis spp. [22,23] and wild relatives of wheat [24], are prevalent. For example, the evolution of a race or races virulent to Yr9, followed by their spread across Asia, caused epidemics that led to significant yield losses in the 1990s and early 2000s. During those years, it was estimated that the stripe rust-prone areas were mainly in China (9.6 m hectares), India (9.4 m hectares), Türkiye (7.4 m hectares), Pakistan (5.8 m hectares), Iran (4.4 m hectares), and Syria (1.3 m hectares) [25]. Therefore, preliminary studies should be conducted to assess the potential risks of Yr5-virulent races to wheat production. The potential risk of Yr5-virulent races in China was evaluated on 165 Chinese wheat cultivars. It was reported that a low percentage of these cultivars have postulated resistance genes Yr5, Yr7, Yr10, Yr15, Yr26, or YrSP and the isolates TSA-6 and TSA-9, which are virulent to Yr5, can be a serious threat to wheat production [26].

This study aimed to evaluate the potential risk of the Yr5-virulent and other predominant races previously reported in studies on bread wheat production in Türkiye. For this purpose, reaction tests were performed to evaluate the virulence of Yr5-virulent race in comparison with other prevalent races, and molecular detection of Yr5 along with other important Yr genes in bread wheat varieties was carried out using molecular markers.

2. Materials and Methods

2.1. Genetic Materials

A total of 70 bread wheat (T. aestivum) varieties, released from 1968 to 2022 in Türkiye, were used as the plant material (Table S1). Some of these varieties (especially the older ones, based on year of registration) have been widely cultivated for many years, while the rest have been newly registered. In addition, the wheat variety Morocco, susceptible to all known Pst races, was used both as a susceptible control and to multiply urediniospores of each race.

A set of 16 Yr NILs with the Avocet S background were used as differentials to determine the virulence (Vr) and avirulence (Avr) patterns of the races. Reactions of the 70 wheat varieties were evaluated with five Pst races, PSTr-27 Vr to Yr5 (Vr: Yr5,6,7,17,24,27,44,SP/Avr: Yr1,8,9,10,15,32,43,Tr1,Exp2,Tye) and PSTr-28 (Vr: Yr6,7,8,9,24,27,43,44/Avr: Yr1,5,10,15,17,32,SP,Tr1,Exp2,Tye), PSTr-29 (Vr: Yr6,7,8,9,27,43,44,Tr1,Exp2/Avr: Yr1,5,10,15,17,24,32,SP,Tye), PSTr-30 (Vr: Yr6,8,9,43,44,Tr1,Exp2,Tye/Avr: Yr1,5,10,17,24,27,32) and PSTr-31 (Vr: Yr1,6,7,9,17,27,32,43,44,Tr1,Exp2/Avr: Yr5,8,10,15,24,Tye), currently prevalent and Avr to Yr5 [6].

2.2. Multiplication of Pst Urediniospores and Reaction Tests of the Varieties

Urediniospores of each race were multiplied using the method described by Cat et al. [6]. Seeds of the susceptible check variety Morocco were sown in small plastic pots filled with peat substrates (TS1, Klassman GmbH, Geeste, Germany). The pots were placed in trays and transferred to a growth chamber. Fourteen-day old seedlings at the two-leaf stage were inoculated with urediniospores of each race.

The suspension of fresh urediniospores was prepared by adding 10 mg of urediniospores to 5 mL of hydrofluoroether (NovecTM 7100, 3M Co., St. Paul, MN, USA) in a 25 mL of atomizer of airbrush spray gun, and then each suspension was sprayed onto the seedlings as described by Sorensen et al. [27]. The inoculated seedlings were then incubated at 10 °C for 24 h at 100% relative humidity (RH) in darkness. After incubation, the plants were transferred to climate-controlled rooms programmed with a diurnal temperature cycle (10–16 °C) with an 8 h dark/16 h light period, and 60% relative humidity. Each pot was enclosed in a cellophane bag to prevent cross-contamination. Approximately 19 days post-inoculation (dpi), fresh urediniospores of each race were collected into gelatin capsules using a mini cyclone collector. The multiplication of urediniospores on the susceptible variety was repeated as necessary until enough spores were obtained for reaction tests.

Following the multiplication of urediniospores, reaction tests were conducted on 70 bread wheat varieties used in the study. For this purpose, 10 seeds of each variety were sown in small plastic pots. The same methods for inoculation, incubation, and cultivation described in the multiplication of urediniospores section were applied in the reaction tests [27]. The testing was conducted with three replications to confirm the accuracy of the variety resistance to Pst races. Infection type (IT) for each variety was recorded 19 dpi using the 0–9 scale developed by McNeal et al. [28]. On this scale, infected plants scored as ITs 0–3 were considered resistant (R) (necrotic/chlorotic blotches with no or trace sporulation); ITs 4–6 were considered moderate-resistant/susceptible (necrotic/chlorotic blotches with moderate sporulation); and ITs 7–9 were considered susceptible (high sporulation with no or little necrotic/chlorotic blotches).

2.3. Extraction of Genomic DNA

Genomic DNA was extracted from approximately 100 mg of non-infected fresh leaves collected from fourteen-day-old seedlings of the tested varieties, the check variety in Morocco, and differential lines each carrying a different Yr resistance gene at the two-leaf stage. Leaf samples and lysis buffer were first added to a 2.0 mL microcentrifuge tube, and the mixture was homogenized using a micro pistil and vortexed regularly. The following procedures were performed in accordance with the manufacturer’s protocol for the NucleoSpin® Plant II Extraction Kit (Macherey-Nagel, Dueren, Germany). Genomic DNA was dissolved in 100 μL of Tris-EDTA (TE) buffer, and the quality and concentration were assessed with 1% agarose gel electrophoresis with a DNA standard. It was diluted with Tris-EDTA (TE) buffer (pH 8.0) to adjust a final concentration of 50 ng/μL for PCR amplification.

2.4. Molecular Detection of Yr Genes

Molecular detection was performed using PCR amplification with different molecular markers linked to the resistance genes Yr5, Yr10, Yr15, Yr17, Yr18, Yr26, Yr36, Yr44, and YrSP to determine the presence/absence of these genes in the varieties. Information about these markers was given in Table 1. The genomic DNAs of differential lines, each carrying a different Yr resistance gene, were used as positive control. The total volume of PCR reaction mixture was 20 uL, containing 50 ng DNA template, 1X PCR buffer (Thermo Fisher Scientific, Waltham, MA, USA), 1.5 mM MgCI2 (Thermo Fisher Scientific, Waltham, MA, USA), 0.2 mM of dNTPs (Thermo Fisher Scientific, Waltham, MA, USA), 1 μM forward primer, 1 μM reverse primer, and 1 U Taq DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA). Amplifications were performed in a thermal cycler (T100, Bio-Rad, Hercules, CA, USA) under the following conditions: initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 45–65 °C (Table 1) for 30 s, and extension at 72 °C for 1 min, and a final extension of 10 min at 72 °C, before cooling down to 4 °C. PCR products were electrophoresed with a 2% (w/v) agarose gel in 1× TBE (Tris-boric acid-EDTA) buffer (pH 8.3) in a horizontal electrophoresis system (Bio-Rad, Hercules, CA, USA) at 5 V/cm for 40 to 60 min. DNA standards of 50 bp and 100 bp (Thermo Fisher Scientific, Waltham, MA, USA) were used to determine the size of amplicons. Visualization of gels was conducted under UV light using a gel imaging system (UVsolo touch, Analytik Jena, Jena, Germany) following staining with ethidium bromide.

Table 1.

The molecular markers used in this study for detection of each Yr gene.

Gene Marker Type Marker Annealing Temp (°C) Sequence (5′→3′) Expected Fragment (bp) Reference
Yr5 STS/CAPS STS7 45 GTACAATTCACCTAGAGT 289 (+) [29]
STS8 GCAAGTTTTCTCCCTAT 182 (−)
Yr10 Gene-specific Yr 10 F 64 TCAAAGACATCAAGAGCCGC 543 (+) [30]
Yr 10 R TGGCCTACATGAACTCTGGAT
Yr15 SSR Xbarc8 F 50 GCGGGGGCGAAACATACACATAAAAACA 200 (+) [31]
Xbarc8 R GCGGGAATCATGCATAGGAAAACAGAA 280 (−)
Yr17 SCAR VENTRIUP 65 AGGGGCTACTGACCAAGGCT 262 (+) [32]
LN2 TGCAGCTACAGCAGTATGTACACAAAA
Yr18 Gene-specific L34DINT9F 51 TTGATGAAACCAGTTTTTTTTCTA 517 (+) [33]
L34PLUSR GCCATTTAACATAATCATGATGGA
Yr26 STS we173 57 GGGACAAGGGGAGTTGAAGC 451/500 (+) [34]
GAGAGTTCCAAGCAGAACAC 730 (−)
Yr36 Gene-specific Yr36START 52 GGCCACACTGCAATACTATACC 871 (+) [35]
CACAAATCCTGGCTGTGGAC
Yr44 STS pWB5 49 GGTGCAATTTGAGTTTGGAGT 380 (+) [36]
pWN1R1 GGTGTTGACTGGAGAATCCG
YrSP STS dp269 55 CTGCTGTCACCGCTCTCC 190 (+) [37]
AGTCACACGCCCTACTCTCC 201 (−)

2.5. Data Analysis

A 0–9 scale was used to determine the reaction of the varieties to Pst races, with three replications for each test. The resulting data were recorded in Microsoft Excel. The basic statistics such as the mean, standard deviation, coefficient of variation (CV), standard deviation (SD), kurtosis, and skewness were first calculated. Additionally, standard errors were used to compute z values for reactions to each Pst race, and p-values were calculated to indicate the degree of deviation from normal distribution for skewness and kurtosis values. To assess the effect of each Yr gene or gene combination in various genetic backgrounds, the data were divided into two groups based on presence or absence of related genes. A one-way analysis of variance (ANOVA) was performed at a 95% confidence level to identify significant differences between these groups. All analyses were performed in an R environment.

3. Results

3.1. Reaction Tests of the Bread Wheat Varieties to Pst Races

Reactions of all varieties to the prevalent Pst races, PSTr-28, PSTr-29, PSTr-30, and PSTr-31 in Türkiye, as well as to the PSTr-27, a virulent race to Yr5, were determined. The basic statistics and generated histograms of the reactions of all varieties to the Pst races are given in Table S2 and Figure 1. Overall, it was determined that the most virulent race among the varieties tested was PSTr-27 (IT: 7.67), as expected. This was followed by PSTr-31 (7.27), PSTr-29 (6.63), PSTr-28 (6.61) and PSTr-30 (6.61), respectively. While PSTr-28 and PSTr-29 had the highest CV value with 16.54% and 15.66%, PSTr-27 had the lowest with 11.92% (Table S2). Additionally, the skewness and kurtosis of the reactions of the varieties to PSTr-28 were close to zero, indicating that the distribution of reactions among the varieties was fairly consistent (Table S2; Figure 1).

Figure 1.

Figure 1

Histograms showing the reactions of bread wheat varieties to the PSTr-27 (a), PSTr-28 (b), PSTr-29 (c), PSTr-30 (d), and PSTr-31 (e).

The results of the reaction analyses of the varieties to all Pst races are presented in Table 2. As mentioned above, the most virulent race was identified as PSTr-27, and except for seven varieties (Kıraç 66, İkizce 96, Ziyabey 98, Bayraktar 2000, Altındane, Dinç and Shiro) that showed a moderately resistant (MR) reaction, no variety showed a resistant (R) reaction to this race. According to the scale, 19 varieties scored seven, 28 varieties scored eight, and 16 varieties scored nine, all indicating a susceptible (S) reaction to this race. Against the second most virulent race, PSTr-31, the varieties were scored between four and eight; while seven varieties were identified as moderately resistant (MR), the remaining 63 had a susceptible (S) reaction. For the third most virulent race, PSTr-29, only one variety (Kıraç-66) exhibited a resistant (R) reaction. In addition, 27 varieties were moderately resistant whereas 42 varieties showed a susceptible reaction. PSTr-28 and PSTr-30 were determined to have similar virulence on average on the varieties. While only one variety, Dinç, showed resistant reaction to PSTr-30, 28 varieties had moderately resistant reaction. The remaining 41 varieties were scored with seven and eight, indicating susceptible reaction. There was no variety with resistant reaction to PSTr-28; however, a similar variability was observed in this race as in the PSTr-30. While 27 varieties had a moderately resistant reaction to PSTr-28, the remaining 43 varieties were susceptible (Table 2).

Table 2.

Reactions of bread wheat varieties to Pst races.

Variety Pst Races
PSTr-27 PSTr-28 PSTr-29 PSTr-30 PSTr-31
Bezostaja-1 S MR MR MR S
Kıraç 66 MR MR R MR MR
Cumhuriyet 75 S S S S S
Gerek 79 S S S S S
Atay-85 S S S S S
Kate A-1 S MR MR MR S
Dağdaş 94 S MR MR MR MR
Sultan 95 S S S MR S
Kaşifbey 95 S MR S MR S
İkizce 96 MR S S S S
Pamukova 97 S S S S S
Pehlivan S S MR S S
Karacadağ 98 S S S S S
Gönen 98 S MR MR MR MR
Ziyabey 98 MR MR MR MR S
Karahan-99 S MR S MR S
Ceyhan-99 S MR MR MR S
Flamura 85 S MR S S S
Bayraktar 2000 MR MR MR MR S
Demir 2000 S S S S S
Sönmez 2001 S MR MR MR S
Alparslan S MR MR S S
Pandas S S S S S
Sagittario S MR MR MR S
Canik 2003 S S S S S
Tosunbey S S MR MR S
Ahmetağa S S S S S
Krasunia odes’ka S S S S S
Kenanbey S S MR S S
Aldane S S S S S
Selimiye S MR S MR S
ES 26 S S MR S S
Esperia S S MR S MR
Cömert S S S S S
Altındane MR S S S S
Vittorio S MR MR MR S
Quality S S S S S
Rumeli S MR S MR MR
Aglika S MR MR MR S
Dinç MR MR MR R MR
Gökkan S S S S S
Segor S S S S S
Adelaide S MR MR MR S
Avorio S MR MR MR S
Tekin S S S S S
Nevzatbey S S MR S S
Yakamoz S S S S S
Bora S MR MR MR S
Genesi S MR MR MR MR
Glosa S S S S S
Masaccio S S S S S
Efe S S MR MR S
Kale S S S MR S
Yüksel S S S S S
Leuta S S S S S
Duru S S S S S
Hüseyinbey S MR MR MR S
Albachiara S S S S S
Damla S S S S S
Koç S MR S S S
İzvor S S S S S
Anafarta S S S S S
Abide S S S S S
Eylül S S S S S
Albaşak S S S S S
Boldane S MR MR MR S
Beyaz-I S S S S S
Shiro MR MR MR MR S
Destra S S S S S
Alba S S S MR S

Overall, Kıraç 66 and Dinç were the most prominent varieties with an MR or R reaction to all races including Yr5-virulent, PSTr-27. In addition, some varieties displayed resistance to more than one race (Table 3). Ziyabey 98, Bayraktar 2000, and Shiro were the most prominent varieties with moderately resistant reaction to Yr5-virulent race, PSTr-27, and another three races: PSTr-28, PSTr-29, and PSTr-30. The other prominent varieties, Dağdaş 94, Gönen 98, and Genesi, were resistant or moderately resistant to all races except for PSTr-27 (Table 2).

Table 3.

Number of varieties showing resistant or moderately resistant reactions to one or more Pst races.

No of Variety Pst Races
PSTr-27 PSTr-28 PSTr-29 PSTr-30 PSTr-31
2 + − − − −
2 − + − − −
4 − − + − −
3 − − − + −
1 − + + − −
3 − + − + −
2 − − + + −
1 − − + − +
12 − + + + −
1 − + − + +
3 + + + + −
3 − + + + +
2 + + + + +
31 − − − − −
Total 7 27 28 29 7

Additionally, twelve varieties (Bezostaja-1, Kate A-1, Ceyhan-99, Sönmez 2001, Sagittario, Vittorio, Aglika, Adelaide, Avorio, Bora, Boldane, and Hüseyinbey) were moderately resistant to, PSTr-28, PSTr-29, and PSTr-30, while only one variety, Rumeli, showed moderately resistant reaction to the races PSTr-28, PSTr-30, and PSTr-31 (Table 2). On the other hand, 31 varieties (44% of the tested varieties) alarmingly showed susceptible reactions to all Pst races tested in this study.

Additionally, the correlation analysis of the reactions of the varieties to the Pst races showed that the strongest correlations were between PSTr-28 and PSTr-30 (r = 0.770, p = 0.000), PSTr-28 and PSTr-29 (r = 0.727, p = 0.000), and PSTr-29 and PSTr-30 (r = 0.721, p = 0.000), respectively (Table 4).

Table 4.

Correlation coefficients between five Pst races based on the ITs of the varieties.

Race PSTr-27 PSTr-28 PSTr-29 PSTr-30 PSTr-31
PSTr-27 1
PSTr-28 0.519 ** 1
PSTr-29 0.527 ** 0.727 ** 1
PSTr-30 0.516 ** 0.770 ** 0.721 ** 1
PSTr-31 0.464 ** 0.601 ** 0.581 ** 0.543 ** 1

** p < 0.01.

On the other hand, significant but weak correlations were found between Yr5-virulent race, PSTr-27, and other races, revealing that PSTr-27 differs significantly from other races in terms of virulence on the varieties (Table 4).

3.2. Molecular Detection of Yr Genes

The presence and absence of nine resistant alleles of Yr genes, Yr5, Yr10, Yr15, Yr17, Yr18, Yr26, Yr36, Yr44, and YrSP, in the 70 bread wheat varieties were detected with different molecular markers (Table S3). Sample agarose gel images for each molecular marker are given in Figure S1. The Yr5, Yr15, and Yr26 genes were not detected in any of the varieties. The Yr10 and YrSP genes were detected in only one variety each, namely Kıraç 66 and Adelaide, respectively. In addition, the Yr17 gene was detected in three varieties, the Yr18 gene in 26 varieties, the Yr36 gene in 30 varieties, and the Yr44 gene in 14 varieties (Table S3).

No resistance genes were detected in 29 varieties, while 26 varieties were determined to contain two or more resistance genes. The varieties Ceyhan-99, Vittorio, Rumeli, Aglika, Gökkan, Avorio, Bora, and Genesi were found to carry three resistance genes (Yr18, Yr36, and Yr44) (Table S3). The contribution of each Yr gene to resistance against Pst races was also estimated based on the ITs of the varieties. To this end, the ITs of varieties carrying the Yr gene(s) were compared with those lacking the Yr gene, using one-way ANOVA (Figure 2).

Figure 2.

Figure 2

Contribution of each Yr gene or gene combination for resistance to PSTr-27 (a), PSTr-28 (b), PSTr-29 (c), PSTr-30 (d), and PSTr-31 (e). Each bar represents the average ITs of bread wheat varieties with presence or absence (Yr-) of Yr gene(s). * p < 0.05, ** p < 0.01.

Remarkably, the lowest ITs were observed in varieties with the Yr10 + 18 combination against all races. In addition, bread wheat varieties carrying the Yr17 gene or the gene combinations Yr18 + 36, and Yr18 + 36 + 44 had significantly lower ITs compared to those without the Yr gene (Yr-) against all Pst races (Figure 2).

4. Discussion

Plant diseases caused by many different plant pathogens pose an ongoing threat to global food security, as well as plant and ecosystem health. Plant pathogens are responsible for at least 20 to 40% of crop losses globally, and plant disease epidemics and outbreaks caused by these pathogens occur continuously every year, anywhere in the world. As an example of this, 617 new distribution records of 283 plant pathogens in 2021 and 29 pathogens with new distribution records in 2022 were reported [38,39]. For this reason, continued monitoring of these threats is essential to manage pathogen incursions and management of threats within a newly introduced area. In wheat, wheat rusts are the most devastating diseases historically worldwide, and many severe epidemics, causing serious economic damage, have occurred in many regions of the world, such as the stem rust epidemic, caused by the race Ug99 [40], or the stripe rust epidemics, caused by Yr9-virulent races [25].

To date, more than 80 Yr genes (Yr1–Yr83) have been identified that confer resistance to this disease in wheat [16]. Among them, major resistance genes Yr5 and Yr15 have still been known to provide resistance to all Pst races worldwide. Notably, no virulent race has been reported globally against Yr15; however, several races have been reported as virulent to Yr5, especially during the last five years [6,17,20]. One of them, PSTr-27, was detected in Türkiye by our research group [6,17]. The other prevalent Pst races in Türkiye—PSTr-28, PSTr-29, PSTr-30, and PSTr-31—were also reported in these studies. The results of the present study showed that Yr5-virulent race, PSTr-27, was determined to be the most aggressive among the Pst races. Based on the aggressiveness of Pst races, PSTr-27 was followed by PSTr-31, PSTr-29, PSTr-28 and PSTr-30, respectively (Table S2; Figure 1). Similarly, Zhang et al. [41] compared the relative parasitic fitness of the Yr5-virulent races (TSA-6 and TSA-9) identified in China [20] with four prevalent Chinese races (CYR31, CYR32, CYR33, and CYR34), and determined that Yr5-virulent races had significantly (p < 0.05) higher parasitic fitness than other Pst races, following the CYR32.

In the present study, seven varieties, Kıraç 66, İkizce 96, Ziyabey 98, Bayraktar 2000, Altındane, Dinç, and Shiro, showed a moderately resistant reaction to the most aggressive race, PSTr-27. Two of them, Kıraç 66 and Dinç, were also the most prominent varieties to all Pst races studied. Zhang et al. (2022) [26] evaluated the virulence and potential risk of two Yr5-virulent races (TSA-6 and TSA-9) identified in China in 2017, with other prevalent Pst races, on 165 Chinese wheat varieties. They determined that the avirulence/virulence patterns of these races were highly similar to the CYR32 race commonly found in China, but significantly different from CYR34. Of the 165 varieties, 21 showed all-stage resistance to the TSA-6 race, 34 to TSA-9, and 20 to both races. In both studies, about 10% of the varieties had a resistant reaction to Yr5-virulent races.

In addition to reaction tests, molecular screening of nine resistance genes (Yr5, Yr10, Yr15, Yr17, Yr18, Yr26, Yr36, Yr44, and YrSP) in bread wheat varieties was also investigated in this study. In addition to Yr5 and Yr15, other resistance genes utilized in this study, including Yr10, Yr17, Yr18, Yr26, Yr36, Yr44, and YrSP, have also been used in breeding programs for yellow rust resistance in many regions of the world [42,43,44,45,46]. There are no varieties possessing the resistance genes Yr5, Yr15, and Yr26 in these germplasms. Baloch et al. [47] screened a germplasm including Kazakh, Russian, and Turkish wheat varieties as well as Turkish wild emmer genotypes, and found no wheat varieties with Yr15 gene except for Turkish wild emmer genotypes. Abbas et al. [48] also screened 349 Pakistan and Southwest China wheat genotypes for 13 major Yr genes, and determined that Yr26, Yr15, and Yr65 were present with a higher percentage than other genes studied in both Pakistani and Chinese genotypes. In another study, Ul Islam et al. [49] evaluated 192 wheat genotypes for resistance to stripe rust, and reported that 9, 12, 14, and 32 of them had the resistance genes Yr5, Yr10, Yr15, and Yr17, respectively. Recently, Sucur et al. [50] evaluated European bread wheat varieties for resistance to stripe rust and powdery mildew and reported that Yr5 and Yr15 were remarkably high in these varieties. These results show that there is a wide variation in wheat germplasm for Yr genes.

In the present study, the relative effect of resistance genes on disease severity was also evaluated. According to the findings, as a single gene effect, only Yr17 provided significant resistance to PSTr-28, PSTr-29 and PSTr-30 (Figure 2). However, some gene combinations were generally effective for resistance to the Pst races. Specifically, the combination Yr10 + Yr18 was prominent compared to the effects of other combinations, since it provided resistance to all Pst races studied. In addition, Yr36 + YrSP and Yr16 + Yr36 + Yr44 were other effective combinations, especially for resistance to PSTr-28, PSTr-29 and PSTr-30. In a similar way, Abbas et al. [48] reported that some gene combinations, such as Yr26 + Yr48, Yr29 + Yr5, Yr26 + Yr30, and Yr30 + Yr17, enhanced resistance to the currently prevalent Pst races in Pakistan. Leharwan et al. [51] claimed that the resistance genes, Yr10, Yr15, Yr18, Yr24, Yr29, Yr36, Yr44, Yr53, and Yr65, provided significant resistance to prevalent Pst races in India. Kokhmetova et al. [52] also reported that wheat genotypes carrying Yr10 alone or in combination with other Yr genes enhanced resistance significantly to Kazakhstan Pst population. These results suggest that the effective Yr gene or gene combinations may vary depending on the Pst races commonly found in related region(s).

5. Conclusions

In the present study, according to reaction test results, the most aggressive races were determined to be as follows: PSTr-27 > PSTr-31 > PSTr-28 > PSTr-29 ≥ PSTr-30. Seven varieties (Kıraç 66, İkizce 96, Dinç, Altındane, Ziyabey 98, Bayraktar 2000, and Shiro) gave a moderately resistant reaction to Yr5-virulent, PSTr-27. However, the remaining 63 varieties, which are widely cultivated in wheat-growing areas of Türkiye, were susceptible to this Pst race. The most interesting point here is that most of the resistant varieties to PSTr-27 do not contain any Yr gene(s) studied, according to molecular screening. The same pattern was observed in the reactions of the varieties to other races; overall, 19 varieties without resistance genes studied to all Pst races were susceptible, whereas 10 varieties had resistance to one or more races, suggesting the presence of unknown or novel resistance sources. The results show that multiple genes, like the Yr10 + Yr18 combination, can enhance resistance to Pst races, and this suggests that more genes should be used in wheat resistance breeding programs to achieve durable resistance to Pst. In addition, the Yr5-virulent race PSTr-27, which had previously been detected by our research group from only a single isolate and was not widespread across Türkiye, was found in this study to exhibit high virulence on widely grown wheat varieties; therefore, continual monitoring of PSTr-27 and other Pst races is essential.

Acknowledgments

The authors would like to thank Xianming Chen for providing AvSYr single gene lines.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof11090635/s1, Figure S1: Agarose gel images of the molecular markers analyzed; Table S1: A set of 70 bread wheat varieties, released from 1968 to 2022 in Türkiye, and their information; Table S2: Basic statistics, such as mean, minimum, maximum, coefficient of variation (CV), standard deviation (SD), skewness, and kurtosis, of reactions of bread wheat varieties to the Pst races; Table S3: Molecular screening results obtained using markers linked to the Yr5, Yr10, Yr15, Yr17, Yr18, Yr26, Yr36, Yr44, and YrSP resistance genes.

jof-11-00635-s001.zip (312.2KB, zip)

Author Contributions

Conceptualization, M.T. and A.C.; methodology, M.T., A.C. and K.A.; software, M.T.; validation, M.T., A.C. and K.A.; formal analysis, M.Y., Y.S.T. and M.Z.Y.; investigation, M.Y. and Y.S.T.; resources, A.C., M.T. and K.A.; writing—original draft preparation, A.C. and M.T.; writing—review and editing, M.T., K.A. and M.Z.Y.; visualization, A.C. and M.T.; supervision, M.T.; project administration, M.T.; funding acquisition, M.T. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

The data presented in this study is available on request from the corresponding author.

Conflicts of Interest

Author Medine Yurduseven was employed by the company Argeto Vegetable Seeds Co. Author Yesim Sila Tekin was employed by the company Merkez Anadolu Kimya Co. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding Statement

This research was funded by the Scientific Research Projects Unit of Akdeniz University, grant number FBA-2022-6002.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.FAOSTAT Crops and Livestock Products. [(accessed on 24 February 2025)]. Available online: https://www.fao.org/faostat/en/#data/QCL.
  • 2.Schwessinger B. Fundamental wheat stripe rust research in the 21st century. New Phytol. 2017;213:1625–1631. doi: 10.1111/nph.14159. [DOI] [PubMed] [Google Scholar]
  • 3.Chen X.M. Pathogens which threaten food security: Puccinia striiformis, the wheat stripe rust pathogen. Food Secur. 2020;12:239–251. doi: 10.1007/s12571-020-01016-z. [DOI] [Google Scholar]
  • 4.Braun H., Saari E.E. An assesment of the potential of Puccinia striiformis f. sp. tritici to cause yield losses in wheat on the Anatolian Plateau of Turkey; Proceedings of the Eight European and Mediterranean Cereal Rusts and Mildews Conference; Weihenstephan, Germany. 8–11 September 1992. [Google Scholar]
  • 5.Mamluk O.F., Cetin L., Braun H.J., Bolat N., Bertschinger L., Makkouk K.M., Yildirim A.F., Saari E.E., Zencirci N., Albustan S., et al. Current status of wheat and barley diseases in the Central Anatolian Plateau of Turkey. Phytopathol. Mediterr. 1997;36:167–181. [Google Scholar]
  • 6.Cat A., Tekin M., Akan K., Akar T., Catal M. Virulence characterization of the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici, in Turkey from 2018 to 2020. Can. J. Plant Pathol. 2023;45:158–167. doi: 10.1080/07060661.2023.2166126. [DOI] [Google Scholar]
  • 7.Akan K. Evaluation of some lines selected from bread wheat landraces for their reaction to yellow (stripe) Rust. Fresen Environ. Bull. 2019;28:6339–6351. [Google Scholar]
  • 8.Cat A., Tekin M., Catal M., Akan K., Akar T. Wheat stripe rust and breeding studies for resistance to the disease. Mediterr. Agric. Sci. 2017;30:97–105. [Google Scholar]
  • 9.Louwers J.M., van Silfhout C.H., Stubbs R.W. Race Analysis in Wheat in Developing Countries. Research Institute for Plant Protection (IPO-DLO); Wageningen, The Netherlands: 1992. (Report 1992-11). [Google Scholar]
  • 10.Mert Z., Dusunceli F., Akan K., Cetin L., Yazar S., Bolat N., Yorgancilar A., Unsal R., Ercan B., Ozseven I., et al. An overview of the network for important cereal diseases management research in Turkey between 2003 and 2011; Proceedings of the 13th International Cereal Rusts and Powdery Mildews Conference; Beijing, China. 28 August–1 September 2012; pp. 208–209. [Google Scholar]
  • 11.Wellings C.R., Singh R.P., McIntosch R.A., Pretorius Z.A. The development and application of near isogenic lines for the stripe (yellow) rust pathosystem; Proceedings of the 11th International Cereal Rusts and Powdery Mildew Conference; Norwich, UK. 22–27 August 2004; p. Abstr. A1.39. [Google Scholar]
  • 12.Cheng P., Chen X.M. Molecular mapping of a gene for stripe rust resistance in spring wheat cultivar IDO377s. Theor. Appl. Genet. 2010;121:195–204. doi: 10.1007/s00122-010-1302-0. [DOI] [PubMed] [Google Scholar]
  • 13.Wan A.M., Chen X.M. Virulence characterization of Puccinia striiformis f. sp. tritici using a new set of Yr single-gene line differentials in the United States in 2010. Plant Dis. 2014;98:1534–1542. doi: 10.1094/PDIS-01-14-0071-RE. [DOI] [PubMed] [Google Scholar]
  • 14.Cat A., Tekin M., Akan K., Akar T., Catal M. Races of Puccinia striiformis f. sp. tritici identified from the coastal areas of Turkey. Can. J. Plant Pathol. 2021;43:S323–S332. doi: 10.1080/07060661.2021.1978000. [DOI] [Google Scholar]
  • 15.Chen X.M., Wang M.N., Wan A.M., Bai Q., Li M.J., Lopez P.F., Maccaferri M., Mastrangelo A.M., Barnes C.W., Cruz D.F.C., et al. Virulence characterization of Puccinia striiformis f. sp. tritici collections from six countries in 2013 to 2020. Can. J. Plant Pathol. 2021;43:S308–S322. doi: 10.1080/07060661.2021.1958259. [DOI] [Google Scholar]
  • 16.McIntosh R.A., Dubcovsky J., Rogers W.J., Xia X.C., Raupp W.J. Catalogue of gene symbols for wheat: 2020 supplement. GrainGenes. 2020;66:109–128. [Google Scholar]
  • 17.Tekin M., Cat A., Akan K., Catal M., Akar T. A new virulent race of wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) on the resistance gene Yr5 in Turkey. Plant Dis. 2021;105:3292. doi: 10.1094/PDIS-03-21-0629-PDN. [DOI] [Google Scholar]
  • 18.Nagarajan S., Nayar S.K., Bahadur P. Race-13 (67s8) of Puccinia striiformis virulent on Triticum spelta var album in India. Plant Dis. 1986;70:173. doi: 10.1094/PD-70-173d. [DOI] [Google Scholar]
  • 19.Wellings C.R., McIntosch R.A. Puccinia striiformis f.sp. tritici in Australasia: Pathogenic changes during the first 10 years. Plant Pathol. 1990;39:316–325. doi: 10.1111/j.1365-3059.1990.tb02509.x. [DOI] [Google Scholar]
  • 20.Zhang G.S., Zhao Y.Y., Kang Z.S., Zhao J. First report of a Puccinia striiformis f. sp. tritici race virulent to wheat stripe rust resistance gene Yr5 in China. Plant Dis. 2020;104:284–285. doi: 10.1094/PDIS-05-19-0901-PDN. [DOI] [Google Scholar]
  • 21.Kharouf S., Hamzeh S., Azmeh S.F. Races identification of wheat rusts in Syria during the 2019 growing season. Arab. J. Plant Prot. 2021;39:1–13. doi: 10.22268/AJPP-39.1.001013. [DOI] [Google Scholar]
  • 22.El Amil R., Ali S., Bahri B., Leconte M., de Vallavieille-Pope C., Nazari K. Pathotype diversification in the invasive PstS2 clonal lineage of Puccinia striiformis f. sp. tritici causing yellow rust on durum and bread wheat in Lebanon and Syria in 2010-2011. Plant Pathol. 2020;69:618–630. doi: 10.1111/ppa.13164. [DOI] [Google Scholar]
  • 23.Akci N., Karakaya A. Puccinia graminis f. sp. tritici races identified on wheat and Berberis spp. in northern Turkey. Indian Phytopathol. 2021;74:1105–1109. doi: 10.1007/s42360-021-00343-1. [DOI] [Google Scholar]
  • 24.Tekin M., Cat A., Akar T., Catal M. Super spreaders of wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici) in Turkey; Proceedings of the 3rd International Eurasian Conference on Biological and Chemical Sciences; Ankara, Türkiye. 19–20 March 2020; p. 568. [Google Scholar]
  • 25.Singh R.P., William H.M., Huerta-Espino J., Rosewarne G. Wheat rust in Asia: Meeting the challenges with old and new technologies; Proceedings of the 4th International Crop Science Congress; Brisbane, Australia. 26 September–1 October 2004; pp. 1–13. [Google Scholar]
  • 26.Zhang G.S., Liu W., Wang L., Cheng X.R., Tian X.X., Du Z.M., Kang Z.S., Zhao J. Evaluation of the potential risk of the emerging virulent races of Puccinia striiformis f. sp. to 165 Chinese wheat cultivars. Plant Dis. 2022;106:1867–1874. doi: 10.1094/PDIS-11-21-2622-RE. [DOI] [PubMed] [Google Scholar]
  • 27.Sorensen C.K., Thach T., Hovmoller M.S. Evaluation of spray and point inoculation methods for the phenotyping of Puccinia striiformis on wheat. Plant Dis. 2016;100:1064–1070. doi: 10.1094/PDIS-12-15-1477-RE. [DOI] [PubMed] [Google Scholar]
  • 28.McNeal F.H., Konzak C.F., Smith E.P., Tate W.S., Russell T.S. A Uniform System for Recording and Processing Cereal Research Data. CIMMYT; Mexico City, Mexico: 1971. REP-10904. [Google Scholar]
  • 29.Chen X.M., Soria M.A., Yan G.P., Sun J., Dubcovsky J. Development of sequence tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust resistance gene Yr5. Crop Sci. 2003;43:2058–2064. doi: 10.2135/cropsci2003.2058. [DOI] [Google Scholar]
  • 30.Singh R., Datta D., Priyamvada, Singh S., Tiwari R. A diagnostic PCR based assay for stripe rust resistance gene Yr10 in wheat. Acta Phytopathol. Entomol. Hung. 2009;44:11–18. doi: 10.1556/APhyt.44.2009.1.2. [DOI] [Google Scholar]
  • 31.Murphy L.R., Santra D., Kidwell K., Yan G.P., Chen X.M., Campbell K.G. Linkage maps of wheat stripe rust resistance genes Yr5 and Yr15 for use in marker-assisted selection. Crop Sci. 2009;49:1786–1790. doi: 10.2135/cropsci2008.10.0621. [DOI] [Google Scholar]
  • 32.Helguera M., Khan I.A., Kolmer J., Lijavetzky D., Zhong-qi L., Dubcovsky J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Sci. 2003;43:1839–1847. doi: 10.2135/cropsci2003.1839. [DOI] [Google Scholar]
  • 33.Krattinger S.G., Lagudah E.S., Spielmeyer W., Singh R.P., Huerta-Espino J., McFadden H., Bossolini E., Selter L.L., Keller B. A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science. 2009;323:1360–1363. doi: 10.1126/science.1166453. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang X.J., Han D.J., Zeng Q.D., Duan Y.H., Yuan F.P., Shi J.D., Wang Q.L., Wu J.H., Huang L.L., Kang Z.S. Fine mapping of wheat stripe rust resistance gene Yr26 based on collinearity of wheat with Brachypodium distachyon and rice. PLoS ONE. 2013;8:e57885. doi: 10.1371/journal.pone.0057885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fu D.L., Uauy C., Distelfeld A., Blechl A., Epstein L., Chen X.M., Sela H.A., Fahima T., Dubcovsky J. A Kinase-START gene confers temperature-dependent resistance to wheat stripe rust. Science. 2009;323:1357–1360. doi: 10.1126/science.1166289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sui X.X., Wang M.N., Chen X.M. Molecular mapping of a stripe rust resistance gene in spring wheat cultivar Zak. Phytopathology. 2009;99:1209–1215. doi: 10.1094/PHYTO-99-10-1209. [DOI] [PubMed] [Google Scholar]
  • 37.Feng J.Y., Wang M.N., Chen X.M., See D.R., Zheng Y.L., Chao S.M., Wan A.M. Molecular mapping of YrSP and its relationship with other genes for stripe rust resistance in wheat chromosome 2BL. Phytopathology. 2015;105:1206–1213. doi: 10.1094/PHYTO-03-15-0060-R. [DOI] [PubMed] [Google Scholar]
  • 38.Jeger M.J., Fielder H., Beale T., Szyniszewska A.M., Parnell S., Cunniffe N.J. What can be learned by a synoptic review of plant disease epidemics and outbreaks published in 2021? Phytopathology. 2023;113:1141–1158. doi: 10.1094/PHYTO-02-23-0069-IA. [DOI] [PubMed] [Google Scholar]
  • 39.Fielder H., Beale T., Jeger M.J., Oliver G., Parnell S., Szyniszewska A.M., Taylor P., Cunniffe N.J. A synoptic review of plant disease epidemics and outbreaks published in 2022. Phytopathology. 2024;114:1717–1732. doi: 10.1094/PHYTO-01-24-0042-RVW. [DOI] [PubMed] [Google Scholar]
  • 40.Singh R.P., Hodson D.P., Huerta-Espino J., Jin Y., Bhavani S., Njau P., Herrera-Foessel S., Singh P.K., Singh S., Govindan V. The emergence of Ug99 races of the stem rust fungus is a threat to world wheat production. Annu. Rev. Phytopathol. 2011;49:465–481. doi: 10.1146/annurev-phyto-072910-095423. [DOI] [PubMed] [Google Scholar]
  • 41.Zhang G.S., Sun M.D., Ma X.Y., Liu W., Du Z.M., Kang Z.S., Zhao J. Yr5-virulent races of Puccinia striiformis f. sp. tritici possess relative parasitic fitness higher than current main predominant races and potential risk. J. Integr. Agric. 2024;23:2674–2685. doi: 10.1016/j.jia.2023.11.005. [DOI] [Google Scholar]
  • 42.Coriton O., Jahier J., Leconte M., Huteau V., Trotoux G., Dedryver F., de-Vallavieille-Pope C. Double dose efficiency of the yellow rust resistance gene Yr17 in bread wheat lines. Plant Breed. 2020;139:263–271. doi: 10.1111/pbr.12768. [DOI] [Google Scholar]
  • 43.Liu R., Lu J., Zhou M., Zheng S.G., Liu Z.H., Zhang C.H., Du M., Wang M.X., Li Y.F., Wu Y., et al. Developing stripe rust resistant wheat (Triticum aestivum L.) lines with gene pyramiding strategy and marker-assisted selection. Genet. Resour. Crop Evol. 2020;67:381–391. doi: 10.1007/s10722-019-00868-5. [DOI] [Google Scholar]
  • 44.Wang L.C., Tang X.R., Wu J.H., Shen C., Dai M.F., Wang Q.L., Zeng Q.D., Kang Z.S., Wu Y.F., Han D.J. Stripe rust resistance to a burgeoning Puccinia striiformis f. sp. tritici race CYR34 in current Chinese wheat cultivars for breeding and research. Euphytica. 2019;215:68. doi: 10.1007/s10681-019-2383-8. [DOI] [Google Scholar]
  • 45.Yazdani M., Yassaie M., Rezaee S., Zakeri A.K., Patpour M. Exploring Iranian wheat landraces for stripe rust resistance genes and validation of selected genes using molecular markers. Can. J. Plant Pathol. 2023;45:451–462. doi: 10.1080/07060661.2023.2221652. [DOI] [Google Scholar]
  • 46.Eagles H.A., Bariana H.S., Ogbonnaya F.C., Rebetzke G.J., Hollamby G.J., Henry R.J., Henschke P.H., Carter M. Implementation of markers in Australian wheat breeding. Aust. J. Agric. Res. 2001;52:1349–1356. doi: 10.1071/AR01067. [DOI] [Google Scholar]
  • 47.Baloch F.S., Ali A., Tajibayev D., Nadeem M.A., Ölmez F., Aktas H., Alsaleh A., Coemertpay G., Imren M., Mustafa Z., et al. Stripe rust resistance gene in Turkish and Kazakhstan wheat germplasms and the potential of Turkish wild emmer for stripe rust breeding. Genet. Resour. Crop Evol. 2024;71:2699–2719. doi: 10.1007/s10722-023-01804-4. [DOI] [Google Scholar]
  • 48.Abbas S., Li Y.F., Lu J., Hu J.M., Zhang X.N., Lv X., Shahzad A., Ao D.H., Abbas M., Wu Y., et al. Evaluation of stripe rust resistance and analysis of resistance genes in wheat genotypes from Pakistan and Southwest China. Front. Plant Sci. 2024;15:1494566. doi: 10.3389/fpls.2024.1494566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ul Islam B., Mir S., Dar M.S., Khan G.H., Shikari A.B., Sofi N.U., Mohiddin F., Ahangar M.A., Jehangir I.A., Kumar S., et al. Characterization of pre-breeding wheat (Triticum aestivum L.) germplasm for stripe rust resistance using field phenotyping and genotyping. Plants. 2023;12:3239. doi: 10.3390/plants12183239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Sucur R., Ali A., Mortazavi P., Mladenov V., Jockovic B., Gou J.Y., Nadeem M.A., Baloch F.S., Chung Y.S. Molecular screening of stripe rust and powdery mildew resistance genes in European bread wheat using the validated gene-specific SSR markers. Physiol. Mol. Plant Pathol. 2025;139:102743. doi: 10.1016/j.pmpp.2025.102743. [DOI] [Google Scholar]
  • 51.Leharwan M., Singh A.K., Kumar A., Kashyap P.L., Kumar S., Singh R., Gangwar O.P. Phenotyping and deciphering genetic resistance to yellow rust in wheat through marker-assisted analysis. Physiol. Mol. Plant Pathol. 2025;139:102757. doi: 10.1016/j.pmpp.2025.102757. [DOI] [Google Scholar]
  • 52.Kokhmetova A., Rsaliyev A., Malysheva A., Atishova M., Kumarbayeva M., Keishilov Z. Identification of stripe rust resistance genes in common wheat cultivars and breeding lines from Kazakhstan. Plants. 2021;10:2303. doi: 10.3390/plants10112303. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

jof-11-00635-s001.zip (312.2KB, zip)

Data Availability Statement

The data presented in this study is available on request from the corresponding author.


Articles from Journal of Fungi are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES