Skip to main content
Veterinary Sciences logoLink to Veterinary Sciences
. 2025 Aug 27;12(9):826. doi: 10.3390/vetsci12090826

Molecular Detection and Prevalence of Equine Piroplasmosis and Other Blood Parasites in Equids of Western Aegean Türkiye

Selin Hacilarlioglu 1, Huseyin Bilgin Bilgic 1, Tulin Karagenc 1, Heycan Berk Aydin 1, Hasan Toker 1, Hakan Kanlioglu 2, Metin Pekagirbas 1, Serkan Bakirci 1,*
Editors: Luiz Daniel De Barros, Gustavo Felippelli, Fernando de Souza Rodrigues
PMCID: PMC12474372  PMID: 41012752

Simple Summary

In this study, blood samples from 388 equines in Western Aegean Türkiye were analyzed for the presence of Theileria equi, Babesia caballi, Anaplasma phagocytophilum, Trypanosoma spp., and Leishmania spp. using molecular methods. T. equi was detected in 24.74% (96/388) of the samples, and B. caballi in 12.89% (50/388). Infections with T. equi and B. caballi were detected across all four provinces—Aydın, İzmir, Denizli, and Muğla—with the exception of B. caballi, which was not detected in any of the samples from Muğla. None of the other blood parasites investigated were detected in any of the samples. These results indicate that T. equi is widely distributed in the region and that carrier animals may play an important role in the transmission and spread of this disease.

Keywords: equine blood samples, equine piroplasmosis, Anaplasma phagocytophilum, Trypanosoma spp., Leishmania spp., Molecular detection, PCR, Türkiye

Abstract

Equine piroplasmosis (EP), caused by Theileria equi and Babesia caballi, is a tick-borne disease posing significant threats to equine health and the horse industry worldwide. Other vector-borne blood parasites, including Anaplasma phagocytophilum, Trypanosoma spp., and Leishmania spp., can also infect horses; however, their prevalence remains poorly characterized in Türkiye. This study aimed to determine the molecular prevalence of T. equi, B. caballi, A. phagocytophilum, Trypanosoma spp., and Leishmania spp. in equids from the Western Aegean Region of Türkiye. Blood samples were collected from 388 clinically healthy equines across İzmir, Aydın, Denizli, and Muğla provinces. Species-specific PCR assays were performed, and T. equi and B. caballi were detected in 24.74% (96/388) and 12.89% (50/388) of samples, respectively, with co-infections in 3.09%. T. equi and B. caballi infections were detected in horses from all four sampled provinces—Aydın, İzmir, Denizli, and Muğla—except for B. caballi, which was not found in any samples from Muğla. No samples tested positive for A. phagocytophilum, Trypanosoma spp., or Leishmania spp. Prevalence significantly varied by province, breed, age, and sex (p < 0.05). This study demonstrates the considerable prevalence of T. equi and B. caballi in Western Türkiye, underlining the need for routine screening and vector control programs. The absence of other parasites suggests limited circulation; however, continued surveillance remains crucial to safeguard equine health and prevent disease spread.

1. Introduction

Equines, including horses, mules, donkeys, and zebras, are distributed worldwide, and their economic value varies significantly between countries [1]. Throughout history, Equidae have been an important component of animal husbandry in Türkiye, where they have been raised primarily for agricultural, transportation, military, and sporting purposes [2]. Despite ongoing use in some regions, Türkiye’s equine population declined sharply, from 495,543 in the 1990s to 70,360 in 2024, largely due to mechanization in agriculture and transport [3]. However, the sector remains economically important, particularly in the breeding and management of sport horses. Equines are susceptible to a range of diseases, many of which are vector-borne and show nonspecific signs (e.g., fever, anemia, edema). These overlapping signs complicate diagnosis as they are shared by several vector-borne diseases—including Anaplasma phagocytophilum, Trypanosoma spp. (Surra and Dourine), Borrelia burgdorferi (Lyme disease), Leishmania spp., West Nile virus, and the causative agents of equine piroplasmosis (EP)—Babesia caballi and Theileria equi [2,4,5,6,7]. These diseases continue to pose health and economic challenges, particularly in regions where competent arthropod vectors are endemic.

EP is one of the most important vector-borne diseases of equids. It is caused primarily by T. equi, T. haneyi, and B. caballi, which are intra-erythrocytic parasites belonging to the phylum Apicomplexa [8]. Transmission occurs through ixodid ticks such as Amblyomma, Hyalomma, Haemaphysalis, Dermacentor, Ixodes, and Rhipicephalus [8,9,10]. The geographical distribution of these tick vectors overlaps with the areas where the disease is endemic, notably in countries within the Afrotropical, Neotropical, and Palearctic regions [11]. Acute disease can be fatal if left untreated. Chronically infected animals serve as long-term reservoirs, facilitating parasite transmission. Notably, T. equi can persist lifelong in untreated hosts. Therefore, the identification and monitoring of chronically infected equids are crucial to prevent further transmission to naïve animals [12]. Although B. caballi can also establish chronic infections, horses can clear the parasite within approximately four years in the absence of reinfection [12,13,14]. Preventing the introduction of EP into non-endemic areas remains a priority to safeguard equine health and international movement.

Equine granulocytic anaplasmosis (EGA), caused by Anaplasma phagocytophilum, is a zoonotic tick-borne disease of equids [15]. A. phagocytophilum primarily affects horses during the colder months, with prevalence peaking from late autumn to early spring [16]. Depending on the geographic region, various tick species act as vectors for A. phagocytophilum, including Ixodes, Dermacentor, Rhipicephalus, Hyalomma, and Haemaphysalis species [16]. EGA is characterized by fever, reluctance to move, lethargy, ataxia, distal limb edema, lameness, and hematological abnormalities such as thrombocytopenia, anemia, lymphopenia, and neutropenia in horses. It generally resolves spontaneously within 7–14 days [17,18].

Equines have also been increasingly recognized as incidental or potential reservoir hosts for Leishmania spp., especially in regions endemic for canine leishmaniasis. Equine cutaneous leishmaniasis (ECL) has been sporadically reported in various parts of the world. The first documented case occurred in a horse from Argentina, followed by reports in donkeys and mules from Brazil and Venezuela [19,20,21]. To date, phlebotomine sand fly species, including Phlebotomus spp. and Lutzomyia spp., have been reported to feed on domestic animals, including equines, and to transmit Leishmania parasites to horse populations without exhibiting species discrimination [21]. In some endemic regions, infection rates in donkeys have even surpassed those in humans and domestic dogs, suggesting a possible epidemiological role for equids [21]. In Europe, L. infantum has been identified in equids from Spain, Portugal, and Italy, particularly in areas with high canine infection rates [22,23,24,25,26]. Additionally, L. (Mundinia) martiniquensis, formerly known as L. siamensis, has been detected in horses in the United States, Switzerland, and Germany—countries where canine leishmaniasis is not endemic [7,27]. Given the increasing number of reported cases and the close proximity of equids to humans and dogs, particularly in rural and peri-urban settings, investigating Leishmania infections in these animals is essential to better understand their potential role as sentinels, incidental hosts, or secondary reservoirs.

Trypanosoma spp., particularly Try. evansi and Try. vivax, are among the most pathogenic and economically significant species affecting horses, with a broad distribution across Africa, the Middle East, Asia, and Latin America [6,28,29]. Try. evansi, the causative agent of Surra, is mechanically transmitted, mainly via blood-feeding insects such as horseflies (Tabanidae) and stable flies (Stomoxys) [30,31]. Surra, a zoonotic vector-borne disease, is characterized by clinical signs including fluctuating fever, weakness, lethargy, anemia, severe weight loss, petechial hemorrhages on the eyelids and vulvar mucosa, abortion, movement disorders, and edema [28,29,32,33,34].

In Türkiye, most haemoparasitological studies have focused on T. equi and B. caballi, with reported seroprevalence rates ranging from 0–34.6% and 12.8–56.8%, respectively. Molecular studies report 2–38.8% for B. caballi and 3–50% for T. equi [35]. A. phagocytophilum has been investigated in only three studies—one serological [36] and two molecular [35,37]. However, there is a notable lack of data on other vector-borne haemoparasites such as Trypanosoma and Leishmania spp. Given the potential zoonotic importance and epidemiological implications of these pathogens, it is essential to expand surveillance efforts beyond Theileria and Babesia. In light of this knowledge gap, the present study aims to perform a molecular screening for T. equi, B. caballi, A. phagocytophilum, Trypanosoma spp., and Leishmania spp. in equids from the Western Aegean Region of Türkiye.

2. Materials and Methods

2.1. Sampling and Study Area

This study was conducted on clinically healthy horses, donkeys and mules residing in the Western Aegean Region of Türkiye. To ensure that the study sample accurately represented the population, we estimated the sample size based on the number of animals in each sampling region (Table S1). The sample size was calculated using OpenEpi software (Version 3.01, Emory University, Atlanta, GA, USA) [38]. A total of 388 samples were collected from the provinces of İzmir (n = 84), Aydın (n = 177), Denizli (n = 53), and Muğla (n = 74). Figure 1 shows the geographical location of the study area within Türkiye. For statistical analysis, age, sex, breed of each animal, and sampling location were considered. At sampling, none of the animals showed clinical disease signs, and no ticks were observed. Additionally, no information was available regarding their clinical history or any previous antiparasitic treatments. Blood samples were collected from the jugular vein into sterile vacuum tubes containing EDTA (BD Vacutainer®, Franklin Lakes, NJ, USA) from at least the minimum calculated number of animals. Genomic DNA was extracted from blood samples using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA), following the manufacturer’s instructions. Extracted DNA was resuspended in 100 μL elution buffer and stored at −20 °C until analysis. Control DNA samples used in this study were sequence-confirmed reference isolates, labeled according to species and origin, including T. equi/Ankara, B. caballi/Ankara, and, L. infantum/Aydın from Türkiye, A. phagocytophilum/United Kingdom, and Try. evansi/Tunisia.

Figure 1.

Figure 1

Geographic distribution of equine samples collected from the Western Aegean Region of Türkiye.

2.2. Detection of T. equi, B. caballi, A. phagocytophilum, Trypanosoma spp., and Leishmania spp.

All 388 samples were screened with an array of species-specific PCRs for the presence of T. equi, B. caballi, A. phagocytophilum, Trypanosoma spp., and Leishmania spp. Details of primer pairs for each species are given in Table 1. PCR reactions were performed in a final volume of 50 μL containing 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2, 0.001% gelatin, 250 μM of each deoxynucleotide triphosphate, 0.25 U of VitaTaq DNA polymerase (Procomcure Biotech, Bergheim, Austria), 0.5 µM of forward and reverse primer, and 1 µL of DNA template. For the second round of nested PCR (nPCR) targeting B. caballi and A. phagocytophilum, 1 µL of template DNA (first round PCR product) was used. The reactions were performed using an automatic thermal cycler (Techne, TC-512, Staffordshire, UK), and reaction conditions are summarized in Table 1. For each reaction, 10 μL of PCR product was electrophoresed on a 1.5% agarose gel containing 10 μL/mL SybrGreen (SafeView™, ABM Inc., Richmond, BC, Canada) in Tris-acetate-EDTA (TAE) buffer at 100 V. The sizes of the amplified products were estimated using a 100 base pair DNA ladder (GeneDireX®, GeneDireX Inc., Taichung, Taiwan), and the products were visualized on a UVP EC3 Bio-Imaging System with VisionWorksLS software (Version 6.8, Analytik Jena US, Upland, CA, USA).

Table 1.

Primer sequences for detection of Babesia caballi, Theileria equi, Anaplasma phagocytophilum, Trypanosoma spp. and Leishmania spp.

Organisms Genes Primer Names Sequences, 5′-3′ Amplicons Size (Base Pairs) PCR Conditions References
Theileria equi 18S rRNA BEC-UF2 TCG AAG ACG A TC AGA TAC CGT CG 435 94 °C      50 s
55 °C      50 s      35 cycle
72 °C      1 m
[39]
EQUI-R TGC CTT AAA CTT CCT TGC GAT
Babesia caballi * rap-1 Bca-F GAT TAC TTG TCG GCT GTG TCT 222 (nested product) 94 °C      30 s
59 °C      30 s      35 cycle
72 °C      1 m
[40]
Bca-R CGC AAG TTC TCA ATG TCA G
BcaN-F b GCT AAG TAC CAA CCG CTG A
BcaN-R b CGC AAG TTC TCA ATG TCA G
Anaplasma phagocytophilum * 16S rRNA ge3a CACATGCAAGTCGAACGGATTATTC 546 (nested product) 94 °C      50 s
55 °C      50 s      35 cycle
72 °C      1 m
[41]
ge10r TTCCGTTAAGAAGGATCTAATCTCC
ge9f b AACGGATTATTCTTTATAGCTTGCT
ge2 b GGCAGTATTAAAAGCAGCTCCAGG
Trypanosoma spp. ITS1 Kin1
Kin2
GCG TTC AAA GAT TGG GCA AT
CGC CCG AAA GTT CAC C
540 (Try. evansi)
300 (Try. vivax)
94 °C      1 m
58 °C      1 m      4 cycle
72 °C      1 m
94 °C      1 m
56 °C      1 m      8 cycle
72 °C      1 m
94 °C      1 m
54 °C      1 m      23 cycle
72 °C      1 m
[42]
Leishmania spp LT1 RV1 CTT TTC TGG TCC CGC GGG TAG G 145 94 °C      55 s
55 °C      45 s      35 cycle
72 °C      1 m
[43]
RV2 CCA CCT GGC CTA TTT TAC ACC A

* represent species detected by a nPCR approach and b indicates primers used for the second round of the nPCR. Primer sequences are given in 5′→3′ direction.

2.3. Sequencing of Amplified PCR Products

In order to confirm the specificity and accuracy of the PCR assay, Sanger sequencing was performed on three randomly selected positive samples for each parasite species, and these were submitted to a commercial sequencing service (Atlas Biotechnology Laboratory, Ankara, Türkiye). These included three samples obtained from T. equi-positive animals, targeting the 18S rRNA gene with an expected product size of 435 base pairs using the BEC-UF2 and EQUI-R primers (Table 1), and three samples from B. caballi-positive animals, targeting the rap-1 gene with an expected product size of 222 base pairs, using the BcaN-F and BcaN-R primer pairs (Table 1). The resulting sequences were analyzed using BLASTn (www.ncbi.nlm.nih.gov, accessed on 21 May 2025), version 2.16.0 and compared with reference sequences in the GenBank database to confirm their identity.

2.4. Statistical Analysis

Statistical analyses were performed using SPSS version 22.0 (SPSS Inc., Chicago, IL, USA). Data were first assessed for normality, and one-way analysis of variance (ANOVA) was used for normally distributed variables. For non-normally distributed data, the Kruskal–Wallis test was applied. Post hoc tests were conducted to determine which specific groups differed when a statistically significant result was obtained. Results are expressed as mean ± standard error (SE), and a p value of <0.05 was considered statistically significant.

2.5. Ethics Statement

The study was approved by the institutional animal Ethics Committee of the Aydın Adnan Menderes University (Protocol number: 64583101/2018/067) and conducted according to national guidelines conforming to European Directive 2010/63/EU.

3. Results

3.1. Prevalence of T. equi, B. caballi, A. phagocytophilum, Trypanosoma spp. and Leishmania spp.

In the present study, a total of 388 samples were collected from equines, of which 215 (55.41%) were classified as adults (>3 years), 42 (10.83%) as young stock (≤3 years), and 131 (33.76%) as unknown age. The sample population comprised 135 males (34.79%), 88 females (22.68%), and 165 (42.53%) with unknown sex, thus providing a comprehensive representation of the species (Table 2). Some of the recorded data, including the age, sex, and breed of the animals, could not be located for analysis due to an unexpected circumstance. As a result, these data points were treated as missing values to avoid inaccuracies in the statistical analysis. All samples were screened by PCR for the presence of T. equi, B. caballi, Anaplasma spp., Trypanosoma spp., and Leishmania spp. infections. However, only T. equi and B. caballi were detected; all samples tested negative for A. phagocytophilum, Trypanosoma spp., and Leishmania spp. PCR revealed 134 animals (34.54%) positive for at least one parasite, including 12 (3.09%) with co-infections. T. equi was the most prevalent parasite, identified in 96 horses (24.74%), whereas B. caballi was detected in 50 horses (12.89%). There was no statistically significant difference in prevalence between T. equi and B. caballi (p = 0.896) among sampled animals.

Table 2.

Distribution of Theileria equi and Babesia caballi infections by age, sex, and breed in equines of Western Aegean Türkiye.

Factors Positive Samples (No (%)/(Mean ± Standard Error of The Mean)
T. equi p Value * B. caballi p Value *
Age ≥3 years 54 (25.11%) (1.74 ± 0.43) 19 (8.83%) (1.91 ± 0.28)
<3 years 9 (21.43%) (1.78 ± 0.41) 3 (7.14%) (1.92 ± 0.26)
Unknown 33 (25.19%) (1.74 ± 0.43) 28 (21.37%) (1.78 ± 0.41)
0.871 *a 0.002 *
Sex Female 24 (27.27%) (1.72 ± 0.04) 8 (9.09%) (1.90 ± 0.03)
Male 35 (25.93%) (1.74 ± 0.03) 10 (7.41%) (1.92 ± 0.02)
Unknown 37 (22.42%) (1.77 ± 0.03) 32 (19.39%) (1.80 ± 0.03)
0.645 *b 0.004 *
Breed Ambler 27 (35.52%) (1.64 ± 0.05) 0 (0%) (2.00 ± 0.00)
Arabian 8 (11.43%) (1.88 ± 0.03) 12 (17.14%) (1.82 ± 0.04)
English 1 (2.86%) (1.97 ± 0.02) 3 (8.57%) (1.91 ± 0,04)
Local breed 12 (60.0%) (1.40 ± 0.11) 4 (20.0%) (1.80 ± 0.09)
Haflinger 0 (0%) (2.00 ± 0.00) 0 (0%) (2.00 ± 0.00)
Pony 2 (50%) (1.50 ± 0.28) 1 (25%) (1.75 ± 0.25)
Donkey/Local 9 (42.86%) (1.57 ± 0.11) 0 (0%) (2.00 ± 0.00)
Mule/Local 2 (11.76%) (1.88 ± 0.08) 0 (0%) (2.00 ± 0.00)
Unknown 35 (24.65%) (1.75 ± 0.03) 30 (21.13%) (1.78 ± 0.03)
0.000 * 0.000 *

* Indicates p values considered as statistically significant (<0.05) based on the Kruskal–Wallis test for non-normally distributed data. *a p value between age for T. equi positive samples *b p value between sex for T. equi positive samples.

Geographically, T. equi and B. caballi infections were identified in horses from all four sampled provinces—Aydın, İzmir, Denizli, and Muğla—with the exception of B. caballi, which was not detected in any of the samples from Muğla. Figure 2 compares the molecular prevalence of T. equi and B. caballi among the four provinces sampled in the Western Aegean Region of Türkiye. The distribution of T. equi across the study area showed considerable variation; the highest infection rate was observed in Aydın (58/177, 32.77%), followed by Muğla (21/74, 28.38%), Denizli (8/53, 15.09%) and İzmir (9/84, 10.71%). Similarly, the prevalence of B. caballi also varied by region, ranging from null in Muğla to 39.29% in İzmir. The highest frequency of B. caballi infection was recorded in İzmir (33/84, 39.29%), followed by Denizli (9/53, 16.98%) and Aydın (8/177, 4.52%). The differences in prevalences of T. equi (p < 0.001) and B. caballi (p < 0.001) among provinces were statistically significant (Table 3), indicating that geographic location may play a role in the epidemiology of EP in the Western Aegean Region of Türkiye (Figure 2).

Figure 2.

Figure 2

Distribution of Theileria equi and Babesia caballi samples among provinces.

Table 3.

Demographic distribution of Theileria equi and Babesia caballi infections.

Factors Positive Samples (No (%)/(Mean ± Standard Error of The Mean)
T. equi p Value * B. caballi p Value *
Province Aydın 58 (32.77%) (1.67 ± 0.03) 8 (4.52%) (1.95 ± 0.01)
Denizli 8 (15.09%) (1.84 ± 0.04) 9 (16.98%) (1.83 ± 0.05)
İzmir 9 (10.71%) (1.89 ± 0.03) 33 (39.29%) (1.60 ± 0.05)
Muğla 21 (28.38%) (1.71 ± 0.05) 0 (0%) (2.00 ± 0.00)
0.000 * 0.000 *
Overall 96 (24.74%) 50 (12.89%) 0.896 *c

* Indicates p values considered as statistically significant (<0.05) based on the Kruskal–Wallis test for non-normally distributed data. *c p value between T. equi and B. caballi positive samples.

Theileria equi prevalence significantly differed among breeds (p < 0.001) (Table 2). However, no significant differences were observed between age groups (≤3 years vs. >3 years; p = 0.871) or sex (females: 24/88, 27.27% vs. males: 35/135, 25.93%; p = 0.645). In contrast, the distribution of B. caballi infections showed notable differences based on age, sex, and breed. The infection was more prevalent (p = 0.004) in females (8/88, 9.09%) compared to males (7.41%). Furthermore, when comparing different age groups, the positivity rate was higher in individuals older than three years (19/215, 8.83%) than in those aged three years or younger (3/42, 7.14%) (p = 0.002) (Table 2). In the present study, significant differences were observed in the prevalence of T. equi and B. caballi infections among different horse breeds and species (p < 0.001). T. equi was detected across most horse breeds and donkeys, with the highest infection rates recorded in local horses (12/20, 60.0%), ponies (2/4, 50.0%), donkeys (9/21, 42.86%), and Ambler horses (27/76, 35.52%). In contrast, lower prevalence rates were noted in Arabian (11.43%) and English (2.86%) horses. Notably, T. equi was not detected in Haflingers. Regarding B. caballi, infections were primarily found in local (4/20, 20.0%) and Arabian (12/70, 17.14%) breeds, while no cases were detected in Ambler horses, donkeys, mules, or Haflingers. Although the sample size for some breeds was limited, these findings suggest that breed may influence susceptibility or exposure to EP pathogens, potentially due to differences in vector contact, geographical distribution, or husbandry conditions.

3.2. Sequence Results

To confirm the accuracy of the PCR assay, six representative positive samples (three T. equi and three B. caballi) were randomly selected, and subjected to sequence analysis. The BLAST analysis of the three sequences obtained from T. equi-positive samples revealed 99–100% identity with sequences previously reported from Türkiye (MG569900), Sudan (AB515311), and Israel (KX227639). Sequences from the three B. caballi-positive samples showed 99% identity to reference sequences from Brazil (MG906584) and Sudan (LC514709).

4. Discussion

The significance of EP is underscored by the global mobility of horses, particularly those with substantial economic value that are transported for participation in international equestrian sporting events [44,45]. Many countries enforce strict import regulations to prevent the introduction of positive animals into their territories. These countries have established unified and widely accepted policies at both federal and state levels for the identification and management of seropositive horses [46,47,48]. In Türkiye, horse importation is regulated through licensing systems requiring certification of freedom from specific diseases such as equine infectious anemia, African horse sickness, dourine, glanders, anthrax, and equine viral arteritis [49]. However, an important tick-borne disease; EP, caused by T. equi and B. caballi and transmitted by ticks belonging to the genera Dermacentor, Rhipicephalus, and Hyalomma [50], is not included in the list of infections evaluated during the importation process. EP is widespread globally and the disease most commonly occurs in its chronic form, which is characterized by nonspecific clinical signs such as lethargy, partial anorexia, weight loss, and poor performance. Consequently, infected animals frequently become asymptomatic carriers, sustaining transmission [9,10,50].

Traditionally, diagnosis of EP has relied on microscopic examination of Giemsa-stained blood smears [51], but this method lacks sensitivity, especially in chronic infections with low levels of parasitemia [9,50]. Serological techniques offer improved sensitivity for detecting subclinical infections, but they cannot differentiate between past and current infections [52]. In contrast, PCR-based molecular techniques allow for highly sensitive and specific detection of active infections and enable species-level identification [39,53]. The prevalence of T. equi varies significantly across different regions and continents, affected by diagnostic methods as well as local epidemiological factors such as vector density, host behavior, and strategies for tick control [51]. Globally, molecular prevalence rates range from 0.8–96.8% for T. equi and from undetectable to 78.0% for B. caballi [54,55].

In Türkiye, several studies have reported a wide range of prevalence levels, from 0% to 85%, using molecular techniques [35,56,57,58]. In the present study, conducted on 388 equids from the Western Anatolia Region of Türkiye, the molecular prevalence of T. equi and B. caballi was found to be 24.74% and 12.89%, respectively. Mixed infections were detected in 3.09% of the animals. Consistent with most previous findings, T. equi was found to be more prevalent than B. caballi in this study, which can be attributed to the lifelong carrier status of T. equi infections [51]. While interpreting the molecular prevalence results for T. equi, it is important to consider potential diagnostic limitations of the assay used in this study. Although the assay used in this study targets the 18S rRNA gene region specific to T. equi, previous studies have shown high sequence similarity between T. equi and T. haneyi [59,60]. It should be noted that cross-amplification cannot be completely excluded, and some of the T. equi–positive results in this study may potentially represent T. haneyi. Due to the limited sequencing data and the lack of T. haneyi–specific PCR assays, we were unable to confirm or exclude this species. Considering that T. haneyi is increasingly reported in various regions and may be misidentified as T. equi in 18S-based assays, future studies in this region should include T. haneyi–specific molecular testing [59,61]. Additionally, sequencing a larger proportion of positive samples would help clarify the occurrence and prevalence of this species. Given the widespread presence of competent tick vectors in Türkiye [62], the detection and elimination of persistent T. equi (and potentially T. haneyi) infections are critical steps toward preventing the re-emergence and spread of the disease. The role of chronically infected equids as reservoirs for tick transmission, as proposed by Scoles and Ueti (2015) [10], underscores the need for routine molecular screening, especially in regions with active equine movement and trade. Integrating molecular diagnostics with tick surveillance and vector control programs would strengthen current prevention strategies and help mitigate the risk of new outbreaks.

In the present study, due to an inexplicable circumstance, some of the recorded data, including age, sex, and breed of the animals, could not be retrieved for the analysis. As a result, these data points were treated as missing values to prevent any inaccuracies in the statistical analysis. Thus, the following statistical conclusions are only valid for animals with complete data. In this study, T. equi was detected in all the provinces examined—Aydın, İzmir, Denizli, and Muğla—while B. caballi was not detected in the Muğla. The prevalence of both parasites varied significantly among sampled provinces (p < 0.001). The observed differences may be influenced by breed distributions and horse usage (e.g., heavy labor), which affect tick exposure, especially in Muğla where tick control is less rigorously applied. Earlier studies identified a positive correlation between age and T. equi or B. caballi prevalence, indicating higher risk in older animals [63,64]. In this study, while no statistically significant difference in the rate of T. equi infection was observed between age groups, B. caballi infections were significantly more common in animals over 3 years of age (p = 0.002). Although this finding may reflect the larger sample size in this age group, it contrasts with previous reports indicating higher B. caballi prevalence in younger animals [8]. In general, T. equi prevalence tends to increase with age, due to its ability to establish lifelong carrier states. In contrast, B. caballi infections may be cleared over time as host immunity develops [51]. Similarly, T. equi prevalence did not vary by sex, whereas B. caballi was significantly more common in females (p = 0.004). The influence of host sex on susceptibility to protozoan infections, including T. equi and B. caballi, has been debated. Some studies have linked sex differences in infection rates to the modulatory effects of sex hormones on immune responses [65]. For example, in Leishmania infections, androgens and estrogens modulate the Th1/Th2 balance, affecting host susceptibility [66]. However, data on EP are inconsistent. While several studies report higher infection rates of T. equi in females [11,63,67,68], others have found no significant association between sex and seropositivity for either T. equi or B. caballi [12,58,69].

Breed has been identified as a potential risk factor affecting seroprevalence of EP [67]. Both parasites have also been detected in other equids, including donkeys and mules [8,70,71,72,73]. In this study, the prevalence of both parasites differed significantly among breeds (p < 0.001). Local donkeys exhibited the highest prevalence of T. equi (9/21, 42.86%) after local horse breeds (12/20, 60%). Conversely, B. caballi was not detected in donkeys. This finding suggests that the more persistent T. equi infections follow a similar course in donkeys, which may act as carriers of EP, potentially affecting their health and work performance [74]. Although donkeys are considered more resistant than horses [74], this assumption remains insufficiently supported, as data on domestic equines—particularly donkeys and mules—are less comprehensive than those available for horses. The lower infection rates observed particularly in sport horses may reflect reduced exposure to tick infestation as well as more effective management and parasite control programs. In other words, the higher prevalence observed in mules and donkeys has been attributed to their frequent outdoor activities, particularly their involvement in daily wood transportation from forests [64]. This may also be associated with their prolonged exposure to pasture environments, which increases the likelihood of tick bites [51].

Equine granulocytic anaplasmosis (EGA), caused by A. phagocytophilum, is a tick-borne disease with a worldwide distribution [15,16]. In Türkiye, A. phagocytophilum infections have been reported at varying prevalence rates not only in horses but also in cattle [75,76,77], sheep [78,79,80], goats [81], and dogs [82]. However, data on its prevalence in horses remain limited. Previous studies reported a seroprevalence of 8.6% [37], while molecular prevalence rates were 6.6% [35] and 6.4% [37]. In contrast to these findings, A. phagocytophilum was not detected in the present study. This variation in findings may be attributed to differences in geographical distribution, sample size, seasonal factors, or tick infestation rates in the study areas.

Among salivarian trypanosomes, Try. evansi and Try. vivax are responsible for Surra and Nagana diseases, respectively. They cause fatal infections in a wide range of domestic and wild animals, including camelids, horses, cattle, buffalo, small ruminants, pigs, carnivores, deer, gazelles, and elephants [29,30,32,83]. Although, Try. evansi has been reported in Türkiye [29], no subsequent studies have examined the presence of the parasite in equines so far. In the present study, no positive samples were detected for Try. evansi or Try. vivax. These findings align with the absence of reported clinical trypanosomiasis cases in horses from Western Anatolia. This suggests that Try. evansi is likely not present in this area. The lack of molecular detection of Try. evansi and Try. vivax may be attributed to parasite clearance, seasonal variations in parasitemia, or parasitemia levels below the detection threshold of the PCR assay used [32]. Nevertheless, considering that outbreaks of Try. evansi have been reported in neighboring countries [84,85], located approximately 1500 km away from the sampling sites in this study, strict control measures regarding the importation and movement of animals from these regions remain crucial, especially due to the widespread distribution of blood-sucking insect vectors capable of transmitting these parasites.

Leishmaniasis is a zoonotic disease caused by species of the genus Leishmania, which are obligate intracellular protozoa transmitted by blood-sucking female sand flies [86]. The disease affects not only humans but also a variety of domestic and wild animals [7]. Recent studies have reported Leishmania infections in equines in both endemic [7,20] and non-endemic regions, and sporadic cases of equine cutaneous leishmaniasis caused by L. infantum [22,87] or L. martiniquensis [27]. Visceral and cutaneous leishmaniasis caused by L. infantum and L. tropica are endemically seen in the Aegean region of Türkiye [88]. Although several studies in European countries have investigated the role of different farm animals, including horses, in the transmission of leishmaniasis, no such studies have been conducted in Türkiye to date. In the present study, PCR assays targeting the LT1 gene region of Leishmania were performed on blood samples collected from equines in the sampling area; however, no Leishmania DNA was detected in any of the samples. PCR, as a molecular diagnostic technique, has higher sensitivity when tissue samples such as bone marrow, lymph nodes, spleen, or culture isolates are used, compared to blood samples [89]. Thus, reliance on blood samples may partly explain the absence of positive detections. It is evident that both sample type and sample size are critical factors that should be considered in studies aiming to determine the prevalence of leishmaniasis in equids, particularly in endemic areas. Indeed, researchers have reported that in endemic regions, the prevalence of infection in donkeys may exceed that observed in humans and domestic dogs [21].

In the present study, blood samples were collected from the jugular vein of clinically healthy animals for the molecular detection of all targeted parasites. However, it should be noted that the choice of sampling site can significantly influence the detection sensitivity of blood parasites. Previous studies have recommended jugular venipuncture for the detection of T. equi, B. caballi, and A. phagocytophilum, particularly in healthy animals [12,14,90]. In contrast, for Try. evansi, sampling from peripheral capillary-rich sites has been suggested to improve detection [91], although jugular venipuncture remains the most common choice in field studies due to practical considerations. Detection of Leishmania spp. is inherently more challenging; optimal molecular diagnosis generally involves tissue samples from lesions (e.g., skin scrapings, needle aspirates, or biopsies) or aspirates from lymph nodes or bone marrow [88,89]. However, such sampling procedures, as well as the collection of peripheral capillary blood, are often impractical under field conditions in equids. For these reasons, jugular vein sampling was adopted for all animals in the present study. While the sampling site is an important parameter for the detection of related parasites, the sampling time-point may also influence the detection of parasites such as A. phagocytophilum due to the seasonal pattern of tick activity and pathogen transmission [92,93]. In this study, none of the animals exhibited clinical signs of any diseases, and there were no ticks present on the animals at the time of sampling. Based on the lack of positivity in A. phagocytophilum, Try. evansi and Leishmania spp. in collected equidae samples, we conclude to include alternative sampling sites such as capillary vessels, tissue fluids, biopsies, needle aspirates and skin scrapings in future studies that are aiming to detect these parasites.

5. Conclusions

This study determined the prevalence and genetic characteristics of EP in horses from Western Anatolia, Türkiye. The results showed a prevalence of 24.74% (96/388) for T. equi and 12.89% (50/388) for B. caballi, with all positive horses identified as asymptomatic carriers. These significant prevalence rates highlight the risk posed by carrier animals, which can transmit infection to ticks and may develop clinical disease under immunosuppression, heavy exercise, concurrent illness, or stress. Although no ticks were found on sampled horses, studies targeting tick vectors are needed to assess parasite prevalence. Similarly, more research is required to elucidate the clinical significance of atypical piroplasm infections in equids. Moreover, although other blood parasites such as Leishmania, Trypanosoma, and Anaplasma species were also investigated in this study but not detected, clinicians should consider the potential presence of blood parasites other than B. caballi and T. equi in the diagnosis and treatment of equine diseases.

Acknowledgments

The authors would like to thank Ahmet DENIZ for providing T. equi and B. caballi control DNA samples, Alexander GRAY for providing A. phagocytophilum positive control DNA and Mohamed GHARBI for providing Trypanasoma spp. positive control DNA. We would also like to thank to veterinarian Muharrem BOZAN for his support in collecting samples.

Abbreviations

The following abbreviations are used in this manuscript:

EP Equine piroplasmosis
EGA Equine granulocytic anaplasmosis
ECL Equine cutaneous leishmaniasis
PCR Polymerase Chain Reaction
n-PCR Nested Polymerase Chain Reaction
DNA Deoxyribonucleic acid

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci12090826/s1, Table S1. Estimated and actual sample sizes for each sampling region.

vetsci-12-00826-s001.zip (150.5KB, zip)

Author Contributions

Conceptualization, H.B.B., S.B. and T.K.; methodology, H.B.B., S.B. and S.H.; software, S.B. and M.P.; validation, H.B.B., S.B. and T.K.; formal analysis, S.B. and M.P.; investigation, H.B.B., S.B., S.H., H.K., H.B.A. and H.T.; resources, H.B.B., S.B. and T.K.; data curation, S.B. and S.H.; writing—original draft preparation, S.B.; writing—review and editing, H.B.B., S.B. and T.K.; visualization, S.B. and M.P.; supervision, T.K.; project administration, H.B.B. and S.B. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the institutional animal Ethics Committee of the Aydın Adnan Menderes University (Date: 31 May 2018, Protocol number: 64583101/2018/067) and conducted according to national guidelines conforming to European Directive 2010/63/EU.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Dataset available on request from the authors.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Funding Statement

This study was partially supported by the Adnan Menderes University Research Foundation (VTF-20017) and is based in part on data from a Master’s thesis conducted at the Institute of Health Sciences, Adnan Menderes University.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Ramadan R.M., Taha N.M., Auda H.M., Elsamman E.M., El-Bahy M.M., Salem M.A. Molecular and immunological studies on Theileria equi and its vector in Egypt. Exp. Appl. Acarol. 2024;93:439–458. doi: 10.1007/s10493-024-00933-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yilmaz O., Wilson R.T. The domestic livestock resources of Turkey: Occurrence and control of diseases of horses, donkeys and mules. J. Equine Vet. Sci. 2013;33:1021–1030. doi: 10.1016/j.jevs.2013.05.003. [DOI] [Google Scholar]
  • 3.Çırak V.Y., Girişgin A.O. Parasites of horses, donkeys and mules in Turkey. Türkiye Parazitol. Derg. 2021;45:56–75. doi: 10.4274/tpd.galenos.2020.7193. [DOI] [PubMed] [Google Scholar]
  • 4.Brun R., Hecker H., Lun Z.-R. Trypanosoma evansi and T. equiperdum: Distribution, biology, treatment and phylogenetic relationship (a review) Vet. Parasitol. 1998;79:95–107. doi: 10.1016/S0304-4017(98)00146-0. [DOI] [PubMed] [Google Scholar]
  • 5.Limeira C.H., Alves C.J., Azevedo S.S., Santos C.S.A.B., Melo M.A., Soares R.R., Barnabé N.N.D.C., Rodrigues G.Q. Clinical aspects and diagnosis of leishmaniasis in equids: A systematic review and meta-analysis. Rev. Bras. Parasitol. Vet. 2019;28:574–581. doi: 10.1590/s1984-29612019074. [DOI] [PubMed] [Google Scholar]
  • 6.Sazmand A., Bahari A., Papi S., Otranto D. Parasitic diseases of equids in Iran (1931–2020): A literature review. Parasites Vectors. 2020;13:568. doi: 10.1186/s13071-020-04472-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Carbonara M., Mendoza-Roldan J.A., Bezerra-Santos M.A., de Abreu Teles P.P., Lia R.P., Locantore F., Iatta R., Volf P., Otranto D. Leishmania spp. in equids and their potential vectors in endemic areas of canine leishmaniasis. PLoS Neglected Trop. Dis. 2024;18:e0012290. doi: 10.1371/journal.pntd.0012290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tirosh-Levy S., Gottlieb Y., Fry L.M., Knowles D.P., Steinman A. Twenty years of equine piroplasmosis research: Global distribution, molecular diagnosis, and phylogeny. Pathogens. 2020;9:926. doi: 10.3390/pathogens9110926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wise L.N., Kappmeyer L.S., Mealey R.H., Knowles D.P. Review of equine piroplasmosis. J. Vet. Intern. Med. 2013;27:1334–1346. doi: 10.1111/jvim.12168. [DOI] [PubMed] [Google Scholar]
  • 10.Scoles G.A., Ueti M.W. Vector ecology of equine piroplasmosis. Annu. Rev. Entomol. 2015;60:561–580. doi: 10.1146/annurev-ento-010814-021110. [DOI] [PubMed] [Google Scholar]
  • 11.Atabek B., Zhyldyz A., Aitakin K., Rysbek N., Jailobek O., Ahedor B., Mumbi N.N.M., Ma Y., Otgonsuren D., Perera W.P.P.S.I., et al. Molecular prevalence and genotypic diversity of Theileria equi and Babesia caballi infecting horses in Kyrgyzstan. Parasitol. Int. 2024;102:102915. doi: 10.1016/j.parint.2024.102915. [DOI] [PubMed] [Google Scholar]
  • 12.Ahedor B., Sivakumar T., Valinotti M.F.R., Otgonsuren D., Yokoyama N., Acosta T.J. PCR detection of Theileria equi and Babesia caballi in apparently healthy horses in Paraguay. Vet. Parasitol. Reg. Stud. Rep. 2023;39:100835. doi: 10.1016/j.vprsr.2023.100835. [DOI] [PubMed] [Google Scholar]
  • 13.Li J., Li Y., Moumouni P.F.A., Lee S.H., Galon E.M., Tumwebaze M.A., Yang H., Huercha, Liu M., Guo H., et al. First description of Coxiella burnetii and Rickettsia spp. infection and molecular detection of piroplasma co-infecting horses in Xinjiang Uygur Autonomous Region, China. Parasitol. Int. 2020;76:102028. doi: 10.1016/j.parint.2019.102028. [DOI] [PubMed] [Google Scholar]
  • 14.Otgonsuren D., Amgalanbaatar T., Narantsatsral S., Enkhtaivan B., Munkhgerel D., Zoljargal M., Davkharbayar B., Myagmarsuren P., Battur B., Battsetseg B., et al. Epidemiology and genetic diversity of Theileria equi and Babesia caballi in Mongolian horses. Infect. Genet. Evol. 2024;119:105571. doi: 10.1016/j.meegid.2024.105571. [DOI] [PubMed] [Google Scholar]
  • 15.Saleem S., Ijaz M., Farooqi S.H., Ghaffar A., Ali A., Iqbal K., Mehmood K., Zhang H. Equine granulocytic anaplasmosis 28 years later. Microb. Pathog. 2018;119:1–8. doi: 10.1016/j.micpath.2018.04.001. [DOI] [PubMed] [Google Scholar]
  • 16.Dzięgiel B., Adaszek Ł., Kalinowski M., Winiarczyk S. Equine granulocytic anaplasmosis. Res. Vet. Sci. 2013;95:316–320. doi: 10.1016/j.rvsc.2013.05.010. [DOI] [PubMed] [Google Scholar]
  • 17.Praskova I., Bezdekova B., Zeman P., Jahn P. Seroprevalence of Anaplasma phagocytophilum in horses in the Czech Republic. Ticks Tick-Borne Dis. 2011;2:111–115. doi: 10.1016/j.ttbdis.2011.01.002. [DOI] [PubMed] [Google Scholar]
  • 18.Madigan J.E., Barlough J.E., Dumler J.S., Schankman N.S., DeRock E. Equine granulocytic ehrlichiosis in Connecticut caused by an agent resembling the human granulocytotropic ehrlichia. J. Clin. Microbiol. 1996;34:434–435. doi: 10.1128/jcm.34.2.434-435.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Aguilar C.M., Fernández E.S., Fernandez R., Deane L.M. Study of an outbreak of cutaneous leishmaniasis in Venezuela: The role of domestic animals. Mem. Do Inst. Oswaldo Cruz. 1984;79:181–195. doi: 10.1590/S0074-02761984000200005. [DOI] [PubMed] [Google Scholar]
  • 20.Truppel J.H., Otomura F., Teodoro U., Massafera R., da Costa-Ribeiro M.C.V., Catarino C.M., Dalagrana L., Costa Ferreira M.E.M., Thomaz-Soccol V., Schallig H.D.F.H. Can equids be a reservoir of Leishmania braziliensis in endemic areas? PLoS ONE. 2014;9:e93731. doi: 10.1371/journal.pone.0093731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mhadhbi M., Sassi A. Infection of the equine population by Leishmania parasites. Equine Vet. J. 2020;52:28–33. doi: 10.1111/evj.13178. [DOI] [PubMed] [Google Scholar]
  • 22.Solano-Gallego L., Fernández-Bellon H., Serra P., Gállego M., Ramis A., Fondevila D., Ferrer L. Cutaneous leishmaniosis in three horses in Spain. Equine Vet. J. 2003;35:320–323. doi: 10.2746/042516403776148336. [DOI] [PubMed] [Google Scholar]
  • 23.Gama A., Elias J., Ribeiro A.J., Alegria N., Schallig H.D., Silva F., Santarém N., Cardoso L., Cotovio M. Cutaneous leishmaniosis in a horse from northern Portugal. Vet. Parasitol. 2014;200:189–192. doi: 10.1016/j.vetpar.2013.12.005. [DOI] [PubMed] [Google Scholar]
  • 24.Gazzonis A.L., Morganti G., Porcellato I., Roccabianca P., Avallone G., Gavaudan S., Canonico C., Rigamonti G., Brachelente C., Veronesi F. Detection of Leishmania spp. in chronic dermatitis: Retrospective study in exposed horse populations. Pathogens. 2022;11:634. doi: 10.3390/pathogens11060634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pala S., Martínez-Sáez L., Llobat L., Marín-García P.J. Prevalence and factors associated with Leishmania spp. and Toxoplasma gondii infections in apparently healthy horses in Eastern Spain. Res. Vet. Sci. 2024;171:105236. doi: 10.1016/j.rvsc.2024.105236. [DOI] [PubMed] [Google Scholar]
  • 26.Cardoso L., Schallig H., Persichetti M.F., Pennisi M.G. New epidemiological aspects of animal leishmaniosis in Europe: The role of vertebrate hosts other than dogs. Pathogens. 2021;10:307. doi: 10.3390/pathogens10030307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Müller N., Welle M., Lobsiger L., Stoffel M.H., Boghenbor K.K., Hilbe M., Gottstein B., Frey C.F., Geyer C., von Bomhard W. Occurrence of Leishmania sp. in cutaneous lesions of horses in Central Europe. Vet. Parasitol. 2009;166:346–351. doi: 10.1016/j.vetpar.2009.09.001. [DOI] [PubMed] [Google Scholar]
  • 28.Berlin D., Nasereddin A., Azmi K., Ereqat S., Abdeen Z., Baneth G. Longitudinal study of an outbreak of Trypanosoma evansi infection in equids and dromedary camels in Israel. Vet. Parasitol. 2010;174:317–322. doi: 10.1016/j.vetpar.2010.09.002. [DOI] [PubMed] [Google Scholar]
  • 29.Desquesnes M., Holzmuller P., Lai D.H., Dargantes A., Lun Z.R., Jittaplapong S. Trypanosoma evansi and surra: A review and perspectives on origin, history, distribution, taxonomy, morphology, hosts, and pathogenic effects. BioMed Res. Int. 2013;2013:194176. doi: 10.1155/2013/194176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Desquesnes M., Dargantes A., Lai D.-H., Lun Z.-R., Holzmuller P., Jittapalapong S. Trypanosoma evansi and surra: A review and perspectives on transmission, epidemiology and control, impact, and zoonotic aspects. BioMed Res. Int. 2013;2013:321237. doi: 10.1155/2013/321237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jaimes-Dueñez J., Jiménez-Leaño Á., Enrique-Niño S., Arias-Landazábal N., Bedoya-Ríos M., Rangel-Pachón D. Clinical and epidemiological aspects of the infection by Babesia, Theileria and Trypanosoma species in horses from northeastern Colombia. Ticks Tick-Borne Dis. 2023;14:102208. doi: 10.1016/j.ttbdis.2023.102208. [DOI] [PubMed] [Google Scholar]
  • 32.Desquesnes M., Gonzatti M., Sazmand A., Thévenon S., Bossard G., Boulangé A., Gimonneau G., Truc P., Herder S., Ravel S., et al. A review on the diagnosis of animal trypanosomoses. Parasites Vectors. 2022;15:64. doi: 10.1186/s13071-022-05190-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Golombieski L., Bassi das Neves G., da Silva Casa M., Campos de Souza Costa G., Miletti L.C., Saito M.E., Fonteque J.H. Prevalence and risk factors associated with natural infection by Trypanosoma evansi in Campeiro horses. J. Equine Vet. Sci. 2023;126:104300. doi: 10.1016/j.jevs.2023.104300. [DOI] [PubMed] [Google Scholar]
  • 34.Shoraba M., Shoulah S.A., Arnaout F., Selim A., El-Magd M. Equine trypanosomiasis: Molecular detection, hematological, and oxidative stress profiling. Vet. Med. Int. 2024;2024:6550276. doi: 10.1155/2024/6550276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ceylan O., Benedicto B., Ceylan C., Tumwebaze M., Galon E.M., Liu M., Xuan X., Sevinc F. A survey on equine tick-borne diseases: The molecular detection of Babesia ovis DNA in Turkish racehorses. Ticks Tick-Borne Dis. 2021;12:101784. doi: 10.1016/j.ttbdis.2021.101784. [DOI] [PubMed] [Google Scholar]
  • 36.Gün Aydin E., Pekkaya S., Kuzugüden F., Zeybek M., Güven Gökmen T., Ütük A.E. The first detection of anti-Anaplasma phagocytophilum antibodies in horses in Turkey. Kafkas Univ. Vet. Fak. Derg. 2018;24:867–871. doi: 10.9775/kvfd.2018.20171. [DOI] [Google Scholar]
  • 37.Oğuz B. First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in horses in Muş Province of Turkey. Kocaeli Univ. Sağlık Bilim. Derg. 2021;7:312–318. doi: 10.30934/kusbed.895438. [DOI] [Google Scholar]
  • 38.Dean A., Sullivan K., Soe M. OpenEpi: Open-source epidemiologic statistics for public health. 2013. [(accessed on 11 August 2025)]. Available online: https://www.openepi.com/Menu/OE_Menu.htm.
  • 39.Alhassan A., Pumidonming W., Okamura M., Hirata H., Battsetseg B., Fujisaki K., Yokoyama N., Igarashi I. Development of a single-round and multiplex PCR method for the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet. Parasitol. 2005;129:43–49. doi: 10.1016/j.vetpar.2004.12.018. [DOI] [PubMed] [Google Scholar]
  • 40.Schwint O.N., Knowles D.P., Ueti M.W., Kappmeyer L.S., Scoles G.A. Transmission of Babesia caballi by Dermacentor nitens (Acari: Ixodidae) is restricted to one generation in the absence of alimentary reinfection on a susceptible equine host. J. Med. Entomol. 2008;45:1152–1155. doi: 10.1093/jmedent/45.6.1152. [DOI] [PubMed] [Google Scholar]
  • 41.Massung R.F., Slater K., Owens J.H., Nicholson W.L., Mather T.N., Solberg V.B., Olson J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998;36:1090–1095. doi: 10.1128/JCM.36.4.1090-1095.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Desquesnes M., McLaughlin G., Zoungrana A., Dávila A.M. Detection and identification of Trypanosoma of African livestock through a single PCR based on internal transcribed spacer 1 of rDNA. Int. J. Parasitol. 2001;31:610–614. doi: 10.1016/S0020-7519(01)00161-8. [DOI] [PubMed] [Google Scholar]
  • 43.Le Fichoux Y., Schwenkenbecher J., Goralczyk K., Marty P., Boni M., Rioux J.A., Pratlong F. Occurrence of Leishmania infantum parasitemia in asymptomatic blood donors living in an area of endemicity in southern France. J. Clin. Microbiol. 1999;37:1953–1957. doi: 10.1128/JCM.37.6.1953-1957.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Divan Baldani C., Cristina A., Nakaghi H.O., Rosangela S., Machado Z. Occurrence of Theileria equi in horses raised in the Jaboticabal microregion, São Paulo State, Brazil. Rev. Bras. Parasitol. Vet. 2011;20:44–47. doi: 10.1590/S1984-29612010000400007. [DOI] [PubMed] [Google Scholar]
  • 45.Sevinc F., Maden M., Kumas C., Sevinc M., Ekici O.D. A comparative study on the prevalence of Theileria equi and Babesia caballi infections in horse sub-populations in Turkey. Vet. Parasitol. 2008;156:173–177. doi: 10.1016/j.vetpar.2008.06.006. [DOI] [PubMed] [Google Scholar]
  • 46.Friedhoff K. Transmission of Babesia. In: Ristic M., editor. Babesiosis of Domestic Animals and Man. CRC Press; Boca Raton, FL, USA: 1988. pp. 23–52. Chapter 2. [Google Scholar]
  • 47.Schein E. Equine babesiosis. In: Ristic M., editor. Babesiosis of Domestic Animals and Man. CRC Press; Boca Raton, FL, USA: 1988. pp. 197–208. Chapter 12. [Google Scholar]
  • 48.Nardini R., Trotta M., Mannelli A., Ebani V.V., Rocchigiani G., Papini R., Poli A., Perego R. Comparison of direct and indirect methods to maximise the detection of Babesia caballi and Theileria equi infections in Central Southern Italy. Ticks Tick Borne Dis. 2022;13:101939. doi: 10.1016/j.ttbdis.2022.101939. [DOI] [PubMed] [Google Scholar]
  • 49.Ministry of Agriculture and Forestry, Türkiye [(accessed on 10 July 2025)]; Available online: https://www.tarimorman.gov.tr/GKGM/Belgeler/Veteriner%20Hizmetleri/SaglikSertifikasi/ithalat/01_ab_disi_gecici_at_sertifikasi.pdf.
  • 50.Rothschild C.M. Equine piroplasmosis. J. Equine Vet. Sci. 2013;33:497–508. doi: 10.1016/j.jevs.2013.03.189. [DOI] [Google Scholar]
  • 51.Onyiche T.E., Suganuma K., Igarashi I., Yokoyama N., Xuan X., Thekisoe O. A Review on equine piroplasmosis: Epidemiology, vector ecology, risk factors, host immunity, diagnosis and control. Int. J. Environ. Res. Public Health. 2019;16:1736. doi: 10.3390/ijerph16101736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ogunremi O., Halbert G., Mainar-Jaime R., Benjamin J., Pfister K., Lopez-Rebollar L., Georgiadis M.P. Accuracy of an indirect fluorescent-antibody test and of a complement-fixation test for the diagnosis of Babesia caballi in field samples from horses. Prev. Vet. Med. 2008;83:41–51. doi: 10.1016/j.prevetmed.2007.06.009. [DOI] [PubMed] [Google Scholar]
  • 53.Montes Cortés M.G., Fernández–García J.L., Habela Martínez–Estéllez M.Á. A multinested PCR for detection of the equine piroplasmids Babesia caballi and Theileria equi. Ticks Tick-Borne Dis. 2019;10:305–313. doi: 10.1016/j.ttbdis.2018.11.008. [DOI] [PubMed] [Google Scholar]
  • 54.Braga M.d.S.C.d.O., Costa F.N., Gomes D.R.M., Xavier D.R., André M.R., Gonçalves L.R., Freschi C.R., Machado R.Z. Genetic diversity of piroplasmids species in equids from island of São Luís, northeastern Brazil. Rev. Bras. Parasitol. Vet. 2017;26:331–339. doi: 10.1590/s1984-29612017046. [DOI] [PubMed] [Google Scholar]
  • 55.Coultous R.M., Racz C., Wakeel R.A., Sutton D.G.M., Coumbe K., Wood J.L.N., Newton J.R. Equine piroplasmosis status in the UK: An assessment of laboratory diagnostic submissions and techniques. Vet. Rec. 2019;184:95. doi: 10.1136/vr.104855. [DOI] [PubMed] [Google Scholar]
  • 56.Güçlü H.Z., Karaer K.Z. Ankara yöresinde sportif ve gösteri amaçlı yetiştirilen atlarda Babesia caballi (Nuttall, 1910) ve Theileria equi polimeraz zincir reaksiyonu ile araştırılması. Türkiye Parazitol. Derg. 2007;31:89–93. [PubMed] [Google Scholar]
  • 57.Kizilarslan F., Yildirim A., Duzlu O., Inci A., Onder Z., Ciloglu A. Molecular detection and characterization of Theileria equi and Babesia caballi in horses (Equus ferus caballus) in Turkey. J. Equine Veter Sci. 2015;35:830–835. doi: 10.1016/j.jevs.2015.08.002. [DOI] [Google Scholar]
  • 58.Guven E., Avcioglu H., Deniz A., Balkaya I., Abay U., Yavuz Ş., Akyüz M. Prevalence and molecular characterization of Theileria equi and Babesia caballi in jereed horses in Erzurum, Turkey. Acta Parasitol. 2017;62:207–213. doi: 10.1515/ap-2017-0025. [DOI] [PubMed] [Google Scholar]
  • 59.Knowles D.P., Kappmeyer L.S., Haney D., Herndon D.R., Fry L.M., Munro J.B., Sears K., Ueti M.W., Wise L.N., Silva M., et al. Discovery of a novel species, Theileria haneyi n. sp., infective to equids, highlights exceptional genomic diversity within the genus Theileria: Implications for apicomplexan parasite surveillance. Int. J. Parasitol. 2018;48:679–690. doi: 10.1016/j.ijpara.2018.03.010. [DOI] [PubMed] [Google Scholar]
  • 60.Bhoora R.V., Collins N.E., Schnittger L., Troskie C., Marumo R., Labuschagne K., Smith R.M., Dalton D.L., Mbizeni S. Molecular genotyping and epidemiology of equine piroplasmids in South Africa. Ticks Tick-Borne Dis. 2020;11:101358. doi: 10.1016/j.ttbdis.2019.101358. [DOI] [PubMed] [Google Scholar]
  • 61.Bhoora R.V., Mbaba T.V., Troskie M., Ackermann R.E., Collins N.E. Quantitative detection of Theileria haneyi in South African horses. Ticks Tick-Borne Dis. 2025;16:102487. doi: 10.1016/j.ttbdis.2025.102487. [DOI] [PubMed] [Google Scholar]
  • 62.Bakirci S., Sarali H., Aydin L., Eren H., Karagenc T. Distribution and seasonal activity of tick species on cattle in the West Aegean Region of Turkey. Exp. Appl. Acarol. 2012;56:165–178. doi: 10.1007/s10493-011-9502-0. [DOI] [PubMed] [Google Scholar]
  • 63.Rüegg S.R., Torgerson P., Deplazes P., Mathis A. Age-dependent dynamics of Theileria equi and Babesia caballi infections in southwest Mongolia based on IFAT and/or PCR prevalence data from domestic horses and ticks. Parasitology. 2007;134:939–947. doi: 10.1017/S0031182007002405. [DOI] [PubMed] [Google Scholar]
  • 64.Kouam M.K., Kantzoura V., Gajadhar A.A., Theis J.H., Papadopoulos E., Theodoropoulos G. Seroprevalence of equine piroplasms and host-related factors associated with infection in Greece. Vet. Parasitol. 2010;169:273–278. doi: 10.1016/j.vetpar.2010.01.011. [DOI] [PubMed] [Google Scholar]
  • 65.Roberts C.W., Walker W., Alexander J. Sex-associated hormones and immunity to protozoan parasites. Clin. Microbiol. Rev. 2001;14:476–488. doi: 10.1128/CMR.14.3.476-488.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Sellau J., Hansen C.S., Gálvez R.I., Linnemann L., Honecker B., Lotter H. Immunological clues to sex differences in parasitic diseases. Trends Parasitol. 2024;40:1029–1041. doi: 10.1016/j.pt.2024.09.006. [DOI] [PubMed] [Google Scholar]
  • 67.Moretti A., Trotta M., D’Alterio N., Di Palo M., Greco A., Fioretti D. Prevalence and diagnosis of Babesia and Theileria infections in horses in Italy: A preliminary study. Vet. J. 2010;184:346–350. doi: 10.1016/j.tvjl.2009.03.021. [DOI] [PubMed] [Google Scholar]
  • 68.Zhang Y., Wang X., Li Q., Chen J., Liu H., Zhao Y., Ma R. Prevalence and genetic diversity of Theileria equi from horses in Xinjiang Uygur Autonomous region, China. Ticks Tick Borne Dis. 2023;14:102193. doi: 10.1016/j.ttbdis.2023.102193. [DOI] [PubMed] [Google Scholar]
  • 69.Giubega S., Vlad A., Pet M., Ioniță M., Popescu M., Munteanu A., Mihalca A.D. Molecular investigations of Babesia caballi from clinically healthy horses in southwestern Romania. Vet. Sci. 2024;11:600. doi: 10.3390/vetsci11120600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Sumbria D., Das Singla L., Sharma A. Theileria equi and Babesia caballi infection of equids in Punjab, India: A serological and molecular survey. Trop. Anim. Health Prod. 2016;48:45–52. doi: 10.1007/s11250-015-0917-1. [DOI] [PubMed] [Google Scholar]
  • 71.Afridi M.J.K., Khan M.N., Ahmad M., Hussain S., Khan A., Muhammad G., Ali Q., Ullah Z. Seroprevalence and risk factors for Theileria equi infection in equines from Khyber Pakhtunkhwa province, Pakistan. Iran. J. Parasitol. 2017;12:597–605. [PMC free article] [PubMed] [Google Scholar]
  • 72.Costa S.C.L., Santos H.F.R., Costa F.B., Oliveira A.M., Barros M.R., Menezes R.C., Silva A.G. Frequency and factors associated with Theileria equi, Babesia caballi and Trypanosoma evansi in equids from Bahia (Northeast Brazil) Rev. Bras. Parasitol. Vet. 2019;28:47–58. doi: 10.1590/s1984-296120180090. [DOI] [PubMed] [Google Scholar]
  • 73.Minervino A.H.H., Marques M.M., Carvalho W.S., Barbosa J.D., Moura J.R., Soares H.S., Silva F.M. Factors associated with the prevalence of antibodies against Theileria equi in equids of Western Pará, Brazil. Transbound. Emerg. Dis. 2020;67((Suppl. S2)):100–105. doi: 10.1111/tbed.13268. [DOI] [PubMed] [Google Scholar]
  • 74.Kumar S., Kumar R., Sugimoto C. A perspective on Theileria equi infections in donkeys. Jpn. J. Vet. Res. 2009;56:171–180. [PubMed] [Google Scholar]
  • 75.Aktas M., Altay K., Dumanli N. Molecular detection and identification of Anaplasma and Ehrlichia species in cattle from Turkey. Ticks Tick Borne Dis. 2011;2:62–65. doi: 10.1016/j.ttbdis.2010.11.002. [DOI] [PubMed] [Google Scholar]
  • 76.Aktas M., Özübek S. Bovine anaplasmosis in Turkey: First laboratory confirmed clinical cases caused by Anaplasma phagocytophilum. Vet. Microbiol. 2015;178:246–251. doi: 10.1016/j.vetmic.2015.05.021. [DOI] [PubMed] [Google Scholar]
  • 77.Hoşgör M., Bilgiç H.B., Bakırcı S., Ünlü A.H., Karagenç T., Eren H. Detection of Anaplasma/Ehrlichia species of cattle and ticks in Aydin Region. Türkiye Parazitol. Derg. 2015;39:291–298. doi: 10.5152/tpd.2015.4525. [DOI] [PubMed] [Google Scholar]
  • 78.Altay K., Dumanlı N., Aktaş M., Özübek S. Doğu Anadolu Bölgesinde koyun ve keçilerde Anaplasma enfeksiyonlarının araştırılması. Kafkas Univ. Vet. Fak. Derg. 2014;20:1–4. doi: 10.9775/kvfd.2013.9189. [DOI] [Google Scholar]
  • 79.Öter K., Çetinkaya H., Vuruşaner C., Toparlak M., Ergünay K. Türkiye’nin Trakya bölgesindeki küçük ruminantlarda görülen Anaplasma türlerinin moleküler yöntemlerle tespiti ve tiplendirmesi. Kafkas Univ. Vet. Fak. Derg. 2016;22:133–138. doi: 10.9775/kvfd.2015.14075. [DOI] [Google Scholar]
  • 80.Zhou M., Cao S., Sevinc F., Sevinc M., Ceylan O., Ekici S., Jirapattharasate C., Moumouni P.F.A., Liu M., Wang G., et al. Molecular detection and genetic characterization of Babesia, Theileria and Anaplasma amongst apparently healthy sheep and goats in the central region of Turkey. Ticks Tick Borne Dis. 2017;8:246–252. doi: 10.1016/j.ttbdis.2016.11.006. [DOI] [PubMed] [Google Scholar]
  • 81.Bilgic H.B., Bakırcı S., Kose O., Unlu A.H., Hacılarlıoglu S., Eren H., Weir W., Karagenc T. Prevalence of tick-borne haemoparasites in small ruminants in Turkey and diagnostic sensitivity of single-PCR and RLB. Parasites Vectors. 2017;10:211. doi: 10.1186/s13071-017-2151-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Çetinkaya H., Matur E., Akyazi İ., Ekiz E.E., Aydin L., Toparlak M. Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of Turkey. Ticks Tick Borne Dis. 2016;7:706–714. doi: 10.1016/j.ttbdis.2016.02.021. [DOI] [PubMed] [Google Scholar]
  • 83.Yamazaki A., Suganuma K., Kayano M., Acosta T.J., Saitoh T., Inoue N. Risk factors for equine trypanosomosis and hematological analysis of horses in Paraguay. Acta Tropica. 2022;233:106543. doi: 10.1016/j.actatropica.2022.106543. [DOI] [PubMed] [Google Scholar]
  • 84.Ereqat S., Nasereddin A., Al-Jawabreh A., Al-Jawabreh H., Al-Laham N., Abdeen Z. Prevalence of Trypanosoma evansi in livestock in Palestine. Parasit Vectors. 2020;13:21. doi: 10.1186/s13071-020-3894-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Javanshir A., Tavassoli M., Esmaeilnejad B. Morphological, serological, molecular detection, and phylogenetic analysis of Trypanosoma evansi in horses of different regions in Iran. Parasitol. Res. 2023;122:1873–1881. doi: 10.1007/s00436-023-07888-2. [DOI] [PubMed] [Google Scholar]
  • 86.Akhoundi M., Kuhls K., Cannet A., Votýpka J., Marty P., Delaunay P., Sereno D. A historical overview of the classification, evolution, and dispersion of Leishmania parasites and sandflies. PLoS Negl. Trop. Dis. 2016;10:e0004349. doi: 10.1371/journal.pntd.0004349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Koehler K., Stechele M., Hetzel U., Domingo M., Schönian G., Zahner H., Burkhardt E. Cutaneous leishmaniosis in a horse in southern Germany caused by Leishmania infantum. Vet. Parasitol. 2002;109:9–17. doi: 10.1016/S0304-4017(02)00246-7. [DOI] [PubMed] [Google Scholar]
  • 88.Karakuş M., Arserim S.K., Kasap Ö.E., Pekağırbaş M., Aküzüm D., Alten B., Toz S., Özbel Y. Vector and reservoir surveillance study in a canine and human leishmaniasis endemic area in most western part of Turkey, Karaburun. Acta Trop. 2019;190:177–182. doi: 10.1016/j.actatropica.2018.11.020. [DOI] [PubMed] [Google Scholar]
  • 89.Bakırcı S., Bilgiç H.B., Köse O., Aksulu A., Hacılarlıoğlu S., Erdoğan H., Karagenç T. Molecular and seroprevalence of canine visceral leishmaniasis in West Anatolia, Turkey. Turk. J. Vet. Anim. Sci. 2016;40:637–644. doi: 10.3906/vet-1508-73. [DOI] [Google Scholar]
  • 90.Schäfer I., Silaghi C., Fischer S., Marsboom C., Hendrickx G., Gehlen H., Müller E. Detection of Anaplasma phagocytophilum in horses from Germany by molecular and serological testing (2008–2021) Vet. Parasitol. 2022;312:109840. doi: 10.1016/j.vetpar.2022.109840. [DOI] [PubMed] [Google Scholar]
  • 91.WOAH Terrestrial Manual, Chapter 3.1.21. Surra in All Species (Trypanosoma evansi Infection). Report of the Meeting of the WOAH Terrestrial Animal Health Standards Commission. 2021. [(accessed on 15 August 2025)]. pp. 4–5. Available online: https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.01.21_SURRA_TRYPANO.pdf.
  • 92.Kocan K.M., Blouin E.F., Barbet A.F. Anaplasmosis control. Past, present, and future. Ann. N. Y. Acad. Sci. 2000;916:501–509. doi: 10.1111/j.1749-6632.2000.tb05329.x. [DOI] [PubMed] [Google Scholar]
  • 93.Rubel W., Ganter M., Bauer B.U. Detection of Anaplasma phagocytophilum in ovine serum samples—A retrospective study. Ruminants. 2022;2:351–359. doi: 10.3390/ruminants2030024. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

vetsci-12-00826-s001.zip (150.5KB, zip)

Data Availability Statement

Dataset available on request from the authors.


Articles from Veterinary Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES