Development of loop mediated isothermal amplification assay for rapid detection and its comparison with PCR techniques for Ancylostoma duodenale

Abstract

Hookworm infections, primarily affecting children and pregnant women are major health concern. As part of global efforts to eradicate neglected tropical diseases (NTDs) through mass chemotherapy, reliable diagnostic methods are urgently needed as regions work towards elimination. In this study, we have developed a LAMP-based method to detect hookworm infection in faecal samples. The primers, tailored for the LAMP assay, were designed targeting ITS-1 region of Ancylostoma duodenale using Primer Explorer version 5. Five hundred (500) human stool samples were subjected to microscopy and DNA extraction simultaneously, followed by conventional PCR, real-time PCR and LAMP amplification. The specificity, sensitivity and inter-rater agreement of all assays were evaluated using MedCalc software taking real-time PCR as gold standard. The newly devised LAMP method successfully identified A. duodenale DNA in fecal samples in less than 40 min. It demonstrated perfect specificity (100%), with no instances of cross-reactivity. The LAMP assay achieved a sensitivity of 87.8%, 83.7% for conventional PCR and 59% for microscopy with 100% specificity for all methods. The newly developed LAMP assay represents a suitable diagnostic approach for identifying A. duodenale DNA in human stool samples due to its simplicity, affordability, sensitivity, specificity and potential for field applicability.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-93995-2.

Introduction

Hookworm infection ranks among the prevalent neglected tropical diseases, primarily occurring in tropical and subtropical regions. It impacts approximately 471.8 million individuals globally, leading to gastrointestinal disturbance and iron deficiency anemia^1,2. Soil-transmitted helminthiasis (STH), such as Trichuris trichiura, Ascaris lumbricoides, Strongyloides stercoralis and hookworms (Ancylostoma duodenale and Necator americanus) are some of the most prevalent infections globally. India bears the heaviest burden of STH, accounting for around 25% of the worldwide load^3,4. Although there has been a notable global reduction in the prevalence of Ascaris (a 25.5% decrease since 1990), the decline for Trichurishas been more modest (11.6%), and even smaller for hookworm (5.1%)⁵. Current efforts to manage the morbidity associated with these intestinal parasites focus on mass deworming programs targeting preschool and school-aged children. These programs administer benzimidazole-based drugs, such as albendazole and mebendazole, to all schoolchildren regardless of infection status^6–8. However, the exact effectiveness of these deworming programs remains unclear⁹.

Accurate diagnosis of STH infections is essential for developing effective prevention and control measures and guiding policies such as mass deworming programs. Presently, diagnostic methods predominantly involve conventional techniques, including the faecal larval culture, concentration methods and Kato-Katz method. The Kato-Katz technique is widely utilized for diagnosing and monitoring STH infections because of its affordability and portability, making it particularly advantageous in resource constrained settings. Nevertheless, its sensitivity diminishes when detecting infections of very low intensity¹⁰, and it cannot distinguish between different hookworm species because of similar egg morphology. Speciation of hookworm is crucial as clinical implications vary; A. duodenale leads to significant blood loss, ranging from 0.05 to 0.3 mL per worm/day, whereas N. americanusis linked to a lower blood loss of 0.01 to 0.04 mL per worm/day. Additionally, it is less effective for detecting hookworm infections because fragile hookworm eggs degrade quickly within two hours^11–13. The labour-intensive nature of the Kato-Katz method further reduces its effectiveness for hookworm detection. The larvae culture technique is a traditional but labour-intensive method for species identification based on differences in the filariform larvae of hookworm species, but it depends heavily on the larvae’s survival in stool samples and requires skilled operators and takes time^14–16. As a result, there is a pressing demand for novel diagnostic techniques that offer high sensitivity and specificity in detecting hookworm infections and distinguishing between species¹⁷.

Molecular diagnostics are an effective method for detecting hookworm infections in faecal samples. DNA-based diagnostic testing using conventional PCR, real-time PCR and loop mediated isothermal amplification (LAMP) provides an ideal means for the species-specific and sensitive detection of STH infection. Various gene targets, such as internal transcribed spacer region (ITS-1), Cytochrome oxidase 1, and β-tubulin, have been identified for hookworm detection, although their sensitivity and specificity vary^18–20. The ITS-1 region is a highly sensitive target for detecting and identifying hookworm species. LAMP is particularly advantageous in resource-limited settings due to its affordability, speed, simplicity, and ease of use, as it operates without the need for advanced thermal cyclers (as in PCR) or prior denaturation steps, completing the entire process in a single stage. Compared to other molecular methods, LAMP demonstrates higher sensitivity and specificity^21–23. In recent years, several studies have developed LAMP assays for the detection of various STH infections; however, to the best of our knowledge, this is the first study to develop a LAMP assay for A. duodenale. Furthermore, the sensitivity thresholds of microscopy, conventional PCR, real-time PCR, and LAMP for identifying A. duodenale infection were evaluated.

Materials and methods

Study approval and ethical consideration

The study, a cross-sectional analysis, received approval from the scientific and ethics committee at the Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh (IEC-INT/2022/PhD-849). Informed written consent or assent was obtained from all participants, along with consent from the parents or guardians of children. Stool samples (all age groups) were collected from a nearby rural area of Chandigarh and some samples were collected from the lab of department of medical parasitology, PGIMER, Chandigarh. Participants were randomly selected since STH infection is largely asymptomatic. All participants diagnosed with hookworm, or any other STH infection were advised to receive treatment with a 400 mg single dose of albendazole. All the experiments were performed in accordance with standard guidelines and regulations.

Stool sample collection and parasitological examination

Every enrolled participant submitted a stool sample in a sealed plastic container. These samples were then transported to the laboratory within two hours of collection. In the laboratory, Kato-Katz slides were prepared in duplicate using the standard protocol. Additionally, concentration method (Mini Parasep SF, catalogue no.108920) was performed and samples examined using microscopy within one hour of preparation.

DNA extraction

For molecular assays, DNA was extracted from all faecal samples utilizing the QIAamp Fast DNA stool minikit (Cat. No. /ID: 51604, QIAGEN, Hilden, Germany). Additionally, DNA was extracted from an adult hookworm for limit of detection assay. DNA was also extracted from stool sample spiked with 10 cultured rhabditiform larvae for limit of detection assay using QIAGEN kit Hilden, Germany. The ITS-1 gene of A.duodenale was cloned into pDrive Vector using QIAGEN PCR Cloning Kit (Cat. No. 231124) serving as a positive control.

Bioinformatic analysis and primer design for LAMP assay

The ITS-1 gene was chosen for amplification due to its relatively low mutation rates and considerable interspecies variation. Sequences were retrieved from the GenBank database online at “https://www.ncbi.nlm.nih.gov/genbank/”. A total of eight sequences (Accession numbers EU344797.1, KC896800.1, MK271367.1, KU996390.1, KU996373.1, KU996372.1, KU996371.1, and KU996370.1) were aligned using the Clustal Omega program from the European Bioinformatics Institute (https://www.ebi.ac.uk/Tools/msa/clustalo/). From this alignment, a consensus sequence containing the conserved regions of the ITS-1 gene was generated. Real-time LAMP primers were designed using Primer Explorer version 5.0 software (“https://primerexplorer.jp/e/index.html”). Several primer sets were designed and assessed using the Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The analysis confirmed that the primer set adhered to the criteria specified in the referenced source⁶and demonstrated the specificity of each primer⁷. The selected oligonucleotides were then synthesized commercially to meet high-performance liquid chromatography (HPLC) grade standards.

Primers for conventional PCR and real-time PCR

The primers for conventional PCR and real-time PCR targeting ITS-1 gene were selected from previously published studies^24,25and for internal control β-actin gene was targeted²⁶, given in Table 1.

Table 1.

Sets of oligonucleotides used for conventional PCR and real-time PCR.

Method	Primers	Amplicon size	References
Conventional PCR	“Forward: 5´-GAT GAG CAT TGC WTG AAT GCC G-3´ Reverse: 5´-GCA AGT RCC GTT CGA CAA ACA G-3”	380 bp (A.duodenale) 480 bp (N.americanus)	24
Real-time PCR	“A.duodenale -Forward- 5’- GTATTTCACTCATATGATCGAGTGTTC − 3’ 5’- Reverse- GTTTGAATTTGAGGTATTTCGACCA − 3’ Probe- 5’- /56-FAM/TGACAGTG T/ZEN/ GTCATACTGTGGA AA/3IABkFQ/ −3’ N.americanus- Forward- 5’- CCAGAATCGCCACAAATTGTAT − 3’ Reverse 5’- GGGTTTGAGGCTTATCATAAAGAA − 3’ Probe- 5’- /56-FAM/CCCGATTT G/ZEN/ AGCTGAATTGTCA AA/3IABkFQ/ −3”		25
Real-time PCR (Housekeeping gene- β-actin gene)	“Forward- CCATCTACGAGGGGTATG Reveres- GGTGAGGATCTTCATGAGGTA Probe- 56-JOE/CCTGCGTCTGGACCTGGCTG/[3BHQ1]”	92 bp	26

Optimization of the real-time LAMP, conventional PCR and real-time PCR conditions

Real-time LAMP

We conducted trials using various sets of primers targeting ITS-1 region. Initially, we examined different proportions of outer to inner primers, including ratios of 1:2, 1:4, 1:6, and 1:8, then 2 µl of loop primers were added in each reaction. Subsequently, we tested several time intervals ranging from 15 min to 1 h, while maintaining a consistent DNA concentration and fixed primer ratio. Additionally, we optimized the optimal incubation temperatures for each time interval, varying between 56 °C and 63 °C, based on the primer’s base composition, recommended melting temperature (Tm) of 63 °C for each primer with 1:4 ratio of primers²⁷. All experiments were conducted using the Genie II Detection System (OptiGene Ltd., Horsham, UK). All experiments were conducted in duplicate. Detailed reaction information of LAMP assay is given in Supporting information document 1.

Conventional PCR

To optimize the reaction for each pair of species-specific primers²⁴, conventional PCR was conducted using a Promega GoTaq Master Mix a mix. Comprehensive reaction details of the conventional PCR are provided in the Supporting Information document 1.

Real-time PCR

The primers were optimized²⁵ for annealing at a temperature range of 50 °C to 65 °C using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The detailed reaction and PCR conditions are given in Supporting Information document 1. Real-time PCR was used as the reference test for comparison of various other tests performed in this study including LAMP assay.

Specificity of the real-time LAMP, conventional PCR, and Real-time PCR methods

To assess specificity of the real-time LAMP, conventional PCR, and real-time PCR, DNA extracted from stool samples positive for Ascaris lumbricoides, Trichuris trichiura, Necator americanus, Giardia lamblia, Strongyloides stercoralis and Entamoeba histolytica were used. Double-distilled water (ddH2O) was included as a negative control.

Limit of detection (LOD) of the real-time LAMP, conventional PCR, and Real-time PCR techniques

The LOD of the newly developed real-time LAMP method was compared to that of conventional PCR and real-time PCR. The primers used for the real-time LAMP method are listed in Table 2, while those for the other two assays are detailed in Table 1. Serial dilutions of A. duodenale adult hookworm DNA (DNA concentration ranging from 6 nanogram to 6 attogram) and 10 serial dilutions of DNA from stool samples spiked with 10 rhabditiform larvae (DNA concentration ranging from 35 ng to 35 ag) were used for limit of detection assay, with double-distilled water (ddH2O) serving as a negative control.

Table 2.

Number of A.duodenale positive samples with all techniques.

S no.	Microscopic method (Kato-Katz, Concentration method)	Conventional PCR	Real-time PCR	Real-time LAMP	Total
1	+	+	+	+	8
2	+	-	+	+	1
3	+	-	+	-	2
4	-	+	+	+	21
5	-	-	+	+	1
6	-	-	+	-	3
7	-	-	-	-	464
Total	11	29	36	31	500

Statistical analysis

2.9.1 The data were reviewed for completeness and then entered in Microsoft Excel. The performance of all tests was assessed using the equations found in “Statistical Guidance on Reporting Results from Studies Evaluating Diagnostic Tests”²⁸ (checklist given in supporting information document 2) and calculated sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) in comparison to both microscopy and real-time PCR results using MedCalc software (https://www.medcalc.org/calc/kappa.php Version 23.1.6). Additionally, the Kappa value was determined to evaluate the strength of agreement between “microscopy and real-time PCR”, “conventional PCR and real-time PCR” and “real-time LAMP and real-time PCR”. The Kappa value was interpreted as follows: 0 indicating no agreement, 0.01–0.20 as slight, 0.21–0.40 as fair, 0.41–0.60 as moderate, 0.61–0.80 as substantial, and 0.81–1.00 as almost perfect agreement.

Results

Stool sample collection, parasitological examination

Stool samples were collected from 500 individuals of all age groups and analysed for STHs by microscopy. Using microscopy, total prevalence of the STHs among participants examined was 7% (35/500), with prevalence of hookworm infection being 2.4% (12/500). All samples were subjected to molecular analysis using conventional PCR, real-time PCR and real-time LAMP. The hookworm positivity by molecular techniques was found to be 7.4% (37/500) and predominant species was A. duodenale (36/500) and only 1/500 was N. americanus. Conventional PCR detected 30 hookworms (A. duodenale,29; N. americanus,1), real-time PCR detected 37 (A. duodenale, 36; N. americanus,1) and real-time LAMP detected 32 (A. duodenale, 31; N. americanus,1) (Table 2). Since this study focuses on A. duodenale infection, we have excluded the N. americanus sample for further analysis.

Primer design for LAMP assay

The primers used in this study were designed targeting a conserved region of the ITS-1 gene of A. duodenale. A multiple sequence alignment, which included 8 sequences from various isolates, revealed a strong conservation among the sequences from different global regions (Fig. 1). Furthermore, the proposed oligonucleotides met the necessary criteria for the LAMP test. The sequences of these oligonucleotides are provided in Table 3.

Fig. 1.

A multiple sequence alignment was performed on a conserved region of the ITS-1 gene of A. duodenale as reported in GenBank. The asterisks (*) indicate the conserved regions.

Table 3.

Set of primers designed for amplification of A. duodenale by real-time LAMP method.

Primers	Sequences (5’ →3’)
FIP	GCCGTCACCCAGTAACGACTCT-CCCCCCGTTATAGCCCTA
BIP	GCTGTGCGAAGTTCGCGTTTC-AGCAGTAAGGCGGCATTC
F3	GTCGGGAAGGTTGGGAGTA
B3	ATGCTCAACCACCAACACA
LF	GCTGCACATAGACACCTTACG
LB	GAGCTTTAGACTTGATGAGCATTGC

Optimization of conditions for Real-time LAMP, conventional PCR, and Real-time PCR

Real-time LAMP

Following multiple optimization trials, the subsequent LAMP reaction conditions were established. Specified components of LAMP reaction- 12.5 µl isothermal master mix, 1.6 µl of primer mix (FIP, BIP, B3, F3, LF and LR) in a ratio of 1:4 outer to inner primers, 7.4 µl H₂O and 3.5 µl template (Total-25 µl). The process of amplification occurred at a temperature of 63⁰ C for a duration of 40 min. In optimized assay, hookworm DNA detected between 15 and 30 min. All optimization results are presented in the Supporting Information document 1.

Conventional PCR

PCR was conducted under the following conditions: Denaturation-an initial step at 95 °C (5 min) then 34 cycles of denaturation at 94 °C for 30 s, 58 °C for 1 min (annealing), and 72 °C for 1 min (extension), with a final extension at 72 °C for 5 min. The PCR products were confirmed to be of the correct size (380 bp for A. duodenale and 480 bp for N. americanus) through agarose gel electrophoresis shown in supporting information document 1.

Real-time PCR

The following thermal cycle times were used, 95 °C for 15 min followed by 35 cycles of 95 °C for 15 s and a temperature gradient 60 °C for 1 min (supporting information document 1). Primers and probe concentration in final reaction was optimized at 10 nM.

Specificity of the real-time LAMP, conventional PCR, and Real-time PCR methods

The results showed that in each assay (Figs. 2, 3 and 4) primers which have used in present study did not cross-amplify with other parasite species.

Fig. 2.

Determination of specificity of A.duodenale real-time LAMP using DNA from other parasites, NC-negative control.

Fig. 3.

Determination of specificity of A.duodenale real-time PCR using other parasitic DNA. Necator americanus (Na), Trichuris trichiura (Tt), Strongyloides stercoralis (Ss), Giardia lamblia (Gl), Entamoeba histolytica (Eh) and A. lumbricoides (Al).

Fig. 4.

Determination of specificity of A.duodenale conventional PCR using other parasitic DNA. Lane 1. A.duodenale stool DNA, Lane 2 A.duodenale adultworm DNA, Lane 3- Negative control, Lane 4- N. americanus DNA, Lane 5- A.lumbricoides DNA, Lane 6- T. trichiura DNA, Lane 7- S.stercoralis DNA, Lane 8- E. histolytica DNA, Lane 9- G.lamblia DNA, L- 100 bp Ladder.

Limit of detection of the real-time LAMP, conventional PCR, and Real-time PCR techniques

Real-time LAMP detected DNA from adult A. duodenale up to 60 ag/µl (Fig. 5), real-time PCR detected up to 60 ag/µl (Fig. 6) and conventional PCR detected up to 6 pg/µl (Fig. 7). LAMP assay detected DNA from stool samples spiked with rhabditiform larvae of A. duodenale up to 35 fg/µl (Fig. 8), real-time PCR detected up to 35 fg/µl (Fig. 9) and conventional PCR detected up to 350 fg/µl (Fig. 10). Comparison of LAMP assay findings with other studies is given in Table 4.

Fig. 5.

Determination of limit of detection of A.duodenale real-time LAMP using adult worm DNA at different concentrations (6 ng to 6 ag).

Fig. 6.

Limit of detection by real-time PCR using A. duodenale adult worm (1–6 ng/µl, 2–600 pg/µl, 3–60 pg/µl, 4–6 pg/µl, 5–600 fg/µl, 6–60 fg/µl, 7 − 6 fg/µl, 8- 600 ag/µl, 9–60 ag/µl).

Fig. 7.

Determination of the detection limits of adult worm A. duodenale DNA using conventional PCR. Lane 1 = Positive control, Lane 2 = 6 ng/µl, Lane 3 = 600 pg/µl, Lane 4 = 60 pg/µl, Lane 5 = 100 bp Ladder, Lane 6 = 6 pg/µl, Lane 7 = 600 fg/µl, Lane 8 = 60 fg/µl, Lane 9 = Negative control.

Fig. 8.

Determination of limit of detection of A.duodenale real-time LAMP using rhabditiform larvae spiked stool sample (35 ng to 35 fg).

Fig. 9.

Limit of detection by real-time PCR using A. duodenale using rhabditiform larvae spiked stool sample (1–35 ng/µl, 2–3500 pg/µl, 3–350 pg/µl, 4–35 pg/µl, 5–3500 fg/µl, 6–350 fg/µl, 7–35 fg/µl, 8-negative control).

Fig. 10.

Determination of the detection limits of A. duodenale stool DNA (Rhabditiform larvae spiked sample) using conventional PCR using gel electrophoresis. Lane 1. 100 bp Ladder, Lane 2–35 ng/µl, Lane 3. 3500 pg/µl, Lane 4. 350 pg/µl, Lane 5. 35 pg/µl, Lane 6. 3500 fg/µl, Lane 7. 350 fg/µl, Lane 8. 35 fg/µl, Lane 9. 100 bp Ladder, Lane 10. Negative control.

Table 4.

Detection limit of LAMP assay for various soil transmitted helminths in previous studies.

Parasite	Gene Targeted	Sensitivity (LOD)	Reference
A. lumbricoides	ITS-1	10.8 ng	29
A. lumbricoides	β-tubulin isotype 1	1 pg	30
N.americanus	ITS-2	0.4 fg	22
T.trichiura	ITS-2	98.6 × 10−9 ng/µl (98.6 ag/µl)	21
A. duodenale (using adult worm tissue DNA)	ITS-1	60 ag (6 × 10−8 ng/µl)	Present study
A.duodenale (DNA from stool samples spiked with rhabditiform larvae)	ITS-1	35 fg (35 × 10−6 ng/µl)	Present study

Statistical analysis

Diagnostic performance of conventional PCR, real-time PCR and LAMP assay versus microscopy

The diagnostic accuracy of all methods, using microscopy as the gold standard, is presented in Table 5, with detailed statistical analysis provided in the supporting information document 1. The agreement among all methods compared to microscopy was found to be moderate i.e. 0.45–0.49 (Table 5). The positive predictive value of real-time PCR and LAMP is quite low (30.5–37.93%).

Table 5.

Performance characteristics of various tests for detection of A.duodenale by the MedCalc software taking microscopy as a gold standard.

Methods	Value
Conventional PCR
Sensitivity	78.57%
Specificity	96.45%
Negative predictive value	99.39%
Positive predictive value	37.93%
Kappa value	0.493 (Moderate agreement)
Real-time PCR
Sensitivity	100%
Specificity	95.14%
Negative predictive value	100%
Positive predictive value	30.56%
Kappa value	0.45045 (Moderate agreement)
Real-time LAMP
Sensitivity	84.62%
Specificity	96.07%
Negative predictive value	99.59%
Positive predictive value	35.48%
Kappa value	0.4812 (Moderate agreement)

Diagnostic performance of microscopy, conventional PCR, LAMP assay versus real-time PCR

The diagnostic accuracy of all methods, using real-time PCR as the gold standard, is presented in Table 6, with detailed statistical analysis provided in the supporting information document 1. The agreement between conventional PCR and real-time LAMP was determined to be perfect (0.90–0.92). The agreement with the microscopy method was substantial (0.7). When considering real-time PCR as the gold standard, the real-time LAMP assay demonstrated higher sensitivity, and a superior positive predictive value compared to other methods (Table 6).

Table 6.

Performance characteristics of various tests for detection of A.duodenale by the MedCalc software taking real-time PCR as a gold standard.

Methods	Value
Microscopy
Sensitivity	59.02%
Specificity	100%
Negative predictive value	96.92%
Positive predictive value	100%
Kappa value	0.71794 (Substantial agreement)
Conventional PCR
Sensitivity	83.72%
Specificity	100%
Negative predictive value	98.75%
Positive predictive value	100%
Kappa value	0.90397 (Perfect agreement)
LAMP assay
Sensitivity	87.80%
Specificity	100%
Negative predictive value	99.06%
Positive predictive value	100%
Kappa value	0.92973 (Perfect agreement)

Discussion

Nucleic acid amplifications tests (NAATs) on stool samples have demonstrated higher sensitivity compared to microscopy for detecting hookworm infection, particularly in cases of low worm burdens^31,32. This study presents findings on an in-house developed LAMP for detecting A. duodenale infection.

In the present study, 12 samples were hookworm positive by microscopy and 37 by molecular techniques. The predominant species was A. duodenale and only 1 was N. americanus. In this study, we compared in-house developed LAMP with real-time PCR, conventional PCR and microscopy for detection of A. duodenale infection in human stool samples. To the best of our knowledge, this is the first study to develop and evaluate the LAMP method for detection of A. duodenale infection in humans.

In this study, the detection limits for real-time LAMP and real-time PCR were determined to be 60 ag/µl and 35 fg/µl, respectively, for A. duodenale adult worm DNA and DNA from fecal samples spiked with rhabditiform larvae. These values indicate superior sensitivity compared to conventional PCR, which had detection limits of 6 pg/µl for A. duodenaleadult worm DNA and 350 fg/µl for fecal samples spiked with rhabditiform larvae. A previous study by Pilotte et al., 2016²⁵, reported that real-time PCR consistently detected genomic DNA at concentrations as low as 2 femtograms or even lower. Our conventional PCR findings are consistent with those of Sanprasert et al., 2019³³ who reported a detection limit of 1 pg/µl for hookworm, A. lumbricoides, and S. stercoralis (1 × 10⁻³ ng/µl). Table 4 compares the detection limit of LAMP assay with those reported for other helminth parasites in previous studies.

Interestedly, two samples which were microscopy positive were found negative by conventional PCR and LAMP, but these samples were found positive by real-time PCR as shown in Table 2. Three samples were found positive by real-time PCR but not detected by conventional PCR and LAMP. The variation in sensitivity observed at low concentrations of template DNA could be linked to factors such as the presence of substances inhibiting polymerase activity, DNA adhering to plastic surfaces, and fluctuations in the volume of template added due to random distribution during pipetting³⁴. Other reason for discrepancies between these methods can be attributed to factors such as differences in sample storage conditions as some stool samples were kept at ­20 °C immediately on receipt, while others were kept at room temperature for long duration due to the remote location of certain sampling sites. However, while many of these samples were successfully extracted and amplified, some likely had reduced DNA concentrations. Real-time PCR detected all samples due to its higher sensitivity (probe-based assay can detect minimal quantities of DNA) compared to conventional PCR. LAMP discrepancies may result from variations in reaction conditions, low target concentrations, or the presence of potential inhibitors in stool samples, which can interfere with the binding of outer and inner primers and discrepant results were verified by repeat assays.

As there are many instances of co-infected individuals, molecular approaches are highly helpful for both species identification and co-infection detection³⁵. In all molecular assays, primers utilized were derived from the ITS-1 segment of ribosomal DNA or rDNA^24,25. In this study, these primers exhibited remarkable specificity towards A.duodenale, displaying no cross-reactivity with other prevalent fecal-based helminths and protozoan parasites like “Ascaris lumbricoides, Necator americanus, Trichuris trichiura, Strongyloides stercoralis, Giardia lamblia, and Entamoeba histolytica”. This observation holds significance as many endemic regions often witness concurrent infections of multiple helminths in individuals³⁶. Given their impact on global health, it’s crucial to underscore the significance of precise and species-specific diagnostic techniques for identifying STHs. However, STHs have different life stages (eggs, larvae, and adults), and not all genes are equally expressed across these stages. To address this issue, a study that by Pilotte et al. (2016), analysed repetitive DNA in human STHs using next-generation sequencing and the Galaxy-based Repeat Explorer web²⁵. Their aim to develop species specific a detection assay for STHs based on non-coding repetitive DNA sequences, encountered unique challenges, such as chromosome diminution during early stages of embryonic development, which discards significant portions of highly repetitive, non-coding genomic DNA. As a result, this DNA is absent in post-embryonic somatic cells. Consequently, two separate repeat analyses on distinct library preparations failed to identify repetitive sequences with copy numbers greater than those of ribosomal and mitochondrial targets. Assays targeting repetitive sequences with high copy numbers are essential for enhancing detection sensitivity, as many eukaryotic pathogens contain abundant non-coding repeat DNA elements^37–41. Additionally, many studies have used the ITS-1 region of rDNA for the diagnosis of STHs. For LAMP primer design, this region was selected due to its conserved nature, low mutation rates, and ability to provide species-specific markers, even among closely related species^{21,22,24,29,30}.

Statistical analysis was conducted using MedCalc software (Version 23.1.6, https://www.medcalc.org/calc/kappa.php). In the first type of analysis (Table 5), conventional PCR, real-time PCR, and LAMP were compared against microscopy, which was considered the gold standard. However, the positive predictive value (PPV) obtained in this analysis for molecular tests was inconsistent with findings from previous studies of soil transmitted helminths^{21,22,24,25,29,33}. To address this, a second analysis (Table 6) was performed in which microscopy, conventional PCR, and LAMP results were compared against real-time PCR, treating it as the gold standard. This approach provided a comprehensive evaluation of the sensitivity, specificity, PPV, and NPV of all methods.

To summarize, LAMP has the best sensitivity and specificity as compared to microscopy and conventional PCR. One of the advantages of LAMP assay over real-time PCR and conventional PCR is that LAMP test has proved dependable and has the potential for point of care application in field settings without need of thermocycler. The LAMP method has previously been employed in rural labs within developing regions to detect trypanosomiasis⁴², and asymptomatic malaria⁴³. The strength of the present study lies in its provision of valuable scientific and epidemiological data. This information could play a crucial role in future efforts to control and ultimately eliminate STH infection.

Conclusion

The newly developed LAMP assay represents a suitable diagnostic approach for identifying A. duodenale DNA in human stool samples due to its simplicity, affordability, and less time consuming. To conclude, both real-time PCR and LAMP demonstrate superior specificity and sensitivity compared to conventional PCR and microscopic methods. LAMP, especially, presents advantages for use in field or resource-constrained settings, potentially marking a pivotal moment in A. duodenale infection management.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

LAMP

loop mediated isothermal amplification

FIP

Forward inner primer

BIP

Backward inner primer

F3

Forward outer primer

B3

Backward outer primer

LF & LB

loop forward and backward primer

Author contributions

A- Mamta ThakurB- Abhishek MewaraC- PVM LakshmiD- Sucheta GuleriaE- Sumeeta KhuranaA- Conception of study, Sample collection & processing, Investigation, Experimentation, acquisition of data, analysis and interpretation of data, Draft writing, Final Editing.B- Supervision and review of the study, Revised the manuscript, Final Editing.C- Supervision and review of the study, Conception of study, Sample collection, Revised the manuscript, Final Editing.D-Writing manuscript, analysis, Review.E- Supervision and review of the study, Contributed to conception of study, Investigation, acquisition of data, Validation of results, Revised manuscript, Final Editing.

Funding

This work is funded by ICMR, New Delhi via file no. Zon/69/2022/ECD-II dated 01-03-2023. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The study, a cross-sectional analysis, received approval from the scientific and ethics committee at the Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh (IEC-INT/2022/PhD-849). The committee members have reviewed the study protocol and research proposal thoroughly. Informed written consent was collected from all participants, along with consent from the parents or guardians of child participants.