N-type Ca²⁺ channels mediate the stimuli-dependent α-synuclein secretion in mouse striatum

Abstract

The secretion of α-synuclein from presynaptic terminals is controlled by neuronal activity through a calcium-dependent mechanism. To address the role of voltage gated calcium channels in this process, we used reverse brain microdialysis to monitor α-synuclein release in vivo in the presence of selective channel inhibitors. Our results revealed that the ω-conotoxin GVIA-sensitive N-type calcium channels are the major mediators of stimulated α-synuclein secretion in mouse striatum.

As the major constituent of pathological Lewy inclusions found in Parkinson’s disease (PD), the small presynaptic protein α-synuclein (α-syn) has been thoroughly investigated as a molecular target for therapeutic intervention against neurodegeneration¹. One fundamental impediment in these efforts is the lack of a solid understanding of the physiological function of α-syn and the early steps underlying the transition from normal to abnormal function. In addition to its intracellular function, the presence of α-syn in the extracellular milieu has also been observed under physiological conditions, such as human CSF from healthy individuals, human and mouse brain parenchyma, and conditioned media of primary neurons in culture, thus suggesting a physiological paracrine action of the released protein. In addition, due to the implications of extracellular α-syn for driving disease propagation in PD, the release of misfolded or aggregated α-syn has also been studied. At the cellular level, it is generally accepted that α-syn follows an unconventional Golgi-independent pathway for secretion. Several mechanisms have been proposed for the export of either normally present or pathological α-syn including endosomal/lysosomal exocytosis mediated by the chaperone DNAJC5/CSPα^2,3 and SNARE proteins^4,5, exosomes^6,7 and membrane nanotubes^8,9. Whether normal and aberrant α conformers share the same secretory mechanism is still under investigation.

The mechanism of α-syn release has also been studied in the mouse brain in the context of intact neuronal networks^5,10,11. In all cases, the export of α-syn from neurons in vitro and in vivo is dependent on intracellular calcium and neuronal activity. Stimulation of neuronal activity can spontaneously increase extracellular α-syn levels which then return to steady state levels upon removal of the stimuli suggesting that the secretory pathway of α-syn release is tightly controlled under physiological conditions. Therefore, the mechanism of α-syn release seems to be fundamental for neuronal homeostasis; aberrantly increased secretion may lead to gradual accumulation and propagation of synuclein pathology in interconnected areas of the brain, whereas aberrantly reduced secretion may dysregulate the paracrine function of the protein.

α-syn is released from neuronal cells in a calcium-dependent manner, possibly via the operation of presynaptic Voltage-Gated Ca²⁺ Channels (VGCCs)^6,12. VGCCs are classified into high-voltage-activated channels consisting of Ca_v1.1-1.4 (L-type), Ca_v2.1 (P/Q-type), Ca_v2.2 (N-type) and Ca_v2.3 (R-type) VGCCs, and low-voltage-activated channels consisting of Ca_v3.1–3.3, known as T-type VGCCs. VGCCs are widely expressed in the brain and regulate calcium influx to control fundamental processes such as neurotransmitter release, neurite outgrowth and hormone secretion. Dysfunctional VGCC activity has been linked with several neurodegenerative disorders, including PD¹³.

Our previous work indicated that α-syn is secreted from glutamatergic terminals through an intercellular mechanism tightly regulated by the neurotransmitter GABA, which is modulated through the operation of SUR1-K_ATP channels on GABAergic neurons¹⁰. According to this mechanism, α-syn release could be stimulated by agents that cause robust [Ca²⁺]i rises and rely on the operation of GABA_B receptors coupled with Ca²⁺ channels, suggesting the participation of VGCCs in the secretory process. Here, we used reverse brain microdialysis to trigger α-syn release in vivo through the pharmacological opening of SUR1-K_ATP channels. Coupling this approach with specific VGCC inhibitors allowed the identification of the N-type Ca_v2.2 VGCCs as key mediators of α-syn release in the mouse striatum. Our results verify the involvement of VGCCs in PD and highlight their potential as therapeutic targets, since VGCC-targeted drugs already approved for other conditions¹⁴ may be repurposed for synucleinopathies.

Due to the functional heterogeneity of VGCCs in the brain, we initially investigated the involvement of VGCCs in α-syn secretion using mouse embryonic primary neurons as a more homogeneous cellular model of α-syn expression and release. Cortical and striatal neurons were used at 12 days in vitro (DIV) to ensure high levels of endogenous α-syn expression as depicted by immunostaining (Supplementary Fig. 1a). However, cortical neurons expressed four times higher levels of the protein compared to striatal neurons and were selected for our next experiments (Supplementary Fig. 1b). The ability of cortical neurons to acutely respond to KCl stimulation was assessed by live calcium imaging using the intracellular calcium indicator Fura-2AM (Supplementary Fig. 1c, d). Quantification of α-syn concentration in the conditioned medium (CM) before and after application of KCl showed a robust increase of extracellular α-syn indicating that these neurons could release α-syn in response to KCl-induced depolarization (Fig. 1a) in accordance with previous studies¹⁰.

Fig. 1. VGCC inhibition decreases α-syn secretion in primary neurons.

a Quantification of secreted α-syn levels in the conditioned medium (CM) of untreated (baseline) and KCl-treated cortical neurons using ELISA (****p < 0.0001, N ≥ 8 independent experiments per condition). b mRNA expression levels of Ca_v1.2, Ca_v2.1, Ca_v2.2, Ca_v2.3, Ca_v3.2 in primary cortical neurons, as measured by qPCR. c–g Quantification of the secreted α-syn collected from the CM of cortical neurons upon application of (c) the P/Q-type inhibitor, ω-Agatoxin, (*p = 0.0451), (d) the N-type blocker, ω-Conotoxin (p = 0.0448, DF = 20), (e) the L-type inhibitor, Nimodipine (*p = 0.0420, DF = 30), (f) the R-type inhibitor, SNX-482 (ns, DF = 11) and (g) the T-type inhibitor, NiCl₂ (ns, DF = 12). In each condition, N ≥ 3 biological replicates. Data are presented as means ± SEM. Statistics were performed by unpaired Student’s t test in (a), by Kruskal–Wallis test followed by Dunnett’s multiple comparisons test in (c) and one-way ANOVA followed by Dunnett’s multiple comparisons test in (d–g).

We performed qPCR to assess the expression of each L-, P/Q-, N-, R- and T-type VGCCs using CACNA1-specific primers. qPCR analysis showed that primary neurons expressed all types of VGCCs and revealed that Ca_v2.2 N-type VGCCs were preferentially expressed in these cells (Fig. 1b). To address the functionality of VGCCs, we applied the well-established selective inhibitors ω-conotoxin GVIA (CTX), ω-agatoxin IVA (ATX), ω-Theraphotoxin-Hg1a or SNX-482 (SNX), Nimodipine (Nim) and NiCl₂, to pharmacologically block N-, P/Q-, R-, L- and T-type VGCCs, respectively. The efficacy of each inhibitor was assessed by measuring the intracellular Ca²⁺ spikes in response to KCl stimulation in the absence or presence of each compound. Elevated extracellular KCl is widely used to achieve depolarization of cultured neurons, presumably, by shifting the equilibrium potential (EK) to more depolarized potentials through the decrease in chemical driving force, without compromising cell viability even after prolonged incubation times^15–17. Our results showed that all inhibitors caused a decrease in F₃₄₀/F₃₈₀ ratio indicating suppression of Ca²⁺ influx (Supplementary Fig. 1e). To investigate the potential involvement of each VGCC in α-syn secretion, primary cortical neurons were treated with three different concentrations of each VGCC inhibitor for 3 h and α-syn in the CM and cell lysates was compared to non-treated controls. We found that ATX, CTX and Nim, significantly reduced extracellular α-syn levels whereas SNX and NiCl₂ had no effect in any of the concentrations tested (Fig. 1c–g). ATX, CTX and Nim suppressed α-syn export in low concentrations to a similar extent (~25%) but had no effect in increasing concentrations. To confirm this unexpected performance, we performed similar experiments in a different cellular system, an established SH-SY5Y cell line of inducible α-syn expression¹⁸. In these cells, which express N- and P/Q type VGCCs (Supplementary Fig. 2a), α-syn is also released in a Ca²⁺-dependent manner^6,19. In a similar fashion to primary cortical neurons, treatment with CTX or ATX reduced the levels of secreted α-syn in low concentrations but had no effect when higher concentrations of each inhibitor were used (Supplementary Fig. 2b, c). Since the low concentrations fall within the reported range of IC₅₀ values for each compound, the observed suppression possibly reflects a selective inhibitory effect suggesting that α-syn secretion in primary neurons can be regulated by VGCC-mediated rises in [Ca²⁺]_i mediated by either P/Q-, N-, and/or L-type VGCCs.

To assess whether these VGCCs could also mediate the release of α-syn in vivo, we used the A53T transgenic mouse model in which the A53T human α-syn is expressed under the prion promoter²⁰. Brain microdialysis experiments have revealed that this over-expression leads to a 3-fold increase in extracellular α-syn levels in the striatal interstitial fluid (ISF) of A53T mice compared to their wild type (Wt) littermates²¹. qPCR quantification of the mRNA levels for each Ca_v subunit in the striatum showed that P/Q-, N-, and L-type VGCCs were similarly expressed in the striatum of Wt and A53T mice (Fig. 2a). Interestingly, Ca_v2.2 N-type VGCCs showed higher expression compared to Ca_v1.2 L- and Ca_v2.1 P/Q- type channels.

Fig. 2. CTX-sensitive N-type VGCCs regulate the DZ-induced α-syn secretion in mouse striatum.

a mRNA levels of VGCCs in mouse striatum as measured by qPCR for the of Ca_v1.2 (p = 0.1815), Ca_v2.1 (p = 0.8614), and Ca_v2.2 (p = 0.6428) in Wt and A53T mice (N ≥ 8 mice per subtype per group). b Experimental timeline of in vivo reverse microdialysis in the striatum of A53T mice. c Changes in ISF α-syn concentration over time following administration of diazoxide (DZ) alone or co-administration of DZ and CTX through the microdialysis probe. A representative experiment is shown. d, f, h Quantification of the % increase in ISF α-syn concentration over the baseline upon administration of DZ and co-administration of DZ with (d) CTX (**p = 0.0086, N = 6 mice per group), (f) ATX (p = 0.5819, N = 5 mice per group) and (h) Nim (p = 0.7447, N = 4 mice per group). e, g, i. Quantification of ISF α-syn concentration before and after application of (e) CTX (p = 0.3533, F = 1.366), (g) ATX (p = 0.818, F = 1.246) or (i) Nim (p = 0.5870, F = 1.605), (N ≥ 4 mice per compound). j Proposed mechanism for the regulatory role of N-type VGCCs in α-syn secretion from neuronal terminals induced by a decrease in GABA levels through (1) VGCC inhibition or (2) opening of K_ATP channels in GABAergic neurons in mouse striatum. In (a, d–i) data are presented as means ± SEM. Statistics in (e–i) by unpaired t test and in (d) by paired t test, ns non-significant.

We pharmacologically blocked each of the P/Q-, N-, and L-type VGCCs in the striatum of freely moving A53T mice and assessed the effects of VGCC inhibition in ISF α-syn levels (Fig. 2b). The A53T transgenic mouse is a well-characterized PD animal model^20,22 and was considered the best choice for our study, since we could not use Wt animals to perform the reverse microdialysis experiments due to technical reasons related to the low ISF α-syn concentration at basal levels. The release of α-syn was triggered by the local administration of diazoxide (DZ), a potent opener of SUR1-K_ATP channels, through the microdialysis probe, as previously described¹⁰. The efficacy of each compound to suppress α-syn release was assessed by measuring ISF α-syn upon DZ induction in the absence and presence of VGCC inhibitors. Hourly microdialysis sampling, including samples during drug infusion, was selected to allow collection of adequate ISF volume for the subsequent α-syn measurement by ELISA. Based on previous experience¹⁰, we anticipated no behavioral effects in the animals following such local drug administration for this period of time. Our results revealed that only the application of CTX significantly prevented the DZ-induced increase of the secreted α-syn whereas ATX and Nim had no effect on ISF α-syn levels (Fig. 2d, f, h). The decrease in DZ-provoked α-syn release observed upon administration of CTX reached approximately 80% suggesting that the N-type VGCCs mediate, at least to a great extent, the stimulated secretion of α-syn in mouse striatum. Administration of CTX, ATX or Nim alone had no effect on the basal ISF levels of α-syn suggesting that the inhibition of α-syn release by CTX was a specific effect (Fig. 2e, g, i). Collectively, these data highlight the N-type VGCCs as potent modulators of α-syn release in vivo and imply that dysfunctional activity of these channels could greatly disturb the extracellular levels of α-syn.

Our previous work elaborated the secretory pathway of α-syn both in vitro, using neuronal cells in culture, and in vivo, in the context of a trans-neuronal network formed by glutamatergic and GABAergic terminals in mouse striatum^6,10. In all the cellular systems studied, our results pointed towards a regulated mechanism for α-syn secretion that is triggered by intracellular Ca²⁺ elevations. In the current study, we have investigated the VGCCs that mediate, at least to a great extent, this stimulus-dependent α-syn secretion in primary neurons and the mouse striatum. Embryonic cortical neurons express high levels of α-syn and are routinely used as an in vitro cell system to recapitulate the events of α-syn production, release and clearance. In this system, three types of VGCCs, P/Q-, N-, and L-type, could drive the increase in [Ca²⁺]_i required for α-syn release. Even though other agents that stimulate neuronal activity have been used to challenge α-syn release in cultured neurons, such as KCl, thapsigargin, glutamate, α-Latrotoxin, rapamycin, and the monoamine oxidase (MAO)-B inhibitor selegiline^11,12,21,23, this is the first report that utilizes VGCC inhibitors and evaluates their effects on extracellular α-syn levels.

In vitro, CTX, ATX and Nim suppressed α-syn release to a similar extent when applied in low concentrations that were within the range of IC₅₀ values reported for each reagent, suggesting a selective effect due to channel inhibition. In higher concentrations, none of the inhibitors affected α-syn secretion. This could be due to compensatory effects from the forced opening of other channels due to massive inactivation of a specific VGCC type or off-target effects of each inhibitor due to the high concentration used. For example, ωCTX GVIA is also an allosteric antagonist of P2X3 and P2X2/X3 ionotropic purinoreceptors²⁴, both expressed in neuronal cells, ωATX IVA can also block glutamate exocytosis^25,26, and Nim can additionally inhibit other VGCCs when applied in higher concentrations, such as Ca_v1.3 and T-type channels¹³. SNX-482 even induced a slight increase in α-syn release that could relate to its impact on A-type K⁺ channels or reflect the presence of R-type channels with different isoforms of α1Ε subunit each exhibiting different pore properties²⁷.

In mouse brain, using brain microdialysis in living A53T transgenic mice to preserve the complex intercellular interactions that are necessary for neuronal function, we found that neurons rely mostly on the operation of CTX-sensitive N-type VGCCs to respond to stimuli that motivates neuronal activity and evokes α-syn release (Fig. 2j). The changes in [Ca²⁺]i caused by CTX administration alone was possibly buffered by active homeostatic mechanisms that maintain the tonic inhibition of N-type VGCCs in presynaptic glutamatergic endings. Since the release of α-syn in the striatum is tightly regulated by the levels of the neurotransmitter GABA, it is possible that changes in VGCC activity on GABAergic neurons directly affect the secretion of α-syn via Ca²⁺-dependent fluctuations on GABA concentration (Fig. 2j). This could be a well-fitted mechanism underlying the constant maintenance of extracellular α-syn levels, since both types of GABAergic neurons in the striatum, medium spiny neurons and interneurons, abundantly express functional L-, N-, and P/Q-type VGCCs. The fact that we did not detect any changes in ISF α-syn upon channel inactivation, could be due to the long administration time (60 min) of VGCC inhibitors in our microdialysis experiments during which, compensatory mechanisms are possibly activated to balance GABA levels thereby masking the direct effects of the inhibitors on α-syn release.

Ca_v2.2 N-type VGCCs are present in the active zone at corticostriatal synapses and contribute significantly to evoked presynaptic Ca²⁺ influx. Their established function includes supporting spontaneous glutamate release and sustaining synaptic transmission during prolonged neuronal activity^28,29. Except for these actions, our study supports a new role of N-type VGCCs in the regulation of α-syn release upon neuronal stimulation thereby providing a mechanism that controls the paracrine mode of action of extracellular α-syn. Even though these distal actions are not entirely clear, the modulation of neurotransmitter release through reorganization of plasma membrane microdomains has been proposed previously³⁰. Alternatively, abnormal release of α-syn could promote local accumulation of the protein and pre-dispose to toxic aggregate formation. Interestingly, the unbalanced activity of presynaptic N-type VGCCs was found to contribute to the selective vulnerability of dopaminergic terminals in the striatum of a PD mouse model, further supporting a critical role of these channels in PD neurodegeneration³¹.

Since corticostriatal terminals are enriched with GABA_B receptors, we anticipate that K_ATP channel opening could also stimulate glutamate release, even though this effect could be diluted by compensatory mechanisms to maintain appropriate glutamate levels. GABA_B receptor modulation can affect glutamate levels directly³² or indirectly by interacting with NMDA, AMPA and mGlu receptors, which are widely distributed. GABA_B receptors are coupled with N- or P-type VGCCs and both CTX and ATX are reported to inhibit glutamate release³².

In sum, our data strongly support a Ca²⁺-dependent mechanism of α-syn release and stress the functional importance of N-type VGCCs, which can be selectively targeted pharmacologically, for the preservation of α-syn physiological function under neurodegenerative conditions. A licensed drug candidate, ziconotide (Prialt; Elan), is already used as a potent analgesic drug for chronic pain by specifically blocking the N-type calcium channels. However, we must stress that Ca_v2.2 VGCCs are abundantly expressed in the CNS, playing a crucial role in the modulation of neurotransmission release. Particularly in the striatum, Ca_v2.2 channels mostly have presynaptic localization in corticostriatal, thalamostriatal and dopaminergic terminals and therefore, the selective Ca_v2.2 channels targeting glutamatergic terminals that are enriched in α-syn will be challenging. In the context of PD, lack of dopamine in the striatum could promote neuronal excitation from glutamatergic terminals, thereby increasing extracellular α-syn levels. However, important information on the physiological paracrine role of extracellular α-syn, whether and to what extent the normally secreted α-syn contributes to the generation of pathology, or whether normal and pathological α-syn conformers share the same secretory mechanism, is still missing. Further work exploring downstream effectors and regulatory molecules involved in the secretion process or delineating the alterations that occur in N-type VGCCs is required to address these questions and decide whether blocking or restoring the activity of N-type VGCCs would benefit PD patients.

Methods

Mice

Both male and female homozygous A53T α-syn transgenic C57BI/C3H mice (A53T Tg, line M83-RRID: IMSR_JAX:004479)²⁰ and Wild-type (Wt) littermates at 6-10 months of age were used. Animals were housed in the animal facility of the Biomedical Research Foundation of the Academy of Athens in a room with a controlled light-dark cycle (12 h light–12 h dark) with unlimited access to food and water. All animal procedures were approved by the National Ethics Committee for Animal Welfare (protocol numbers 2143/14-05-18 and 656899/03-08-21).

Isolation of mouse primary neurons

Brains from mouse embryos at embryonic day 16 (E16) were used as a source for the generation of primary cortical cultures, whereas primary striatal neurons were prepared from E15 embryos. Dissection of cortices or striata was performed under a stereoscope and the tissues were kept in ice cold 1x HBSS (14180, ThermoFisher, Gibco) in 60 cm² cell culture dishes. Tissues dissected from 6–8 embryos were cut into fine pieces and digested in 5 ml of a 20 u/ml papain solution (Papain Sigma P3125, buffered aqueous suspension), which was freshly prepared in HBSS and supplemented with 5mg L-cysteine, adjusted to a pH 7.4 and incubated at 34 °C for 30 min before use. For tissue digestion, HBSS was removed and replaced by the papain solution supplemented with 50 μg/mL DNaseI (DN25, Sigma-Aldrich) and incubated for 30 min at 37 °C. Upon digestion, papain was removed, followed by three washes with DMEM supplemented with 10% FBS and tissues were moved to a 15 ml Falcon tube for trituration. Trituration was performed by gently pipetting the tissue up and down 10 times using a 1 ml tip. Upon each trituration step, the homogenized cell suspension was moved to a new 15 ml Falcon tube and the remaining tissue was further triturated. The homogenate was centrifuged at 1000 x rpm for 5 min and the pellet containing the cells were resuspended in Neurobasal medium (Gibco, Invitrogen), supplemented with 2% B27 supplement (10 ml Gibco, Invitrogen), 0.5 mM L-glutamine (1.25 ml) and 1% penicillin/streptomycin. Trypan blue was used for cell counting, and cells were plated on PDL-coated surfaces and maintained at 37 °C in a humidified 5% CO₂ incubator for 10–12 days.

SH-SY5Y cells

Human neuroblastoma SH-SY5Y cells (purchased from ATCC) were cultured in RPMI 1640 medium containing 10% (v/v) heat-inactivated fetal bovine serum (FBS, Biowest), 1% antibiotic/antimycotic (10,000 units/mL of penicillin, 10,000 μg/mL of streptomycin, and 25 μg/mL of amphotericin B) and 1% L-glutamine. Cells were maintained at 37 °C in a humidified 5% CO₂ environment.

Cell treatments

For the treatments of primary cortical neurons and SH-SY5Y cells that inducibly overexpress α-syn¹⁸, the VGCC inhibitors Nimodipine (N-150, Alomone), ω-agatoxin IVA (synthetic peptide, STA-500, Alomone), ω-conotoxin GVIA (synthetic peptide, C-300, Alomone), ω-Theraphotoxin-Hg1a or SNX-482 (recombinant, produced in E.coli, RTS-500, Alomone) and NiCl₂ (339350, Sigma) were added to cells for 3 h before cell harvesting. This time point was selected to allow accumulation of extracellular α-syn in the conditioned medium since shorter incubation times resulted in non-detectable α-syn levels by our ELISA.

A deprivation period of 16 h, with RPMI + 1% FBS was performed in SH-SY5Y cells, prior to treatment with inhibitors.

Live calcium Imaging

For live-calcium imaging, all procedures were performed in the dark. 12-14 days-in-vitro (DIV) mouse cortical neurons were incubated with 2 μΜ Fura-2AM (F1201, Invitrogen) in conditioned culture medium for 30 min, at 37 °C, followed by removal of Fura-2AM and further incubation in conditioned culture medium for 3 h, at 37 °C. The cells were then incubated with low K⁺/Ca²⁺ buffer (129 mM NaCl, 2 mM CaCl₂, 5 mM KCl,1 mM MgCl₂, 30 mM glucose,1% BSA, 25 mM HEPES) for 45 min at 37 °C. Prior to Ca²⁺ measurements, the cells were washed once with low K⁺/Ca²⁺ buffer and positioned in an inverted microscope (Nikon TE 2000U fluorescence microscope with flat stage) coupled to an intensified CCD camera (PTI-IC200) with the Image Master software package (SN 41N50199-21056). Fluorescence images at 340 and 380 nm excitation and 510 nm emission were obtained before (baseline) and after the addition of 50 mM KCl and the intracellular Ca²⁺ levels before and after depolarization with KCl were measured by the 340/380 nm ratio. To address the effect of the Voltage-gated Calcium Channels (VGCC) inhibitors on calcium influx, each inhibitor was added for 1 min prior to KCl stimulation. Images were acquired every 2 s and image analysis was performed by using the region of interest tool of ImageJ-FIJI software³³. Changes in [Ca²⁺]_i were determined using temporal analyses of single cells to express the data as fluorescence ratios (340 nm/380 nm). Fluorescence peak (Fp) upon KCl-stimulation was normalized to the average baseline fluorescence signal (Fb) (340/380 nm ratio).

Genotyping of A53T mice

DNA extraction was performed from the tail of 15-day-old mice upon overnight incubation in 0.25 ml Extraction Buffer (50 mM Tris/ pH8, 50 mM EDTA, 0.1 M NaCl, 1% SDS) supplemented with 0.4 mg/ml proteinase K, at 55 °C. Remaining hair was removed by centrifugation at 13000 x rpm, at 4 °C and DNA precipitation was achieved using an equal volume of ice-cold isopropanol followed by a 30 min centrifugation step at 4 °C and a subsequent pellet wash with 70% ethanol and a 20 min centrifugation step at 4 °C. The pellet containing the extracted DNA was air-dried and resuspended in water. DNA concentration was measured using a nanodrop (Biotek, SYNERGY H1). To identify Wt from A53T transgenic littermates, a PCR step was performed using specific primers for the Wt (forward: 5’-CTAGGCCACAGAATTGAAAGATCT-3’ and reverse: 5’-GTAGGTGGAAATTCTAGCATCATCC-3’) and A53T (forward: 5’-TGTAGGCTCCAAAACCAAGG-3’ and reverse: 5’-TGTCAGGATCCACAGGCATA-3’). Τo identify homozygous from heterozygous A53T mice, qPCR using TaqMan probes was performed according to JAX protocols (https://www.jax.org/Protocol?stockNumber=004479&protocolID=18858).

Guide cannula implantation and in vivo mouse microdialysis

Guide cannula implantation and reverse microdialysis experiments were performed in the striatum of A53T transgenic mice as previously described^10,21. In brief, mice were kept under constant anesthesia throughout the procedure using an isoflurane anesthesia mask. Administration of Rimadyl (Zoetis), an analgesic and anti-inflammatory drug, was performed subcutaneously prior to the surgical procedure. A small animal stereotaxic apparatus equipped with dual manipulator arms was used for the implantation of a CMA 12 guide cannula to achieve the targeting of the striatum according to the mouse atlas of Paxinos and Franklin (coordinates, AP = +0.5 mm, ML = 22.2 mm, DV = 22.4 mm). The cannula was fixed to the skull with stainless steel screws and dental cement and mice were placed for recovery in individual cages for 72–96 h. For microdialysis experiments, a CMA-12 probe (2 mm, 100 kDa cut-off) was inserted in the guide cannula under mild anesthesia, connected to a CMA 402 pump with a constant flow rate of 0.6 μl/min and mice were placed in a microdialysis cage (CMA 120 System for Freely Moving Animals), with unlimited access to food and water throughout the experimental procedure. Artificial CSF (147 mM NaCl, 2.7 mM KCl, 1.2 mM CaCl₂, 0.85 mM MgCl₂) supplemented with 0.15% bovine serum albumin (BSA) was used as a perfusion fluid. Prior to sample collection, the tubing and probe were equilibrated with the perfusion fluid for 6 h at a flow rate of 0.6 μl/min. Baseline samples were collected every 2 h to a CMA 470 refrigerated fraction collector, overnight, with the same flow rate. 100 μM diazoxide (D9035, Sigma) or VGCC inhibitors (10 μM nimodipine, 10 μΜ ω-agatoxin, 0.5 μΜ ω-conotoxin) or both were delivered through the microdialysis probe for 1 h, followed by hourly fraction collection for 6 h. Samples were stored at −80 °C until analyzed by our in-house ELISA for α-syn.

ELISA for α-syn

The in-house α-syn sandwich ELISA was used as previously described^21,34. In brief, 0.5 μg/ml mouse monoclonal Syn-1 antibody (BD Biosciences) diluted in 100 mM NaHCO₃, pH 9.3 was used to coat white flat-bottom ELISA plates (Corning Costar) for 12–24 h at RT. 3x washes were performed to the wells prior to sample loading with Wash Buffer (50 mM Tris-HCl, 150 mM NaCl and 0.04% Tween-20) and 0.2 or 0.3 μg/μl samples or a standard curve of recombinant α-syn were diluted appropriately in TBST/BSA (10 mM Tris-Cl, pH 7.6, 100 mM NaCl, 0.1% Tween-20 and 1% BSA) in a final volume of 50 μl and incubated at 37 °C, for 2 h, under constant shaking at 700 rpm to achieve antigen binding. Upon three washes, 50μl (10.000x diluted in TBST/BSA) of the capture antibody (rabbit polyclonal C-20, Santa Cruz) was added for 1h at room temperature, followed again by three washes and the addition of an HRP-conjugated rabbit antibody (DAKO) for 30min, at 4 °C, shaking. After three washes, detection was achieved by the addition of 50 μl of chemiluminogenic Femto HRP substrate (ThermoScientific) for 5 min, in the dark, shaking.

RNA extraction and quantitative PCR

Total RNA was extracted from primary cortical neurons or the striata of mice using TRIzol Reagent (15596026, ThermoFisher, Invitrogen™) according to the manufacturer’s instructions, and RNA quality was verified by electrophoresis. 1.5 μg of RNA was used for cDNA synthesis using PrimeScript reverse transcriptase (2680 A, Takara) upon DNase I (2270B, TaKaRa) treatment and qPCR experiments were performed using Kapa SYBR FAST qPCR Master Mix (5515, Kapa Biosystems). Specific primers using a primer designing tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast) were designed for each Mus musculus Ca_v gene as follows: Cacna1c (Cav1.2) forward; ATGCAAGACGCTATGGGCTAT and reverse; CAGGTAGCCTTTGAGATCTTCTTC, Cacna1a (Cav2.1) forward; GGTCACACCTCACAAGTCCAC and reverse; CCAGTCTTCTGGAACATCTCTTG, Cacna1b (Cav2.2) forward; CACTTAGACGAATTCATTCGAGTCT and reverse; TATCATGAGAGCAGCATAGACCTT, Cacna1e (Cav2.3) forward; AAGGTAAAGAAACAGAGACAGCAG and reverse; GTCTGTTACCACCAGAGATTGTTG, Cacna1h (Cav3.2) forward; GCTCTCCCCCGTCTACTTCG and reverse; AGATACTTTGCGCACGACCAGG. For qRT-PCR analysis, quantification of the specific copy number was performed through calibration curves obtained for each gene.

Immunocytochemistry

For immunocytochemistry experiments, 80000 primary cortical or striatal neurons were plated in coverslips pre-coated with 0.1 mg/ml PDL and cells were fixed at 10-12 DIV with 3.7% formaldehyde (104002, Millipore) in PBS for 15 min at room temperature, followed by two washes with PBS. Blocking was achieved by the addition of 10% Normal Goat Serum (NGS), supplemented with 0.1-0.4% Triton-X100 (A4975,1000, AppliChem) in PBS, for 1 h, at RT and cells were incubated with the respective Ca_v antibodies (GTX54754 for anti-Ca_v1.2, GTX54753 for anti-Ca_v2.1, GTX54812 for anti-Ca_v2.2, GTX54756 for anti Ca_v2.3 and GTX54813 for anti-Ca_v3.2 at a dilution of 1:500)^35,36 (Okada et al. Science Advances, 2021; Leandrou et al. 2024) or anti-α-syn (#610787 BD Transductions, 1:500) and the neuronal markers Tuj1 (β3-Tubulin #4466 CST, 1:500) or MAP2 (sc-5359-Santa Cruz, 1:2000) in buffer containing 2% NGS and 0.1% Triton-X100 in PBS for 16 h at 4 °C. Cells were washed and incubated with Alexa Fluor-488/594/647 goat anti-rabbit or anti-mouse IgG (H + L) (Invitrogen) at a dilution of 1:2000 and the nuclear marker Dapi (268298 Merck Millipore) for 2 h in the dark. Since the primary antibodies against Ca_v subunits have not been validated in knock-out tissues, similar immunocytochemistry experiments were performed in SH-SY5Y cells in which VGCCs are abundantly expressed. DAKO Vectashield medium was used for coverslip mounting, and cells were visualized using a SP5-II confocal microscope (Leica).

Immunofluorescence

For brain dissection, mice were transcardially perfused with 50 ml ice cold PBS followed by 50 ml 4% paraformaldehyde (PFA) (D6148, Sigma-Aldrich), using a perfusion peristaltic pump, under isoflurane anesthesia. Upon dissection, brains were post-fixed for 4-6 h with 4% PFA, at 4 °C followed by sequential dehydration with 15% and 30% sucrose and tissue snap freezing in isopentane at a temperature of −45 °C. A Bright cryostat adjusted at 25 μm thickness was used for brain sectioning. For immunofluorescence, sections were incubated in 10 mM citrate buffer, pH 6, for 30 min at 80 °C to achieve antigen retrieval, followed by three washes with PBS. 5% NGS supplemented with 0.1% Triton-X100 in PBS was used as a blocking buffer. Primary antibodies were added in the blocking buffer for 48 h. Sections were washed with PBS and incubated with Alexa Fluor-488/594/647 goat anti-rabbit or anti-mouse IgG (H + L) at a dilution of 1:2000 and the nuclear marker Dapi (1:2000), in blocking buffer, for 2 h in the dark. Following mounting, sections were visualized using a Leica SP5-II confocal microscope.

Confocal microscopy

Fluorescent images were obtained with a Leica SP5-II confocal microscope. 63x water immersion objectives and sequential scanning of each channel were used at a screen resolution of 1024 ×1024 pixels for confocal imaging. Image settings were adjusted over a negative control section that was incubated only with secondary antibodies to subtract non-specific signal and tissue auto-fluorescence. LAS-AF software was used for image acquisition.

Statistical analysis

Data analysis was conducted using GraphPad Prism 6 software. Descriptive statistics were applied to all measurements, and results were presented as mean ± Standard Error of the Mean (SEM). The Shapiro–Wilk test determined whether variables followed a normal distribution. A two-tailed Student’s t test was employed to compare the means of two different groups with normally distributed variables, or a one-way ANOVA followed by Dunnett’s multiple comparisons test to compare the means of more than two independent groups. The significance threshold was set at p < 0.05.

Author contributions

E.L. carried out all the experiments performed in primary neuronal cultures and the in vivo microdialysis experiments. She also drafted the first version of the manuscript. I.C. performed RNA extraction and qPCR experiments. K.V. provided infrastructure and edited the manuscript. E.E. performed data analysis, wrote the manuscript and provided funding for the project. All authors commented on and approved the final version.

Data availability

Source data for all graphs in the figures have been uploaded to Zenodo 10.5281/zenodo.16486489.

Code availability

No codes were used within this study.

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s41531-025-01110-z.