Protocol for triggering plant gene silencing by viral delivery of short RNA

Summary

Virus-induced gene silencing (VIGS) leverages viral vectors to deliver 200–400-nt inserts targeting specific genes. Here, we present a protocol for triggering gene silencing by virus-delivered short RNA inserts (vsRNAi). We describe steps for designing 32-nt vsRNAi that simultaneously target Nicotiana benthamiana homeologous genes involved in chlorophyll biosynthesis and assembling them into JoinTRV, a vector system based on tobacco rattle virus (TRV). This approach results in robust gene silencing phenotypes, including visible leaf yellowing and reduced chlorophyll levels.

For complete details on the use and execution of this protocol, please refer to García et al.¹

Graphical abstract

Highlights

• •Design of virus-delivered short RNA inserts (vsRNAi) to target homeologous genes
• •One-step cloning of 32-nt vsRNAi into JoinTRV, a TRV vector system
• •JoinTRV-mediated expression of vsRNAi for robust gene silencing in Nicotiana benthamiana

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Virus-induced gene silencing (VIGS) leverages viral vectors to deliver 200–400-nt inserts targeting specific genes. Here, we present a protocol for triggering gene silencing by virus-delivered short RNA inserts (vsRNAi). We describe steps for designing 32-nt vsRNAi that simultaneously target Nicotiana benthamiana homeologous genes involved in chlorophyll biosynthesis and assembling them into JoinTRV, a vector system based on tobacco rattle virus (TRV). This approach results in robust gene silencing phenotypes, including visible leaf yellowing and reduced chlorophyll levels.

Before you begin

Plant viruses engineered to activate virus-induced gene silencing (VIGS) can enable on-demand crop trait reprogramming² and crop protection against pests and diseases.^3,4 In VIGS, viral vectors redirect the host RNA interfering machineries to the selective silencing of target genes through the production of gene-specific small RNAs (sRNAs).³ Similar to endogenous sRNAs involved in the regulation of plant gene expression, sizes of sRNAs resulting from VIGS are in the 20–30-nt range and depend on the specific Dicer-like (DCL) RNase involved in substrate cleavage.^5,6,7 VIGS vectors are usually engineered to deliver larger cDNA inserts of 200–400 nt with homology to a target gene.⁸

Vector systems based on tobacco rattle virus (TRV) are largely used in VIGS and virus-induced genome editing assays.^8,9,10,11 Among these, the JoinTRV vector system relies on pLX-TRV1 and pLX-TRV2 for Agrobacterium-mediated delivery (agroinoculation) of TRV genomic components. Based on compact T-DNA binary vectors of the pLX series,¹² pLX-TRV1 provides the viral replicase function, whereas pLX-TRV2 includes an engineered TRV RNA2 sequence with a heterologous sub-genomic promoter of pea early browning virus (PEBV) to drive insert expression.¹³

We recently leveraged N. benthamiana genomics and transcriptomics resources to obtain curated genomic locus annotations, which guided the design of virus-delivered short RNA inserts (vsRNAi) for simultaneous targeting of homeologous gene pairs.¹ Our results showed that quantitative silencing phenotypes could be obtained by use of 24-, 28-, and 32-nt vsRNAi that targeted conserved regions of functionally redundant gene pairs.

Here, we describe a VIGS method in which chemically synthesized DNA oligonucleotide pairs that comprise vsRNAi sequences are inserted by one-step digestion-ligation reactions into the pLX-TRV2 plasmid of JoinTRV (Figure 1). The pLX-TRV2 derivative pLX-TRV2-vCHLI is assembled to express a 32-nt vsRNAi for simultaneously targeting the N. benthamiana magnesium protoporphyrin chelatase subunit I (CHLI) gene pair, which is involved in chlorophyll biosynthesis (Figure 2). Agroinoculation of pLX-TRV2-vCHLI alongside pLX-TRV1 to N. benthamiana plants results in a yellowing phenotype associated to a significant reduction of chlorophyll levels (Figure 3).

Figure 1.

Viral delivery of short RNA inserts triggering gene silencing in Nicotiana benthamiana

In the present protocol, virus-delivered short RNA inserts (vsRNAi) are assembled into pLX-TRV2 of the JoinTRV vector system, which is based on the tobacco rattle virus (TRV). The resulting derivative of pLX-TRV2 is transformed into Agrobacterium cells, along with pLX-TRV1. An Agrobacterium strain that simultaneously hosts both vectors is selected for TRV agroinoculation. A bacterial suspension of this strain is then infiltrated into N. benthamiana plants, leading to the appearance of a gene silencing phenotype. pLX-TRV2 includes the pBBR1 origin and kanamycin resistance (nptI), whereas the compatible vector pLX-TRV1 includes the RK2 origin and gentamicin resistance (aacC1).^12,13

Figure 2.

vsRNAi conservation in N. benthamiana CHLI loci and assembly into pLX-TRV2

(A) A 32-nt vsRNAi sequence is designed to target a region conserved in the N. benthamiana CHLI gene loci. For each of the two homeologs NbL05g17570.1 and NbL10g22050, chromosomal locus positions are shown, and expression and gene structure were confirmed by mapping RNA sequencing reads (Depth).^14,15

(B) Overview of the assembly of vsRNAi into pLX-TRV2 by a one-step digestion-ligation reaction including BsaI and a DNA oligo duplex spanning the vsRNAi sequence. The LacZ reporter allows visual selection of recombinant vectors; vsRNAi expression is driven by the pea early browning virus (PEBV) coat protein (CP) promoter.¹³

(C) Sequence details of the pLX-TRV2 cloning site with the BsaI recognition sites and BsaI-generated overhangs (top), and of the duplex generated by annealing of the oligonucleotide pair vCHLI_F and vCHLI_R (bottom).

Figure 3.

Gene silencing phenotype and chlorophyll levels of N. benthamiana plants inoculated with a 32-nt vsRNAi targeting the CHLI gene pair

(A) Optimal growth stage of N. benthamiana plants for vsRNAi vector agroinoculation (scale = 2 cm).

(B) Leaf yellowing (10 dpi; scale = 2 cm) and chlorophyll levels (mean ± SD; n = 6) of upper-uninoculated leaves of N. benthamiana plants treated with pLX-TRV1 plus pLX-TRV2-vCHLI (vsRNAi), or pLX-TRV1 plus the unmodified pLX-TRV2 (CTRL).

(C) Use of pTRV1 plus pTRV2, a widely used TRV vector system,^8,9 for expression of a 32-nt vsRNAi targeting the CHLI gene pair results in a robust silencing phenotype, which is accompanied by cell death of inoculated area (single arrow) and occasional severe necrosis in upper leaves (double arrows).

Innovation statement

Although endogenous sRNAs and those resulting from VIGS are in the 20–30-nt range, VIGS vectors are engineered to deliver larger inserts of 200–400 nt with homology to a target gene. By leveraging enhanced genomics and transcriptomics resources to obtain curated genomic annotations, vsRNAi are designed to simultaneously target functionally redundant homeologous gene pairs. Vectors based on tobacco rattle virus (TRV) that are engineered to express 32-nt vsRNAi trigger robust gene silencing phenotypes in Nicotiana benthamiana. Simplified cloning of vsRNAi fragments, which are nearly 10-fold smaller than those of conventional approaches and can be synthesized at low cost, remarkably enhances the scalability of VIGS in model and non-model plants.

Biosafety

Bacteria containing recombinant nucleic acid molecules need to be handled and disposed according to institutional regulations. Plant viruses and derived vectors pose potential agronomical and environmental risks; therefore, researchers must comply with governmental and institutional regulations for virus propagation in plants and working with plant infectious agents.

Plants and growth conditions

Timing: 3–4 weeks

Start preparing the plant material three to four weeks in advance as follows.

• 1.Sow N. benthamiana seeds in a well-watered soil mixture (one part of perlite and two parts of potting substrate) and let them germinate in a growth chamber set at 25^oC and long-day conditions (16 h-light/8 h-dark).
• 2.Two weeks after sowing, transfer one seedling to a 12-cm diameter pot filled with the same soil mixture and water them every 2 days to ensure that the soil is humid.

CRITICAL: Avoiding water excess in the tray.

• 3.Two- to three-week-old plants are ideal for agroinoculation of vsRNAi vectors (Figure 3A).

CRITICAL: Inoculation of plants older than 3 weeks may delay the appearance of gene silencing phenotypes. Gene silencing efficiency may be compromised in plants older than 4 weeks of age.⁸

CRITICAL: The quality and age of the plants are essential factors for observing homogeneous symptoms of systemic viral infection and achieving robust gene silencing phenotypes. Healthy plants are obtained only following good practices in a well-conditioned growth chamber, including a disease- and pest-free environment and careful watering.

CRITICAL: The grow rate of plants can vary based on environmental conditions, so empirical adjustments to the watering regime and timing may be necessary.

CRITICAL: Plants can grow at different paces in different environments, therefore following a leaf stage can be more appropriate than an age stage; the optimal leaf stage for agroinoculation of vsRNAi vectors is shown in Figure 3A.

Note: For optimal agroinoculation conditions and time saving, ensure to coordinate the preparation of plants and Agrobacterium strains hosting the viral vectors.

Alternatives: Underutilized Solanaceae crops show favorable features for the deployment of virus-based biotechnologies to assist their functional genomics and breeding¹⁶; for example, vsRNAi approaches are functional in scarlet eggplant (Solanum aethiopicum), a crop mainly cultivated in sub-Saharan Africa and Brazil.¹⁷

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Recombinant DNA
pLX-TRV1	Aragonés et al.9	Addgene Plasmid #180515
pLX-TRV2	Aragonés et al.9	Addgene Plasmid #180516
pLX-TRV2-vCHLI	García et al.1	Addgene Plasmid #239842
Bacterial and virus strains
Escherichia coli DH10B	Pasin18	N/A
Agrobacterium AGL1	Pasin18	N/A
Experimental models: Organisms/strains
Nicotiana benthamiana	Ranawaka et al.19	N/A
Chemicals, peptides, and recombinant proteins
iScript gDNA clear cDNA synthesis kit	Bio-Rad Laboratories	1725035
SsoAdvanced universal SYBR green supermix	Bio-Rad Laboratories	1725271
Tryptone	Condalab	1612
Yeast extract	Condalab	1702
Bacteriological agar	Condalab	1800
Agarose D1 medium EEO	Condalab	8019
FavorPrep plant total RNA mini kit	Favorgen	FAPRK 001
NucleoSpin plasmid kit	Macherey-Nagel	740588.250
BsaI-HFv2 (20 U/μL)	New England Biolabs	R3733S
T4 DNA ligase (400 U/μL)	New England Biolabs	M0202S
Magnesium chloride (MgCl2)	PanReac-AppliChem	131396.1210
Tris(hydroxymethyl)aminomethane (Tris base)	PanReac-AppliChem	A1086
Acetic acid	PanReac-AppliChem	131008.1214
β-mercaptoethanol	PanReac-AppliChem	A1108
Glycerol (87%)	PanReac-AppliChem	A0970
Sodium chloride (NaCl)	PanReac-AppliChem	131659.1211
2-(N-morpholino)ethanesulfonic acid hydrate (MES)	Sigma-Aldrich	M8250
3′,5′-dimethoxy-4-hydroxyacetophenon (acetosyringone	Sigma-Aldrich	D134406
Carbenicillin disodium salt	Sigma-Aldrich	C1389
D(+)-glucose monohydrate	Sigma-Aldrich	104074
Dimethyl sulfoxide (DMSO)	Sigma-Aldrich	D8418
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA)	Sigma-Aldrich	E5134
Gentamicin	Sigma-Aldrich	G1264
Kanamycin	Sigma-Aldrich	K1377
N,N-dimethylformamide	Sigma-Aldrich	D4551
Rifampicin	Sigma-Aldrich	R3501
Sodium hydroxide (NaOH)	Sigma-Aldrich	S5881
5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-Gal)	Thermo Fisher Scientific	B1690
DNase I, RNase-free (1 U/μL)	Thermo Fisher Scientific	EN0521
EcoRI (10 U/μL)	Thermo Fisher Scientific	ER0271
RiboLock RNase inhibitor (40 U/μL)	Thermo Fisher Scientific	EO0381
Cfr9I (XmaI) (10 U/μL)	Thermo Fisher Scientific	ER0171
Liquid nitrogen	N/A	N/A
Oligonucleotides
vCHLI_F TGAAACTTGGGCATGCATTCCAAATCGATCAAGAAG	García et al.1	N/A
vCHLI_R AGAGCTTCTTGATCGATTTGGAATGCATGCCCAAGT	García et al.1	N/A
CHLI_F GGAGGAAGTTTTATGGAGGGATTAG	García et al.1	N/A
CHLI_R GGATCAATTACATTCAGCAAAAGACA	García et al.1	N/A
PP2A_F TGGGGATGGCTCCTGTTTTG	García et al.1	N/A
PP2A_R CTCGCCAATGCCTGTCCTCT	García et al.1	N/A
D3723 ATGCCGACCCGGGCGTAATAACGCTTACG	N/A	N/A
Deposited data
N. benthamiana genome assembly	Ranawaka et al.19	https://solgenomics.net/ftp/genomes/Nicotiana_benthamiana/LAB360/NbLab360.genome.fasta.gz
N. benthamiana genome annotation	Ranawaka et al.19	https://solgenomics.net/ftp/genomes/Nicotiana_benthamiana/LAB360/NbLab360.v103.gff3.CDS.fasta.gz
N. benthamiana transcriptomic and small RNA sequencing reads for vsRNAi and control samples	García et al.1	NCBI BioProject: PRJNA1217923
Other
Cell electroporator	Eppendorf	Eporator
Electroporator 1-mm cuvette	Cell Projects	EP-101
DUALEX optical leaf clip meter	Metos	700256

Materials and equipment

Note: Unless otherwise indicated, standard materials and equipment for molecular biology, bacterial handling and culturing, and for plant maintenance are used.

Note: Unless otherwise indicated, standard molecular cloning reagents and methods²⁰ are used, and materials, solutions, media and buffers are prepared and stored at room temperature (20°C–25°C). Ultrapure water is obtained using a Milli-Q system (Millipore), and autoclave sterilization is done at 121°C (20 min).

Preparation of stock solutions and media

Timing: 1–2 days

• •Kanamycin (50 mg/mL): Dissolve 0.5 g kanamycin powder in 10 mL ultrapure water, sterilize through a 0.2 μm filter, and store 1-mL aliquots at −20°C, for up to 1 year.
• •Gentamicin (30 mg/mL): Dissolve 0.3 g gentamicin powder in 10 mL ultrapure water, sterilize through a 0.2 μm filter, and store 1-mL aliquots at −20°C, for up to 1 year.
• •Carbenicillin (50 mg/mL): Dissolve 0.25 g of carbenicillin disodium salt in 5 mL of ultrapure water, sterilize through a 0.2-μm filter, and store 1-mL aliquots at −20°C for up to 1 year.
• •Rifampicin (50 mg/mL): Dissolve 0.5 g rifampicin powder in 10 mL DMSO, and store 1-mL aliquots at −20°C in the dark, for up to 6 months.
• •Glucose (1 M): Dissolve 9.91 g of D(+)-glucose monohydrate in ultrapure water to a final volume of 50 mL, sterilize through a 0.2-μm filter, and store indefinitely.
• •Glycerol 10%: Mix 10 mL of 87% glycerol with 40 mL of ultrapure water, take the volume up to 87 mL with ultrapure water, and sterilize through a 0.2 μm filter.

Note: Glycerol is a viscous liquid; use reverse pipetting, with slow aspiration and dispensing speeds to reduce pipetting errors.

• •Glycerol for bacterial stocks: Aliquot 0.2 mL of 87% glycerol into 2-mL screw cap tubes, sterilize by autoclaving, and store at room temperature indefinitely.

Note: Glycerol is a viscous liquid; use reverse pipetting, with slow aspiration and dispensing speeds to reduce pipetting errors.

• •X-Gal (40 mg/mL): Dissolve 0.4 g X-Gal powder in 10 mL N, N-dimethylformamide. Store 1-mL aliquots at −20°C in the dark, for up to 6 months.
• •MES pH 5.5 (1 M): Dissolve 9.762 g MES powder in 40 mL ultrapure water, adjust pH to 5.5 with 1 M KOH, take the volume up to 50 mL with ultrapure water, and sterilize through a 0.2 μm filter. Store in the dark, for up to 6 months.
• •MgCl₂ (2 M): Dissolve 9.52 g MgCl₂ in ultrapure water to a final volume of 50 mL, and sterilize through a 0.2 μm filter. Store for up to 1 year.
• •Acetosyringone (0.1 M): Dissolve 98 mg acetosyringone powder in 5 mL DMSO, and store in single-use 150-μL aliquots at −20°C in the dark, for up to 6 months.
• •EDTA (0.5 M): Mix 93.05 g EDTA and 0.4 L distilled water on a magnetic stirrer, adjust pH to 8.0 with ∼10 g NaOH pellets, take the volume up to 0.5 L with distilled water and autoclave. Store for up to 1 year.

Note: EDTA will not go into solution until the solution reach pH ∼8.0.

• •Oligonucleotides: Custom DNA oligonucleotides are purchased desalted after synthesis as 100 μM stock solutions (Integrated DNA Technologies).

Alternatives: Custom DNA oligonucleotides from alternative commercial providers may be used.

• •Media:

Lysogenic broth (LB)

Reagent	Final concentration	Amount
Tryptone	1.0%	10 g
Yeast extract	0.5%	5 g
NaCl	1.0%	10 g
Ultrapure water	─	Up to 1 L
Total	─	1 L

Note: Sterilize by autoclaving, and store indefinitely. Aliquot and supplement antibiotics as needed before use; handle in a microbiological cabinet to prevent contaminations.

LB agar

Reagent	Final concentration	Amount
Tryptone	1.0%	10 g
Yeast extract	0.5%	5 g
NaCl	1.0%	10 g
Bacteriological agar	1.5%	15 g
Ultrapure water	─	Up to 1 L
Total	─	1 L

Note: Sterilize by autoclaving, cool the medium down to ∼50°C–60°C and, in a microbiological cabinet, supplement antibiotics and mix vigorously. Aliquot into petri dishes, and once solidified store at 4°C in the dark.

Note: X-Gal solution can be spread onto LB agar plates before use.

Super optimal broth (SOB)

Reagent	Final concentration	Amount
Tryptone	2.0%	20 g
Yeast extract	0.5%	5 g
NaCl	10.0 mM	0.584 g
KCl	2.5 mM	0.186 g
MgSO4	20.0 mM	2.4 g
Ultrapure water	─	Up to 1 L
Total	─	1 L

Note: Sterilize by autoclaving, and store indefinitely.

Note: Handle in a microbiological cabinet to prevent contaminations.

SOC

Reagent	Final concentration	Amount
SOB	─	9.8 mL
Glucose (1 M)	20 mM	0.2 mL
Total	─	10 mL

Note: Sterilize through a 0.2-μm filter and store indefinitely.

Note: Handle in a microbiological cabinet to prevent contaminations.

Preparation of buffers

Timing: 1–2 days

Tris-acetate-EDTA (TAE) buffer (50×)

Reagent	Final concentration	Amount
Tris-base	2 M	242 g
EDTA pH 8 (0.5 M)	50 mM	100 mL
Acetic acid (100%)	1 M	57.1 mL
Ultrapure water	─	Up to 1 L
Total	─	1 L

Note: Store indefinitely.

Infiltration buffer

Reagent	Final concentration	Amount
MES pH 5.5 (1 M)	10 mM	2.5 mL
MgCl2 (2 M)	10 mM	1.25 mL
Acetosyringone (100 mM)	150 μM	0.375 mL
Ultrapure water	─	Up to 250 mL
Total	─	250 mL

Note: Freshly prepared before use.

Step-by-step method details

Note: Unless otherwise indicated, standard molecular cloning reagents and methods²¹ are used, and protocol steps are done at room temperature (20°C–25°C).

One-step assembly of vsRNAi vectors

Timing: 3–5 days

This section described the assembly of vsRNAi into the pLX-TRV2 plasmid of JoinTRV by one-step digestion-ligation reactions. We showcase the engineering of pLX-TRV2 to express a 32-nt vsRNAi for simultaneously targeting the two N. benthamiana CHLI homeologs (Figure 2).

Note: Silencing of CHLI homeologs present in the genome of the allotetraploid N. benthamiana results a leaf yellowing phenotype, owing to the disruption of the chlorophyll biosynthesis.¹CHLI is used in the described procedures as the target gene pair to facilitate visual inspection of gene silencing efficiency, and the quantification chlorophyll levels by a non-destructive method.^22,23

• 1.
  vsRNAi design and in silico assembly of a recombinant pLX-TRV2 derivative for vsRNAi expression:

  • a.
    Identify the 32-nt sequence CTTCTTGATCGATTTGGAATGCATGCCCAAGT conserved in the two CHLI homeologs NbL05g17570.1 and NbL10g22050.1 of N. benthamiana.

    Note: The gene identification numbers used are those from the NbLab360v103 annotation.¹⁹

    Note: Alternative, high-quality chromosome-level genome assemblies and gene annotations of N. benthamiana may be used.^24,25,26

  • b.
    In silico assembly of the recombinant viral vector for vsRNAi expression.

    • i.
      Obtain the reverse complement of the sequence from step 1.a:
       ACTTGGGCATGCATTCCAAATCGATCAAGAAG
    • ii.
      Retrieve the pLX-TRV2 sequence (GenBank: OM372496).
    • iii.
      Replace the pLX-TRV2 positions 2454-2873 with sequence from step 1.b.i.

      Note: The free open-source bioinformatics software Unipro UGENE (http://ugene.net/)²⁷ can be used for the assembly simulation.

      Note: Correct assembly will result in a sequence identical to pLX-TRV2-vCHLI, whose complete sequence is available at Addgene (https://www.addgene.org/239842/).

• 2.
  Prepare a DNA oligonucleotide duplex spanning the vsRNAi sequence.

  • a.
    Appended the sequence TGAA to the 5′ terminus of the sequence from step 1.b.i to obtain vCHLI_F:
     TGAAACTTGGGCATGCATTCCAAATCGATCAAGAAG
  • b.
    Appended the sequence AGAG to the 5′ terminus of the sequence from step 1.a to obtain vCHLI_R:
     AGAGCTTCTTGATCGATTTGGAATGCATGCCCAAGT
  • c.
    Purchase vCHLI_F and vCHLI_R oligonucleotides and prepare the duplex annealing mix.
    Duplex annealing mix

    Reagent	Final concentration	Amount
    T4 DNA ligase buffer (10×)a	1×	1 μL
    vCHLI_F (100 μM)	5 μM	0.5 μL
    vCHLI_R (100 μM)	5 μM	0.5 μL
    Ultrapure water	─	8 μL
    Total	─	10 μL

    ^a

    Supplied with the enzyme.
  • d.
    Incubate the mix according to the duplex annealing conditions.
    Duplex annealing conditions

    Step	Temperature	Time
    Denaturation	95°C	2 min
    Ramp	from 95°C to 25°C	−6°C/min
    Final incubation	25°C	Hold

  • e.
    Add 190 μL of ultrapure water to the duplex annealing mix.

    Note: The concentration of the obtained duplex is 0.25 μM (250 fmol/μL).

    Note: The obtained duplex will comprise the vsRNAi sequence flanked by sticky ends, which enable directional assembly into BsaI-digested pLX-TRV2.

    Pause point: The obtained duplex can be frozen and stored at −80°C several days.

• 3.
  One-step vsRNAi assembly by BsaI digestion-ligation:

  • a.
    Prepare the digestion-ligation mix:
    Digestion-ligation mix

    Reagent	Final concentration	Amount
    T4 DNA ligase buffer (10×)a	1×	1 μL
    BsaIHFv2 (20 U/μL)	1 U/μL	0.5 μL
    T4 DNA ligase (400 U/μL)	20 U/μL	0.5 μL
    pLX-TRV2	─	∼50 fmol
    Diluted oligo duplex	25 fmol/μL	1 μL
    Ultrapure water	─	Up to 10 μL
    Total	─	10 μL

    ^a

    Supplied with the enzyme.
  • b.
    Incubate the mix according to digestion-ligation conditions.
    Digestion-ligation conditions

    Step	Temperature	Time	Cycles
    Digestion	37°C	5 min	30×
    Ligation	16°C	5 min
    Final incubation	60°C	5 min

    Note: If reactions are incubated overnight, add a 4°C terminal hold, but repeat the final incubation step (60°C, 5 min) the next day before to proceed with the E. coli transformation (step 4).

    Note: Digestion-ligation conditions are based on those reported by New England Biolabs (https://www.neb.com/en/protocols/2018/06/05/golden-gate-24-fragment-assembly-protocol); alternative cycling conditions may work.

• 4.
  Transformation of E. coli cells:

  • a.
    Thaw a 40-μL aliquot of electrocompetent E. coli DH10B cells on ice.

    Alternatives: Other E. coli strains suitable for high-efficient transformation may be used.

  • b.
    Gently mix by pipetting a cell aliquot with 1 μL of the reaction from step 3.b.
  • c.
    Transfer the mixture to a pre-chilled electroporation cuvette, and electroporate cells.

    Note: Once DNA is added to cells, electroporation can be carried out immediately, without any incubation.

    Note: Electroporation is done using a 1-mm cuvette for 5 ms, at 1500 V. Alternative conditions may work.

    Note: If your sample arcs when electroporating, dilute in ultrapure water, dialyze or purify the assembly reaction to remove salt excess.

    Alternatives: Heat shock of chemically-competent E. coli cells for high-efficiency transformation¹⁸ may be used.

  • d.
    Mix cells with 1 mL of SOC (see materials and equipment), and transfer to a 1.5-mL tube.
  • e.
    Incubate the cells at 37^oC, shaking vigorously at 250 rpm (1 h).

    Note: Warm selection plates at 37^oC while cells are recovering.

  • f.
    Pellet bacteria by centrifuging at 15 000 × g (1 min).
  • g.
    Resuspend bacteria in 100 μL of SOC.
  • h.
    Plate the suspension onto LB agar plates supplemented with 50 mg/L kanamycin and 40 μL X-Gal (40 mg/mL).

    Note: Plate the X-Gal solution on agar plates before use for white-blue screen of recombinant clones.

  • i.
    Incubate plates at 37°C (14–18 h).

    Note: Bacterial cells harboring binary vectors with full-length virus clones may display low growth rates, and plate incubation up to 24 h may be necessary.

    Pause point: After colony appearance, plates can be stored 1–3 days at 4°C.

• 5.
  Confirm the presence of recombinant viral vectors in E. coli transformants:

  • a.
    Pick a white colony obtained by X-Gal selection and use it inoculate 10 mL liquid LB with 50 mg/L kanamycin in 50 mL tubes.

    Note: It is recommended to purify plasmid DNA from 1–2 colonies per construct.

  • b.
    Incubate the tubes at 37°C, shaking vigorously at 250 rpm (14–18 h).

    Note: Bacterial cells harboring binary vectors with full-length virus clones may display low growth rates, and extended culturing time up to 24 h may be necessary.

  • c.
    Harvest bacteria from the culture by centrifugation at 15 000 × g (2 min); discard the medium, centrifuge again (30 s) and remove medium residues by pipetting.

    Pause point: Harvested bacterial pellets can be frozen and stored at −80°C several days before proceeding with plasmid DNA purification.

  • d.
    Purify DNA plasmids from bacterial pellets using NucleoSpin plasmid kit (Macherey Nagel) as per manufacturer’s instructions, except that:

    • i.
      Use double volumes of resuspension, lysis and neutralization solutions supplied within the kit to improve clearing of bacterial lysates and increase the amount of purified plasmid.

      Note: After addition of the lysis solution incubate until the cell suspension clears (5 min).

    • ii.
      Transfer ∼800 μL of cleared lysate to the column, centrifuge, discard the flowthrough and load again the same column with the remainder of the lysate.

      Note: The volume of the cleared bacterial lysate will exceed the spin column capacity.

      Note: Other commercial plasmid DNA purification kits can also be used.

      Pause point: Purified DNA plasmids can be frozen and stored at −20°C indefinitely.

• 6.(Optional) Identify recombinant viral vectors by restriction enzyme digestion of purified DNA plasmids (37°C, 1 h), and agarose gel electrophoresis.

Digestion mix

Reagent	Final concentration	Amount
Cfr9I buffer (10×)a	1×	1.5 μL
Cfr9I (XmaI) (10 U/μL)	0.3 U/μL	0.5 μL
EcoRI (10 U/μL)	0.3 U/μL	0.5 μL
Plasmid DNA	─	∼1 μg
Ultrapure water	─	Up to 15 μL
Total	─	15 μL

^aSupplied with the enzyme.

Note: Digestion of the parental vector pLX-TRV2 will yield two fragments of 5179 and 1062 bp, whereas the desired derivative with a 32-nt insert will yield fragments of 5179 and 674 bp.

Pause point: DNA plasmids with the correct digestion profiles can be frozen and stored at −20°C indefinitely.

• 7.Verify the insert sequence of the identified recombinant viral vectors by Sanger sequencing reactions including the primer D3723.

Note: Sanger sequencing results should match the vector sequence obtained by in silico assembly (step 1.b).

Agroinoculation of vsRNAi vectors to plants

Timing: 4–7 days

In this section, binary vectors with the correct sequence confirmed by sequencing are transformed into Agrobacterium AGL1 cells. Selected cells harboring the binary vectors of the JoinTRV system are then cultured, and used to agroinoculate N. benthamiana plants.

Note:Agrobacterium cells can host multiple T-DNA vectors.^12,28 JoinTRV vectors have compatible replication origins for simultaneous agroinoculation of TRV genomic components in a one-Agrobacterium/two-vector approach.¹³

Alternatives: JoinTRV vectors have autonomous replication and can be used in a one-vector/one-Agrobacterium approach. In this case: (i) transform pLX-TRV1 into Agrobacterium cells and selected on plates supplemented with 30 mg/L gentamicin and 50 mg/L rifampicin; (ii) transform pLX-TRV2 and its derivatives into Agrobacterium cells and selected on plates supplemented with 50 mg/L kanamycin and 50 mg/L rifampicin; (iii) individually culture the two obtained Agrobacterium strains as described in steps 10–11 and pool them before to proceed with the preparation of bacterial suspensions for plant agroinoculation (step 12).

CRITICAL: Ensure to coordinate preparation of N. benthamiana plants and Agrobacterium strains hosting the viral vectors.

• 8.
  Preparation of Agrobacterium competent cells hosting pLX-TRV1:

  • a.
    Thaw aliquots of electrocompetent Agrobacterium AGL1 cells on ice.

    Alternatives: Viral vectors of this protocol are based on binary T-DNA vectors of the pLX series, which have been tested in a variety of Agrobacterium strains.²⁹ Strain alternatives include C58C1-313, EHA105, CryX, NMX021 (ref.^12,20,30), as well as any Agrobacterium strain capable of plant cell transformation and sensitive to kanamycin and gentamicin, the antibiotic used for pLX-TRV1 and pLX-TRV2 selection.

    CRITICAL: GV3101::pMP90 is a common Agrobacterium strain resistant to gentamicin³⁰ not compatible with the JoinTRV system.

  • b.
    Gently mix by pipetting a cell aliquot with ∼50 ng of the pLX-TRV1 plasmid.
  • c.
    Transfer the mixture to a pre-chilled electroporation cuvette, and electroporate cells.

    Note: Once DNA is added to cells electroporation can be carried out immediately, without any incubation.

    Note: Electroporation is done using a 1-mm cuvette for 5 ms, at 1500 V. Alternative conditions may work.

    Note: If your sample arcs when electroporating, dilute or purify plasmid DNA to remove salt excess.

    Alternatives: Freeze-thaw transformation¹⁸ of Agrobacterium cells may be used.

  • d.
    Mix cells with 1 mL of SOC and transfer to a 1.5-mL tube.
  • e.
    Incubate the cells at 28^oC, shaking vigorously at 250 rpm (2–4 h).

    Note: Warm selection plates at 28^oC while cells are recovering.

  • f.
    Pellet bacteria by centrifuging at 15 000 × g (1 min).
  • g.
    Resuspend bacteria in 100 μL of SOC.
  • h.
    Plate the suspension onto LB agar plates supplemented with 50 mg/L rifampicin, 30 mg/L gentamicin and 50 mg/L carbenicillin.

    Note: pLX-TRV1 is a derivative of pLX-Z4, which includes the RK2 origin and gentamicin resistance.¹²

    Note: AGL1 is resistant to rifampicin and carbenicillin, and the latter is added to the medium for stringent selection.

  • i.
    Incubate plates at 28°C (48–72 h).

    Note: Bacterial cells harboring binary vectors with viral vectors may display low growth rates; extended plate incubation time may be necessary.

    Pause point: After colony appearance, plates can be stored 1–3 days at 4°C.

  • j.
    Pick an individual colony, and use it to inoculate 5 mL liquid LB with 50 mg/L rifampicin 30 mg/L gentamicin and 50 mg/L carbenicillin, in a 50 mL tube.

    CRITICAL: Bacteria harboring viral vectors may display low growth rates. If a mixture of small and large colonies appears during agar plate selection of transformed bacteria pick a small colony for subsequent steps.

  • k.
    Incubate the tube at 28°C, shaking vigorously at 250 rpm (48 h).
  • l.
    Use the culture from the previous step to inoculate 100 mL liquid LB with 50 mg/L rifampicin and 30 mg/L gentamicin, in a 500 mL flask.
  • m.
    Incubate the flask at 28°C, shaking vigorously at 250 rpm until it reaches an OD₆₀₀ ≈ 0.8–1 (4–6 h).

    Note: For this step, use a starting OD₆₀₀ ≈ 0.1.

  • n.
    Harvest bacteria from the culture by centrifugation at 7 200 × g (10 min, 4°C); discard the medium, centrifuge again (30 s) and remove medium residues by pipetting.
  • o.
    Wash twice the bacteria by resuspending the obtained pellet in 5 mL of ice-cold ultrapure water by pipetting, and repeating step 8.n.
  • p.
    Resuspend the obtained pellet in 5 mL of ice-cold glycerol 10%, and repeat step 8.n.
  • q.
    Resuspend bacteria in 1 mL of ice-cold glycerol 10% by pipetting.
  • r.
    Aliquot 40 μL of the obtained electrocompetent Agrobacterium AGL1(pLX-TRV1) cells to 1.5 mL tubes, freeze in liquid nitrogen and store at −80°C.

    Pause point: Cell aliquots can be stored for at −80°C for up to 12 months.

• 9.
  Preparation of Agrobacterium cells simultaneously hosting pLX-TRV1 and the pLX-TRV2 vector for vsRNAi delivery:

  • a.
    Thaw aliquots of electrocompetent Agrobacterium AGL1(pLX-TRV1) cells on ice.
  • b.
    Gently mix by pipetting a cell aliquot with ∼50 ng of pLX-TRV2-vCHLI or pLX-TRV2.

    Note: pLX-TRV2 is itself a derivative of pLX-B2, which includes the pBBR1 origin and kanamycin resistance.¹²

    Note: The pLX-TRV2 is included as a control vector to be used in plant infection assays.

  • c.
    Follow steps 8.c to 8.g.
  • d.
    Plate the bacterial suspensions onto LB agar plates supplemented with 50 mg/L rifampicin, 30 mg/L gentamicin and 50 mg/L kanamycin for simultaneous selection of pLX-TRV1 and pLX-TRV2-based vectors.
  • e.
    Incubate plates at 28°C (48–72 h).

    Note: Bacterial cells harboring binary vectors with viral vectors may display low growth rates; extended plate incubation time may be necessary.

    Pause point: After colony appearance, plates can be stored 1–3 days at 4°C.

• 10.
  Culturing of Agrobacterium strains harboring the vsRNAi vector:

  • a.
    Prepare 12 mL tubes with 3 mL liquid LB supplemented with 30 mg/L gentamicin, 50 mg/L kanamycin and 50 mg/L rifampicin for JoinTRV selection (pLX-TRV1/pLX-TRV2).
  • b.
    Pick individual colonies selected in step 9.e, and use them to inoculate the prepared tubes.

    CRITICAL: Bacteria harboring viral vectors may display low growth rates. If a mixture of small and large colonies appears during agar plate selection of transformed bacteria pick small colonies for subsequent analysis.

  • c.
    Incubate tubes at 28°C, shaking at 250 rpm (48 h).
  • d.
    Using the cultures from the previous step:

    • i.
      Mix by pipetting a 0.7-mL aliquot with 0.2 mL of autoclaved 87% glycerol, and stored the obtained bacterial stock at −80°C, indefinitely.
    • ii.
      Inoculate a 0.1-mL aliquot to inoculate 10 mL liquid LB with 30 mg/L gentamicin and 50 mg/L kanamycin in 50 mL tube, and incubate at 28°C, shaking at 250 rpm (14–18 h).
• 11.
  Preparation of bacterial suspensions for inoculation:

  • a.
    Measure in a spectrophotometer the optical density at 600 nm (OD₆₀₀) of the bacterial culture from step 10.d.ii until it reaches an OD₆₀₀ ≈ 1.
  • b.
    Pellet bacteria by centrifugation at 7 200 × g (5 min), discard the medium, centrifuge again (30 s) and remove medium residues by pipetting.
  • c.
    Resuspend the cell pellet to an OD₆₀₀ of 0.5 in 4 mL Infiltration Buffer.
  • d.
    Incubate at 28^oC in the dark (3 h) for induction of bacterial genes required for T-DNA delivery to plant cells.
• 12.
  vsRNAi vector delivery to plants by agroinoculation:

  • a.
    Water plants before starting with the inoculation to ensure they are well hydrated and induce stomata opening.

    Note: Organize and label plants before starting the inoculation.

    Note: Besides the empty pLX-TRV2 vector condition, mock-inoculated or untreated plants should also be included as controls.

  • b.
    Inoculate two young leaves per plant on the abaxial side using a 1-mL needleless syringe. Infiltrate ∼0.2 mL of bacterial suspension per leaf.

    Note: Control plants are inoculated with AGL1 harboring pLX-TRV1 plus pLX-TRV2 to assess the symptoms associated with the TRV infection, and not with target gene silencing.

    Note: Mock-inoculated or untreated plants should also be included as controls.

    CRITICAL: Make sure not to press the needleless syringe so hard as to pierce the leaf through.

    CRITICAL: To avoid cross-contamination, use clean gloves and a new syringe for each bacterial suspension. Ensure that plants agroinoculated with different constructs do not come into contact with each other.

Analysis of the gene silencing phenotype

Timing: 1–2 weeks

In this section, inoculated plants are visually inspected and chlorophyll fluorometric quantification is done using a leaf clip meter.²²

• 13.Starting 7 d after inoculation, check plants for changes in phenotype and using control plants treated with the unmodified JoinTRV condition as a reference.

Note: Bright leaf yellowing of plants inoculated with pLX-TRV1 plus pLX-TRV2-vCHLI is expected to appear after 7–10 days.

CRITICAL: Inoculation of plants older than 3 weeks may delay the appearance of gene silencing phenotypes. Gene silencing efficiency may be compromised in plants older than 4 weeks of age.⁸

CRITICAL: Use of TRV systems other than JoinTRV may delay the appearance of gene silencing phenotypes.

• 14.Measure chlorophyll levels of upper-uninoculated leaves of intact plants with the DUALEX optical leaf clip meter, and facing the adaxial leaf side to the light source.

Note: In the vsRNAi condition, chlorophyll levels are expected to be <20% of those in control plants.

CRITICAL: Record measurements of the youngest and second-youngest leaves that have reached a width of 5 cm or more.

CRITICAL: When taking measurements, avoid leaf veins to minimize instrumental errors.

• 15.Collect leaf samples and immediately freeze them in liquid nitrogen.

CRITICAL: Each sample consists of the youngest and second-youngest leaves that have reached a width of 5 cm or more, which can be collected individually or pooled together.

CRITICAL: Collect samples from control plants to be used in downstream analysis.

Pause point: After collection, samples can be stored at −80^oC, up to 6 months.

Validation of gene silencing

Timing: 1–2 days

In this section, the expression of the CHLI gene pair targeted by vsRNAi is analyzed by RT-qPCR to confirm gene silencing (Figure 4A).

Alternatives: In contrast to standard VIGS protocols, in which viral amplification of large inserts can lead to overestimation of expression levels of homologous host genes, RNA sequencing (RNA-seq) analysis can also be used for transcriptome-wide quantification of target gene silencing triggered by vsRNAi (e.g. NCBI BioProject: PRJNA1217923),¹ see Figure 4B.

• 16.Extract RNA from the plant samples with the FavorPrep plant total RNA mini kit (Favorgen) according to the manufacturer’s instructions.

Alternatives: Alternative plant RNA extraction protocols or kits may be used.

CRITICAL: Powder plant samples in liquid nitrogen. Strictly avoid sample thawing, as it may promote RNA degradation and result in unreliable analysis of endogenous transcript levels.

Pause point: RNA samples can be stored at −80^oC, up to 6 months.

• 17.Use ≈1 μg of purified RNA in cDNA synthesis reaction with the iScript gDNA Clear cDNA synthesis kit (Bio-Rad Laboratories) according to the manufacturer’s instructions.

Alternatives: Alternative cDNA synthesis protocols or kits may be used.

Pause point: cDNA samples can be stored at −80^oC, up to 6 months.

• 18.Use cDNA samples in qPCR reactions that included gene-pair-specific primers and 1× SsoAdvanced universal SYBR green supermix (Bio-Rad Laboratories), and run the reactions on a real-time PCR machine, according to the manufacturer’s instructions.

Alternatives: Alternative qPCR reagents may be used.

Note: Use the primer pair CHLI_F and CHLI_R to simultaneously quantify the levels of the two CHLI homologs, NbL05g17570.1 and NbL10g22050.1.

Note: Use the primer pair PP2A_F and PP2A_R to quantify the levels of the reference gene PP2A, as reported.³¹

• 19.Calculate the fold change in levels of the vsRNAi target gene pair compared with the control samples from plants treated with the unmodified JoinTRV vector.

Note: The 2^-ΔΔC_T method can be used to measure the expression of the target gene pair relative to the reference gene.³²

Note: In the vsRNAi condition, transcript levels of the target gene pair are expected to be ≈20% of those in control plants.

Figure 4.

CHLI transcript quantification for gene silencing validation

RNA samples are prepared from upper-uninoculated leaves of N. benthamiana plants treated with pLX-TRV1 plus pLX-TRV2-vCHLI (vsRNAi), or pLX-TRV1 plus the unmodified pLX-TRV2 (CTRL).

(A) RT-qPCR quantification (mean ± SD; n = 3) of the expression of the CHLI gene pair confirms gene silencing in the vsRNAi condition.

(B) Transcriptome-wide quantification of target gene silencing by RNA sequencing (RNA-seq) analysis (n = 3) confirms a significant downregulation (log2 fold change (FC) ≤ −1.92; FDR <0.05) of the CHLI homeologs NbL05g17570.1 and NbL10g22050.1 in the vsRNAi condition.

Expected outcomes

The procedures described in this protocol enable the one-step assembly of viral vectors based on TRV to express short RNA inserts triggering gene silencing, which are delivered to plants by agroinoculation. Compared to standard VIGS protocols, the assembly of vsRNAi vectors overcomes the need for biological material for insert amplification, and is compatible with low-cost DNA chemical synthesis for insert cloning.

Delivery of a vsRNAi designed to simultaneously target regions conserved in the N. benthamiana CHLI gene pair will result in visible phenotypic changes, owing to impairment of chlorophyll biosynthesis. When vsRNAi targeting the CHLI gene pair is used, plants will exhibit bright leaf yellowing starting after 7–10 days. vsRNAi treated plants will show a decrease in levels of transcripts of the target gene pair and of chlorophylls, which are expected to be less than 20% of those in control plants.

Although RT-qPCR is presented here to confirm gene silencing, the efficacy of vsRNAi-based approaches can be validated using alternative methods, including RNA sequencing (RNA-seq) for transcriptome-wide quantification of target gene silencing, and sRNA sequencing to confirm an increased production of 21- and 22-nt sRNAs with homology to the target gene(s).

Finally, simplified cloning of vsRNAi fragments, which are nearly 10-fold smaller than those of conventional VIGS and can be synthesized at low cost, may enable high-throughput functional genomics in plants.

Limitations

JoinTRV and the assembled vectors are based on TRV, which possess a wide host range but it is especially adapted to plants of the Solanaceae family.^16,33,34 Use of this protocol in species other than N. benthamiana may require optimization, for instance the applicability of vsRNAi has been confirmed in tomato (S. lycopersicum) and scarlet eggplant (S. aethiopicum),¹ by treating fully expanded cotyledons of 10-day-old seedlings with bacterial suspensions obtained as described in step 10 and adjusting the final OD₆₀₀ to ≈ 2.

Gene knockdown may cause obvious phenotypes, including severe growth defects and cell death.³⁵ However, gene-silenced plants may show no visible changes compared with the vector controls. Although vsRNAi are designed in this protocol to simultaneously target a N. benthamiana gene pair, targeting multiple genes within the same gene family^36,37 may be required to overcome functional redundancy and yield phenotypic changes.

Troubleshooting

Problem 1

High background of empty vector colonies precludes identification of positive clones (step 4); no vector is recovered with the correct insert (steps 5–7).

Potential solution

• •Work in sterile conditions and avoid plasmid or bacterial contaminations.
• •Obtain pLX-TRV2 from a trusted source (e.g., Addgene #180516).
• •Ensure that the cloning strategy and the materials used are correct; for instance, confirm that the DNA oligonucleotide duplex spanning the vsRNAi sequence includes the TGAA and AGAG overhangs compatible with BsaI-digested pLX-TRV2.

Problem 2

Low plasmid DNA yield from E. coli cultures.

Potential solution

Binary vectors used herein include a medium copy origin by design to enhance stability,¹² higher culture volumes (step 5) should be used to reach yields obtained using with high-copy plasmids. The plasmid DNA amount recovered from a single miniprep is nonetheless sufficient for the procedures detailed in this protocol, that is, the optional verification by restriction enzyme digestion, the clone verification by Sanger sequencing, and transformation of Agrobacterium cells.

Problem 3

Slow growth rates of bacteria harboring binary vectors with viral vectors.

Potential solution

For most applications, extended bacterial culturing time may solve the problem.

Problem 4

N. benthamiana leaves are hard to infiltrate (step 12).

Potential solution

To promote stomata opening and leaf infiltration, ensure to use well-watered plants maintained at above 60% relative humidity, temperatures between 20°C–25°C, and during the light phase of the photoperiod. If the problem persists, discard the entire batch, since it may indicate potentially stressed plants, which may affect viral infection and achieving robust gene silencing phenotypes.

Problem 5

Phenotypes are inconsistent between plants treated with the same vsRNAi vector (step 13).

Potential solution

In step 12, use healthy plants at the same developmental stage, and no older than two to three weeks (see Figure 3A). Inoculation of plants older than 3 weeks may delay the appearance of gene silencing phenotypes, and gene silencing efficiency may be compromised in those older than 4 weeks.

Problem 6

Severe necrosis in the inoculated leaves and in the upper-uninoculated leaves, including in plants treated with the empty vector condition.

Potential solution

Ensure use of vectors from the JoinTRV system; severe necrosis of the infiltrated area and upper leaves has been reported with other TRV systems.¹³

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Fabio Pasin (f.pasin@csic.es).

Technical contact

Questions regarding the technical details of the protocol should be directed to the technical contact, Arcadio García (arcadiogarcia@ibmcp.upv.es).

Materials availability

pLX-TRV1, pLX-TRV2, and the derivative pLX-TRV2-vCHLI are available at Addgene with product numbers 180515 (https://www.addgene.org/180515/), 180516 (https://www.addgene.org/180516/), and 239842 (https://www.addgene.org/239842/), respectively.

Data and code availability

This protocol does not disclose new data or code.

Acknowledgments

This work was supported by grant PID2023-146418OB-I00 from the Ministerio de Ciencia, Innovación y Universidades (Spain), through the Agencia Estatal de Investigación, and by PROMETEO CIPROM/2022/21 from the Generalitat Valenciana. A.G. is the recipient of a predoctoral contract (FPU20/05477) from the Ministerio de Ciencia, Innovación y Universidades (Spain). F.P. is financed by the “Ramón y Cajal” program (RYC2023-045411-I) of the Ministerio de Ciencia, Innovación y Universidades (Spain).

Author contributions

A.G. and F.P. conceived the work; A.G. and F.P. wrote the manuscript with input from the rest of the authors; all authors revised and approved the final version.

Declaration of interests

The authors declare no competing interests.