Toll Like Receptors in the Larynx: Implications for Laryngeal Immunology

ABSTRACT

Rationale

Although optimal epithelial barrier function is essential to laryngeal health and disease, there is a surprising paucity of literature on the underlying immunological mechanisms in laryngeal epithelia. Toll like receptors (TLR) are a class of pattern‐recognition receptor (PRR) proteins that are essential for regulating the innate and adaptive immune response in mucosal epithelia. Identifying the presence of TLR receptors in laryngeal epithelia and delineating their role in laryngeal inflammation will contribute to our understanding of innate and adaptive immune responses in the vocal fold mucosa.

Objective

(1) To delineate TLR expression in human and murine vocal fold epithelium, (2) to elucidate the mechanisms of TLR‐dependent inflammation in primary human vocal fold epithelial cell cultures.

Methods

In our first experiment, we histologically characterized normal TLR 1‐9 expression in human and murine laryngeal epithelium. In our second experiment, we quantified transcript expression of TLR 1‐9 and IL8 in primary human vocal fold epithelial cell cultures, incubated with and without LPS.

Results

TLR were identified in the murine and human vocal fold epithelium with slight differences in localization from true to false vocal folds in humans. In primary human vocal fold epithelial cell cultures, there was a significant increase in relative gene expression at 24 h for TLRs 2, 3, and 6, as well as IL8 with LPS stimulation.

Conclusions

This is the first study to identify the presence of TLR receptors in the human and murine vocal fold epithelium. These data lay the groundwork for delineating the role of TLR in the laryngeal immune response in both healthy and pathological states.

Level of Evidence

NA.

TLR were identified in the murine and human vocal fold epithelium with slight differences in localization from true to false vocal folds in humans. In immortalized human vocal, fold epithelial cell cultures, no significant differences in relative gene expression at 24 h were observed – for TLRs 1‐9 and IL8 – with and without LPS stimulation.

1. Introduction

The larynx is a vital mucosal organ, essential to breathing, swallowing, coughing and phonation in humans [1]. Given its unique position in the aerodigestive tract, the larynx is constantly exposed to environmental, systemic and mechanical irritants [2]. Emerging evidence suggests the larynx has an immunological role in responding to exposed challenges [3, 4, 5]. Vocal fold (VF) epithelium, in the larynx, is composed of layers of stratified squamous epithelium cells that constitute a unique interface with the external environment [6, 7]. This epithelium, being the first line of defense, likely plays an important role in the innate and adaptive immune systems in the presence of noxious stimuli. However, there is a paucity of literature on the mechanisms underlying laryngeal immunity, especially within the epithelium.

Toll like receptors (TLR) are a class of pattern‐recognition receptor proteins that regulate both innate and adaptive immunity in other mucosal epithelia [8, 9, 10]. The TLR family in both humans and mice consists of 10 members, TLR1–TLR10; however, TLR 10 is poorly characterized in humans [11, 12, 13]. Not only do TLR interact with commensal and/or pathogenic bacteria on the epithelium surface, they also influence immunological homeostasis by modulating the pro‐inflammatory cytokine cascade in the presence of bacterial and/or viral ligands [8, 9, 10]. For example, TLR 4 in combination with the MD2 complex recognizes lipopolysaccharide (LPS) which is a constituent of the cell wall of gram‐negative bacteria [14]. TLR 1 and TLR 6 form heterodimers with TLR 2 to recognize triacyl and diacyl lipopeptides from gram‐positive bacteria respectively. TLR 5 recognizes bacterial flagellin. TLR 7 and 8 are known to be activated by single‐strand RNA, and TLR 3 by double‐strand RNA found during viral replication. TLR 9 recognizes CpG motifs in bacterial and viral genomes. TLRs can have various metabolic or immunological functions (lipogenesis, inflammation, prevention from infection) that are specific to their localization within the tissue (endosomal, cytoplasmic), tissue type (adipose, mucosal) and bacterial load [9, 10, 15, 16]. Thus, it is critical to identify TLR in the vocal fold epithelium as they could have a significant immunological impact on laryngeal health and disease.

The murine model is ideal for characterizing the immunological architecture of the larynx and has been employed in previous research in laryngeal immunology [3] and microbiology [17]. In fact, from the murine model, we know that the bacterial composition of the laryngeal microbiota is distinct from the gut [17]. Mice are known to express TLR 1–9 though there have been identified differences in TLR 2, 3, and 4 expression. For example, the murine TLR 2 promoter in monocytes is induced by LPS while not in human monocytes. TLR 3 is strongly induced by LPS in murine macrophages but not in human macrophages. TLR 4 is upregulated upon TLR activation in human macrophages but downregulated in murine macrophages. TLR localization within the VF epithelium has not yet been established. Identifying TLR expression in murine and human vocal fold epithelia can also inform downstream research on host‐microbial immune interactions in the larynx. Consequently, human vocal fold fibroblasts have been previously shown to constitutively express TLR1‐6 and TLR9 [18], and increase expression of these receptors when incubated with LPS [18]. However, the expression of TLRs in vocal fold epithelium of mice and humans has never been described.

In this investigation, we completed two parallel experiments. Experiment 1 was a systematic in vivo characterization of normal TLR1‐9 expression in human and murine laryngeal epithelium. In Experiment 2, we additionally used human vocal fold epithelial cell lines to quantify TLR1‐9 transcript expression in vitro, as well as measure downstream expression of IL‐8 with and without exposure to LPS. These experiments allow for a primary characterization of TLRs in human vocal fold epithelium in both normal and inflammatory conditions, as well as verifying correspondence with murine larynges. By beginning to elucidate potential TLR‐mediated immunological mechanisms of the laryngeal epithelium, we can further our understanding of various laryngeal pathologies.

2. Methods

2.1. Experiment 1: In‐ Vivo Characterization of TLR in Human and Murine Vocal Fold Tissue

2.1.1. Tissue Collection and Processing

2.1.1.1. Human Vocal Fold Tissue

Post‐mortem human laryngeal tissue – obtained through the National Disease Research Interchange (NDRI) – was collected from two healthy cadaveric donors within 24‐h of death. Cadaveric donors (63y, M and 65y, F) had no history of head or neck injuries, laryngeal pathology, respiratory or neurological disease. Following laryngeal extraction, vocal fold tissue was paraformaldehyde‐fixed, processed, and paraffin‐embedded and cut coronally into 4 μM‐thick sections. Three consecutive coronal sections of mid‐membranous vocal fold tissue were selected for downstream immunostaining to identify the presence of TLR.

2.1.1.2. Murine Laryngeal Tissue

All protocols and procedures for the collection of murine laryngeal tissue was approved by the University of Wisconsin Madison IACUC (Protocol # M00569). Six, female, 6‐8‐week‐old, FVB mice were euthanized via CO₂ inhalation. Larynges were rapidly dissected, paraformaldehyde‐fixed, processed, paraffin embedded and cut into coronal 4 μM ‐thick sections. Three consecutive laryngeal sections encompassing the mid‐membranous vocal fold tissue were selected for downstream immunostaining for the presence of TLR.

2.1.2. Immunohistochemistry for TLR Distribution

Immunochemistry procedures were completed with the Dako EnVision Kit (Dako, Copenhagen, Denmark) per manufacturer instructions. Validation of our immunostaining assays for each TLR receptor was completed with a corresponding positive control from murine and human tissue (small intestine, spleen, skin and lung tissue) (Table 1). Once murine laryngeal and human vocal fold FFPE samples were prepared, they were deparaffinized. Following deparaffinization, high‐temperature antigen retrieval was completed with incubation in Tris‐EDTA buffer for 15 min. All staining was completed with Autostainer Plus (DAKO) (per manufacturers' instructions), using Diaminobenzidine (DAKO basic DAB‐kit) as the chromogen. Table 1 details the primary antibody concentrations and incubation time for TLR 1–9. Localization of each TLR receptor within the epithelium of murine and human laryngeal/VF tissue was based on consensus ratings by experienced raters. Three IHC‐trained raters reviewed staining images and determined nuclear versus cytoplasmic as well as apical versus basal staining patterns individually. This was also compared to IHC positive controls to confirm positivity. This data was pooled into a final consensus rating.

TABLE 1.

Primary antibodies with concentrations and secondary antibodies used in immunohistochemical staining of human and murine larynges, as well as tissue type used for positive control.

TLR	Product	Concentration	Secondary antibody	Positive control
TLR1	Thermo Fisher, PA5‐23097	1:100	Mouse anti‐rabbit IgG	Murine small intestine
TLR2	NovusBio, NB100‐56586	1:50	Mouse anti‐rabbit IgG	Human spleen
TLR3	Imgenex, IMG‐315A	1:100	Mouse anti‐rabbit IgG	Murine small intestine
TLR4	Abcam, AB22048	1:100	Mouse anti‐rabbit IgG	Murine small intestine
TLR5	NovusBio, NBP2‐24787	1:75	Goat anti‐mouse IgG	Human skin
TLR6	Thermo Fisher, PA5‐11601	1:500 (murine) 1:100 (human)	Mouse anti‐rabbit IgG	Murine skin
TLR7	Novus Biologicals, NB100‐56682	1:100	Mouse anti‐rabbit IgG	Human lung
TLR8	Novus Bio, NBP2‐24917	1:500 (murine) 1:250 (human)	Goat anti‐mouse IgG	Human spleen
TLR9	Novus Bio, NBP2‐24729	1:250 (murine) 1:500 (human)	Mouse anti‐rabbit IgG	Human spleen

2.2. Experiment 2: In Vitro Quantification of TLR receptor and IL8 transcription levels in human vocal fold epithelial cells following LPS‐stimulation

2.2.1. Human Epithelial, in Vitro Vocal Fold Cell Culture

Primary human normal epithelial vocal fold cells from a single donor19 were incubated in epithelium cell culture medium (EPC) for 7–10 days (Passage 3–4). EPC consisted of airway epithelial cell growth medium (PromoCell, Cat No. C‐21060), bovine pituitary extract (0.004 mL/mL), L‐Epidermal Growth factor (10 ng/mL), insulin (5 μg/mL), hydrocortisone (0.5 μg/mL), trii‐iodo‐L‐thyronine (6.7 ng/mL), transferrin (10 μg/mL), retinoic acid (0.1 ng/mL), L‐glutamine (6 Mm), primocin (100 ng/mL, InvivoGen, San Diego, CA) and 1% Pen‐Strep. When human vocal fold epithelial cells reached near confluence, they were serum‐starved for 24 h, then treated with or without 5 μg/mL LPS (γ‐irradiated, Escherichia coli O26:B6, Sigma‐Aldrich, USA) in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) for 24 h.

2.2.2. Reverse Transcription – Quantitative Polymerase Chain Reaction

We compared relative gene expression of TLR 1–9 and IL8 in vocal fold epithelium cells that were treated with and without LPS. Primer information is reported in Table 2. U937 was used as a positive control to test the validity and efficiency of primers. Total RNA was extracted from vocal fold epithelium cells using RNEasy Plus Mini Kit (Qiagen, Hilden, Germany). Then, cDNA was transcribed from 500 ng of total RNA/sample in a 10 μL final reaction using GoScript RT‐PCR kit (Promega). cDNA was amplified using real‐time quantitative Polymerase Chain Reaction with FastStart DNA Master Syber Green I Kit. Thermocycling parameters of the PCR reactions are as follows; Polymerase chain reaction was carried out for 40 cycles, each including a holding stage of 50°C for 20 s and 95°C for 10 min, a cycling stage of 95°C for 15 s and 60°C for 1 min, and a melting curve stage of 95°C for 15 s, 60°C for 1 min, 95°C for 30 s, and 60°C for 15 s. Three technical replicates (6 total samples) were used for each assay. Relative gene expression of target TLR and IL8 genes was obtained using the 2^−ΔΔCT method with β ‐actin used as internal control [19]. Relative gene expression is expressed as fold‐change relative to the LPS‐untreated group. Mann Whitney t‐tests were completed to compare the relative gene expression of TLR and IL8 between groups. Alpha value was set at p = 0.05.

TABLE 2.

Primer information for qPCR, Experiment 2.

Name	GenBank#	Forward	Reverse	Size
TLR1	NM003263	5’‐CTATACACCAAGTTGTCAGC ‐3′	5’‐GTCTCCAACTCAGTAAGGTG −3′	220
TLR2	NM003264	5’‐ACCTGTCCAACAACAGGATCACCT‐3′	5’‐TGTTCAAGACTGCCCAGGGAAGAA −3′	139
TLR3	NM003265	5’‐ACTGAACCATGCACTCTGTTTGCG‐3′	5’‐TGACGAAAGGCACCTATCCGTTCT‐3′	96
TLR4	NM138554	5’‐ATGCAGGGCTGCTAATCTCAAGGA‐3′	5’‐GTTGGTTGAATGCCCACCTGGAA‐3′	93
TLR5	NM003268	5’‐GTTGCAACTTGCCTGGGAAACTGA −3′	5’‐TCAGCCTGTTGGAGTTGAGGCTTA −3′	164
TLR6	NM006068	5’‐AGGTGCCTCCATTATCCTCA −3′	5’‐GAATCCATTTGGGAAAGCAG −3’	211
TLR7	NM016562	5’‐AATGTCACAGCCGTCCCTACTGTT‐3’	5’‐TTTACACGGCGCACAAGGAAATGG −3’	180
TLR8	NM138636	5’‐TGTCTCAGAGGCTGCAATGTAGGT −3’	5’‐AGGCTCGCATGGCTTACATGAGTA‐3’	136
TLR9	NM017442	5’‐ATCTGCACTTCTTCCAAGGCCTGA‐3’	5’‐AGAAGGCCAGGTAATTGTCACGGA −3’	144
IL‐8	LC461682.1	5’‐ACTGAGAGTGATTGAGAGTGGAC‐3’	5’‐AAC CCT CTG CAC CCA GTT TTC‐3’	112
β ‐Actin	NM_031144.3	5’‐ACGTTGCTATCCAGGCTGTGCTAT −3′	5’‐CTCGGTGAGGATCTTCATGAGGTAGT‐3′	188

3. Results

3.1. Experiment 1: In vivo Characterization of TLR in Human and Murine Vocal Fold Tissue): We performed immunostaining to identify Toll‐Like Receptors (TLRs 1–9) in the murine and human laryngeal epithelium

3.1.1. Murine Laryngeal Tissue

TLR 1–9 were identified in murine laryngeal epithelium (Figure 1). Expression of TLRs 2, 3, 6, 7, 9 were found to be evenly distributed throughout the epithelium, extending from the supraglottis to the subglottis (Figure 1). However, staining of the remaining TLR [1, 4, 5, and 8] was stronger in the epithelial lining of the supraglottis compared to the subglottis (Figure 1). TLR 1–7 were localized to the apical layer of epithelium while TLR 8 and 9 were more diffusely spread throughout all epithelial layers. TLR 2 was nuclear while the remaining TLRs localized to the cytoplasm. TLR 3, 4, and 5 seemed to localize to a singular cell layer. TLR 1, 2, 6, and 7 were apical but involved more than one cell layer (Figure 1).

FIGURE 1.

Immunohistochemical labeling for toll‐like receptors (TLR) 1–9 in the epithelium of the murine larynx (coronal sections, 10× magnification with 40× magnification image subsets).

3.1.2. Human Vocal Fold Tissue

All TLRs (except TLR 3) were identified in the human true and false vocal fold epithelium (Figures 2 and 3). TLRs 1 and 7 were found to be localized to the apical epithelial cell layers (Figures 2 and 3), whereas TLRs 4, 6, 8, and 9 were localized to both apical and basal cell layers (Figures 2 and 3). TLR 2 and 5 were localized to the basal layers only. In the apical cell layers, TLRs 6 and 8 had the strongest signal (Figures 2, 3). In the basal cell layers, TLRs 4 and 5 had the strongest signal (Figures 2 and 3). All TLRs (except TLR 2) were localized to the cytoplasm, whereas TLR 2 had a nuclear localization (Figures 2 and 3). TLR 5 seems to be more diffuse throughout the epithelium in false vocal folds when compared to true vocal folds. While TLR 4 was present in both basal and apical layers of the true VF epithelium, it seemed to localize only to the basal layer of the false VF. Similarly, TLR 9 was only in the apical epithelium of the false VF but more diffusely present in both apical and basal epithelium of the true VF (Table 3).

FIGURE 2.

Immunohistochemical localization of TLR [1, 2, 3, 4, 5, 6, 7, 8, 9] in human true vocal fold epithelium (coronal sections, 40× magnification).

FIGURE 3.

Immunohistochemical localization of TLR [1, 2, 3, 4, 5, 6, 7, 8, 9] in human false vocal fold epithelium (coronal sections, 40× magnification).

TABLE 3.

Summary of differences in TLR localization between human true and false vocal folds and murine laryngeal epithelium.

		TLR1	TLR2	TLR3	TLR4	TLR5	TLR6	TLR7	TLR8	TLR9
Human True VF	Epithelial localization	Apical	Basal	Negative	Basal and apical	Basal	Basal and apical	Apical	Basal and apical	Basal and apical
	Cellular localization	Cytoplasmic	Nuclear	Negative	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic
Human False VF	Epithelial localization	Apical	Basal	Negative	Basal	Full thickness	Full thickness	Apical	Full thickness	Apical
	Cellular localization	Cytoplasmic and nuclear	Nuclear	Negative	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic
Murine VF	Epithelial localization	Apical	Apical	Apical	Apical	Apical	Apical	Apical	Full thickness	Full thickness
	Cellular localization	Cytoplasmic	Nuclear	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic	Cytoplasmic

3.2. Experiment 2: In Vitro Quantification of TLR receptor and IL8 transcription levels in human vocal fold epithelial cells following LPS stimulation

We compared the relative gene expression of TLR and IL8 in human vocal fold epithelial cells following treatment with or without LPS. LPS upregulated expression of TLR2 (p = 0.005), TLR3 (p = 0.005), TLR6 (p = 0.012), and IL8 (p = 0.001) at 24 h. No statistically significant differences were obtained – between LPS‐stimulated and control human in vitro primary epithelial cells – for the relative gene expression of any of the other TLR receptors (p > 0.05, Figure 4).

FIGURE 4.

No significant differences were found comparing relative gene expression of TLR and IL8 between LPS‐treated and control human vocal fold epithelial cells (Mean ± SD, p > 0.05).

4. Discussion

Toll like receptors (TLRs) are essential for maintaining immunological homeostasis in other mucosal organs [8, 9, 10, 20]. Not only do they modulate epithelial barrier function in the case of commensal and pathogenic bacteria, but they also regulate inflammatory cytokine production [8, 20]. We know that the laryngeal microbiota is distinct from the gut microbiome [17], and may have significant impact on laryngeal immunology [3]. Given the important role of TLRs in regulating host‐microbial immunity in other mucosal organs [9], our first experiment sought to identify TLR expression in both human and murine laryngeal epithelium. Following immunostaining for TLR receptor‐specific antibodies, TLR 1–9 were identified in murine and human laryngeal epithelium tissue.

The murine model has similar laryngeal organization to humans [21, 22], and is therefore a suitable model for studies of laryngeal immunology [3] and microbiology [14] and certain disease pathogenesis [23, 24, 25, 26]. TLRs have been identified in murine airway, intestinal, and ocular epithelium [27], however, their specific localization in the laryngeal epithelia has not been previously reported. TLR 1–7 were localized to the apical epithelium, but TLR 8–9 were present throughout the epithelium. All TLRs, except TLR 2, were cytoplasmic. TLR 2 was nuclear in both human and murine models of laryngeal epithelium, but was found to be apical in murine models while it was basally located in humans. While TLR 2 is primarily located on the cell membrane, nuclear staining has been observed in certain cell types such as monocytes [28]. Though, it is important to also note the possibility of non‐specific antibody reactions that were present. Polar expression of TLRs is a common mechanism in airway, intestinal, and oral epithelium to prevent unnecessary inflammation from commensal organisms, which indicates there may be differences in ideal locations of ligand interaction between human and murine epithelium. Interestingly, we found TLR 3 staining in murine VF epithelium but was not found in humans.

In humans, immune cells constitutively express TLR as they drive innate and adaptive immune mechanisms. However, TLR expression in epithelial cells can be quite varied. It has been shown that the expression of TLR in epithelial cells can vary even with expected intracellular/extracellular and apical/basal localization. TLR 4, which has been shown to localize extracellularly in antigen presenting cells, has been found intracellularly within endosomes in epithelium [29]. As observed in gut, gingival, and other airway epithelium [15], TLRs 2, 4, and 5 were localized mainly to the basal epithelial cell layers in human true VFs. In the false VFs, TLR 5 seemed more diffusely spread throughout the epithelium. Structures associated with low bacterial load – such as the larynx – are associated with higher levels of TLR expression in apical epithelial cells [27]. We observed that TLRs 1, 4, 6, 7, 8, and 9 had apical presence. Since epithelial cells provide the first line of defense against microbial pathogens, it is reasonable that they have adapted the best localization for host/microbe interaction. Differences in TLR localization between epithelia of various structures further the notion that the larynx may have distinct immunological function within the airway.

TLRs in mammals have different localizations within the cell, based on the microbial ligands that they detect [10, 12, 13]. Previous literature reports TLRs 1, 2, 5, and 6 are located on the cell surface, responsible for detecting and interacting with microbial factors on the surface (example: bacterial lipoproteins [12, 13].) Consequently, some TLRs have endosomal localization and are responsible for detecting nucleic acids such as TLR 3 (detects double‐stranded RNA), TLR 7, 8 (single stranded RNA) and TLR 9 [12, 13, 26]. Interestingly, our immunohistochemistry findings in human true and false vocal fold epithelium found that all TLRs (except TLR 2) localized in the cytoplasm, with TLR 2 having a nuclear localization.

The human true VF is comprised of stratified squamous epithelium while the false VF has pseudostratified ciliated cuboidal to columnar epithelium. Cellular and functional differences may be the reason there are differences in localization of TLRs between these two adjacent structures. In bronchial epithelium, TLR 4 was shown to be intracellularly compartmentalized, hypothesized to reduce chronic airway inflammation, but was still responsive to LPS stimulation [29]. In previous studies of TLR expression in epithelia, TLR mRNA production did not necessarily correlate with detectable protein expression. In our study, TLR 3 was not histologically detected in laryngeal epithelium (both true and false VF) which is consistent with prior studies that were not able to detect TLR 3 protein expression in lung epithelium [15]. However, it has been identified in tracheal/bronchial and nasal epithelium, which indicates there may be differences in TLR expression even among structures with similar epithelial make‐up.

The false vocal fold contains a rich population of mucus‐secreting goblet cells and submucosal glands unlike the true vocal folds. These specialized cells and glands produce a combination of mucins and antimicrobial peptides, which lubricate the true vocal fold surface and aid in pathogenic defense [2, 30]. As a result, we found it essential to delineate TLR expression in both the true and false vocal fold surface. We found that TLR expression, in general, seemed to be more widely distributed within the epithelium of the false vocal folds. The first and most common response of respiratory tract epithelium to microbial pathogens is mucus production. Mucin production is directly induced by TLR expression and indirectly by IL‐8 expression [31]. This could explain why mucin‐gland rich false VF has more widely distributed TLR expression. TLR localization remains highly variable across and within studies of a specific mucosal tissue‐type and may also be affected by age, bacterial load or disease [27]. One of the limitations of immunohistochemistry is the possibility of non‐specific staining. To mitigate this, we tested several concentrations of primary and secondary antibodies to reduce non‐specific staining which has shown to be difficult in Fc receptor rich tissues like tonsils [32].

Cellular mechanisms underlying TLR‐dependent host‐microbial immune interactions have not been previously characterized in the larynx. Due to the rapid apoptosis and regeneration of vocal fold epithelial cells following mechanical, systemic, and environmental trauma [2], TLR‐dependent inflammatory processes may be difficult to study in vivo. Thus, our second experiment used a primary human vocal fold epithelium cell line [33], in vitro, to study TLR‐dependent inflammatory responses to LPS stimulation. TLR 1–9 mRNA expression has been found in nasal and tracheal/bronchial epithelium, and TLR 1, 2, 4, 5, 9 mRNA has been found in lung epithelium. We found expression of TLR 1–9 in human VF epithelium, with TLR 2, 3, 6, and IL8 having significant increases in relative gene expression following LPS stimulation for 24 h.

Since LPS is derived from gram negative bacteria, a ligand for TLR 4, we had expected an increase in expression, but there may be several reasons why these results were not replicated in our human vocal fold epithelia cell cultures. LPS‐mediated induction of TLR 4 expression is dependent on CD14 and MD2 molecules. CD14 has been found in low levels in non‐Myeloid cells such as adipocytes, hepatocytes, and intestinal epithelial cells, which produce a soluble form of the molecule [34]. To our knowledge, it is unclear whether in vitro VF epithelial cells produce soluble CD14 which is required for TLR 4 induction. We also incubated the epithelial cells with LPS for 24 h which may have missed peak time points for certain TLR expression. This could explain why IL‐8, a more downstream signaling molecule, had significantly increased expression instead. Yang et al. have shown that TLR 2 interacts with membrane‐bound CD14 to form the LPS receptor complex. LPS stimulation results in receptor oligomerization and subsequent recruitment of downstream inflammatory factors including NF‐kB and induction of genes that initiate adaptive immunity such as IL‐8 [35]. This could explain why TLR 2 had significantly increased expression. It is unclear whether TLR 6, which also had increased expression, is involved in this mechanism as it is in the response to gram positive lipopeptides by oligomerizing with TLR 2. TLR 3 usually involves a viral ligand, but Pan et al. have shown that bacterial LPS enhances the host anti‐viral response by upregulating TLR 3 expression in human peripheral blood monocytes and monocytic cell lines [36], so our results may indicate that a similar response is occurring in vocal fold epithelium. Further research is needed to elucidate the full TLR‐activated inflammatory pathway including transcription factors, effectors, and inflammatory cytokines in vocal fold epithelial cells. Overall, it is evident that more research is required to delineate TLR‐dependent pathways in healthy and pathological human vocal fold epithelia.

5. Conclusion

Toll like receptors (TLRs) 1–9 were identified in human and murine vocal fold epithelium using immunohistochemistry. TLR 1–9 were expressed in primary VF epithelial cells, with TLR 2, 3, 6, and IL8 exhibiting significantly increased expression at 24 h post‐LPS stimulation. Our data lay the groundwork for delineating TLR‐dependent vocal fold epithelial pathways in health and disease.

Conflicts of Interest

The authors declare no conflicts of interest.

Gowda M., Venkatraman A., Mechler‐Hickson A., Lungova V., and Thibeault S. L., “Toll Like Receptors in the Larynx: Implications for Laryngeal Immunology,” The Laryngoscope 135, no. 10 (2025): 3815–3823, 10.1002/lary.32366.