Skip to main content
Gut Pathogens logoLink to Gut Pathogens
. 2025 Sep 27;17:74. doi: 10.1186/s13099-025-00745-w

Helicobacter hepaticus CdtB promoted brain impairment in BALB/c mice via gut-brain axis

Yuanyuan Zhang 1,2, Linghan Yang 1,2, Yi Wang 1,2, Jun Yin 1,2, Tao Wang 1,2, Liqi Zhu 1,2,, Quan Zhang 1,2,
PMCID: PMC12476629  PMID: 41015770

Abstract

Background

Helicobacter hepaticus infection has been linked to neurodegenerative diseases, but the underlying molecular mechanism is still unclear. In this study, we established an animal model of neurodegeneration via infecting BALB/c mice with wild-type H. hepaticus (WT) and CdtB-mutant (ΔCdtB) strains to investigate the influence of CdtB on the progression of cerebral injury.

Methods

BALB/c mice were infected with either WT or ΔCdtB, and then were euthanized at 6- and 12- months post of infection (MPI). By means of histopathology and molecular biology techniques, we evaluated the colonization of H. hepaticus, colonic and cerebral pathologies, extracellular fibrillary β-amyloid (Aβ) aggregates, antigen responses, blood-brain-barrier (BBB) integrity, selected cytokines and proteins, as well as DNA damage.

Results

The findings proved that H. hepaticus successfully colonized the intestines, whereas no bacterial DNA was observed in the brains of BALB/c mice. Nevertheless, CdtB antigen was identified in the brains of mice at sampling timepoint. During infection, CdtB exacerbated colonic and cerebral pathologies, compromised BBB integrity to amplify inflammatory responses in the brain, and modified the expression of critical neuronal proteins. Moreover, CdtB was found to induce DNA double-strand breaks (DSBs) and augment Aβ deposition in murine brains at 12 MPI.

Conclusions

These data indicated that H. hepaticus infection in BALB/c mice may serve as a novel model for studying neurodegenerative diseases. Furthermore, H. hepaticus CdtB has the potential to exacerbate both neurodegenerative conditions and inflammatory responses.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13099-025-00745-w.

Keywords: Helicobacter hepaticus, CdtB, Brain impairment, Gut-brain axis

Introduction

It has been demonstrated that Alzheimer’s disease (AD) is a leading causative factor of dementia, currently affecting approximately 47 million individuals worldwide and anticipated to triple in prevalence by 2050 [1]. This neurodegenerative condition is characterized by the accumulation of β-amyloid (Aβ) protein in the brain, which leads to neuronal toxicity within the central nervous system (CNS) and progressive cognitive decline [2]. The etiology of Alzheimer’s disease is considered complex, involving factors such as gender, age, environmental influences, and family history [3]. In addition to these elements, neuroinflammation has gained prominence in the pathophysiology. However, the potential processes underlying the pathogenesis of AD have been largely unexplored.

In recent years, the gut-microbiota-brain axis (GMBA) has emerged as a prominent focus of biomedical research, with an increasing body of foundational studies supporting the notion that gut microbiota (GM) significantly influences CNS health and disorders [4, 5]. In addition, it has been reported that gut microbes can also modulate neuroinflammation and α-Synuclein pathology in rotenone-treated transgenic mice models harboring the α-Synuclein gene (SNCA), which exhibited impairments in nigrostriatal dopamine neurons and motor function [6]. Helicobacter hepaticus (H. hepaticus) is a typical intestinal pathogen associated with the GM, which can colonize both the liver and intestine of murine hosts, and serve as a principal etiological factor for several hepatic and colonic diseases in susceptible mouse strains [7]. Additionally, H. hepaticus has been identified in human bile and is linked to the risks of chronic active hepatitis [8]. Notably, extrahepatic and extracolonic manifestations resulting from H. hepaticus infection warrant further consideration. Evidence suggested that H. hepaticus was enriched in gut microbiota in AD mice models and induce tissue dysfunction and inflammatory responses in both gastrointestinal and neurological contexts, potentially linked to its role in the gut-brain axis [9, 10]. However, the exact procedures through which H. hepaticus induces neuronal impairment are still not fully elucidated.

H. hepaticus cytolethal distending toxin (CDT) is an AB2 toxin composed of three subunits: CdtA, CdtB, and CdtC. The two regulatory subunits (CdtA and CdtC) facilitate the transport of the active subunit CdtB, which induces DNA damage, ultimately leading to cell cycle arrest and apoptosis [11]. CDT is produced by a variety of Gram-negative bacterial species and displays a degree of genetic diversity [12]. Numerous studies have established that H. hepaticus CDT plays a crucial role in promoting persistent bacterial colonization and pathogenicity in some murine models [13, 14]. Furthermore, CDT can elicit immune responses in various cell types in vitro and induce the release of inflammatory cytokines [15]. Following the delivery of the toxin to target cells, which is mediated by the B subunit, CdtB plays a critical role in inducing cytotoxicity and contributing to the overall toxicity of the typhoid toxin [16]. Previous research has indicated that H. hepaticus CdtB significantly contributes to inflammation in the ileum and cecum, as well as inflammatory bowel disease (IBD) and carcinogenesis [13, 17]. However, the roles of CdtB in inducing neuronal impairment remain to be fully elucidated. Here, we show that infection with H hepaticus CdtB exacerbated neuronal impairment in BALB/c mice, and providing new insights into the understanding of CdtB-induced neurological disorders. Thus, BALB/c mice infected with H hepaticus may serve as a novel model for infectious neurodegenerative diseases that more accurately reflects neuronal impairments observed in humans.

Materials and methods

Bacterial strains

CdtB mutant strain was designed by Zhu et al. [18], and preserved in Zhang lab. H. hepaticus strain 3B1 and its mutant were prepared on Brucella agar (BD, USA) supplemented with 5% defibrinated sheep blood under microaerobic conditions (85% N2, 10% CO2, 5% O2) at 37℃ for 3 days. Two bacterial strains were resuspended in PBS containing about 1 × 109 CFU/ml when the OD600 reached 1 [19].

Mice

BALB/c mice were maintained 3–4 per cage in a room under specific pathogen-free (SPF) conditions (20–22℃, 40–60% humidity, a 12 h light/dark cycle). Mice were approved by Institutional Animal Care and Use Committee (IACUC) of Yangzhou University. All experimental procedures commenced following the approval of the Institutional Animal Care and Use Committee of China laboratory regulation Act (2022) under a Project License (SYXK(SU)2022-0044).

Study design

A total of 42 six-week-old male BALB/c mice were used for experiments, and randomly divided into three groups. After a period of adaptive feeding, mice were infected via oral gavage for 3 consecutive days with 0.2 mL PBS containing 2 × 108 CFU of either WT H. hepaticus or ΔCdtB H. hepaticus. The control group mice were received equal volumes of PBS. One week after the final inoculation, fecal sampling confirmed that the mice were infected. To observe the symptoms of encephalopathy in BALB/c mice, we decided to study a long-lasting infection beginning from 6 weeks old to 12 months. At 6- or 12-months post of infection (MPI), half mice were euthanized with Carbon Dioxide and tissue samples were collected.

DNA extraction and qPCR detection

Proximal and brain tissues were collected at low temperatures, and total DNA was extracted from the tissues following the standard method. Quantity of H. hepaticus in the colon and brain tissue samples were calculated according to HH1450 gene primers using the Applied Biosystems StepOne Real Time PCR System (ABI) as previously described [13]. Gene copy numbers of H. hepaticus were quantified relative to the amount of mouse chromosomal DNA.

Blood-brain-barrier (BBB) detection

BBB in mice was assessed using Evans blue (EB) kit (Solarbio, Beijing, China) and permeability analysis. Prior to euthanasia, mice were intravenously injected with 2% EB (4 ml/kg) as previously described [20]. Following a circulation period, the injured hemisphere was dissected and incubated in formamide solution at 37℃. Following a 48-h incubation, the tissue was centrifuged at 2000 × g for 10 min to obtain the supernatant. Finally, the quantity of extravasated EB in the sample was measured by spectrophotometry at 632 nm, and the resulting EB content was utilized to assess the BBB integrity.

Detection of H. hepaticus CdtB antigen in the brain of BALB/c mice

To confirm H. hepaticus antigen in the brain, immunofluorescence assays of bacterial protein CdtB was performed. Mice brains were sectioned into 10 mm frozen sections. The sections underwent treatment with 3% hydrogen peroxide followed by antigen retrieval using an EDTA-citrate solution before incubation with bovine serum albumin. Subsequently, the sections were incubated overnight at 4℃ with primary antibodies against H. h CdtB mAb (prepared by our laboratory, patent number CN202110937064.4). After washing with PBS, the sections were stained for appropriate 1 h with fluorophore-conjugated goat anti-mouse secondary antibodies in PBS. These sections were then examined under a fluorescence microscope.

Histopathology evaluation

At necropsy, colon and brain tissue samples were fixed in 4% paraformaldehyde solution at room temperature, and then embedded in paraffin after dehydrated in ethanol. Tissue samples were sectioned into 5-µm thick slices and stained with H&E. Histomorphology changes of the colon and brain sections were observed under the microscope.

AB-PAS staining

The number of goblet cells in the murine colon was conducted using AB-PAS staining. Specifically, acidic mucous substances were stained lake blue, while the neutral mucous substances were dyed purple blue using the AB-PAS staining kit (Solarbio, Beijing, China).

Nissl staining

To evaluate pyramidal cell neuronal injury in the cortex and hippocampus of mice, a classic nucleic acid staining method for nervous tissue was performed. In brief, the paraffin slices were stained with a 0.1% toluidine blue solution for 10 min, followed by rinsing with distilled water. The number of damaged cells in hippocampus was counted blindly under the microscope.

Thioflavin-S staining

To detect the extracellular fibrillary Aβ aggregates in the brain of BALB/c mice, a Thioflavin-S (Med Chem Express, Monmouth Junction, NJ, USA) staining was performed. Finally, Amyloid plaques were counted manually in a blinded manner with a fluorescence microscope.

Real-time PCR for selected inflammatory cytokines of mice brains

Total RNA was extracted from half brain tissue according to specifications of the FreeZol Reagent kit (Vazyme, Nanjing, China) at 6 and 12 MPI. Next, RNA was reverse transcribed by HiScript III RT SuperMix (Vazyme) with gDNA wiper. The mRNA levels of Tnf-α, Il-6, Il-1β and the housekeeping gene β-actin were detected using SYBR Green Master Mix performed on StepOne Real-Time PCR System. Relative expression of target gene mRNA calculated using the 2−ΔΔCt method. Primers used in this study as followed: (Il-6: GAGAGGAGACTTCACAGAGG, GTACTCCAGAAGACCAGAGG; Tnf-α: ACTCCAGGCGGTGCCTATGT, GTGAGGGTCTGGGCCATAGAA; Il-1β: GCAACTGTTCCTGAACTCAACT, ATCTTTTGGGGTCCGTCAACT; β-actin: GGCTGTATTCCCCTCCATCG, CCAGTTGGTAACAATGCCATGT)

Western blot for selected proteins in the brain

To assess the protein expression levels of mouse brains, the hemispheres were dissected. Subsequently, a medial fraction of brain tissue encompassing the hippocampus and temporal lobe was collected. The tissues were homogenized in RIPA lysis buffer supplemented with a protease inhibitor cocktail (Med Chem Express) using a microtube pestle. Forty micrograms of proteins were loaded onto a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and separated by electrophoresis. Next, the gels were transferred to poly vinylidene fluoride (PVDF) membranes using Gel Transfer Device. Blots were blocked at room temperature with skimmed milk, and then incubated with the primary antibodies, including Iba-1, GFAP, β-TubulinIII (1:1,000, Abcam Technology, USA) and β-actin (1:2,000, ABclonal Technology, Co., Ltd, Wuhan, China) overnight at 4℃. Subsequently, the membranes were probed with HRP-conjugated secondary antibodies for 1 h at room temperature. Finally, ECL method was utilized to detect the membranes followed by exposure on X-ray films.

Immunohistochemistry staining analysis

In accordance with specifications, paraffin-embedded sections were dewaxed and rehydrated before immunostaining. Next, the sections were treated with 3% hydrogen peroxide followed by antigen retrieval using an EDTA-citrate solution before incubation with bovine serum albumin. The sections were stained with diluted primary antibodies, including Iba-1, GFAP, β-TublinIII, γH2A (1:5,000, Abcam, United States). The sections were visualized using diaminobenzidine tetrahydrochloride (DAB) (VECTOR, United States), and then were counterstained with hematoxylin for 5 min prior to microscopic examination.

Statistical methods

All statistical data were performed using GraphPad Prism 9 statistical software. Generally, the bacterial colonization levels, EB permeability, mRNA and protein expression levels were analyzed by two-tailed Student’s t-tests. Differences were considered statistically significant when *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.

Results

Lack of CdtB gene did not influence H. hepaticus colonization in the intestines

To investigate whether ΔCdtB loses its colonization efficiency in the colon of mice, we examined the abundance of both WT and CdtB mutant in BALB/c mice throughout this study. For further determining the localization and abundance of these two strains, IHC using H. hepaticus polyclonal antibody and Quantitative PCR of colonic bacteria were detected. We proved that that H. hepaticus lack of CdtB could colonize the colon of BALB/c mice at 6 and 12 MPI (Fig. 1A). Furthermore, no significant difference of bacterial colonization was observed between the two strains (Fig. 1B). However, neither strain was detectable in the brains at both timepoints.

Fig. 1.

Fig. 1

Functional CdtB is involved in H. hepaticus-induced colonic inflammation. (A) The location of H. hepaticus in the colon of mice in WT or △CdtB H. hepaticus–infected groups at 6 and 12 months (magnification, × 200). (B) The levels of H. hepaticus in the respective samples were quantified based on the number of genomic copies per 1 µg DNA. (C) H&E-stained colon sections of mice in control, WT or △CdtB H. hepaticus–infected groups at 6 and 12 months (magnification, × 100 and × 400). (D) AB-PAS-stained colon sections of mice colon in control, WT or △CdtB H. hepaticus–infected groups at 6 and 12 months (magnification, × 200). (E) The distribution of ZO-1 in the colon of mice in control, WT or △CdtB H. hepaticus–infected groups at 6 and 12 months (magnification, × 200). (F) Transcription levels of ZO-1 in the colon of mice. (G) Protein expression of ZO-1 in the colon of mice. Data are expressed as the means ± SD (n = 7/group). Statistics were analyzed using unpaired two-tailed Student’s t test. *P < 0.05, **P < 0.01, n = 7

H. hepaticus infection induced colitis and disrupted gut barrier integrity

Histopathological examination of the colon was conducted using H&E staining to illustrate features of colonic damage. The pathological results indicated that H. hepaticus infection promoted inflammation compared to controls. In contrast, ΔCdtB H. hepaticus infection mitigated the level of inflammation at 6 and 12 MPI (Fig. 1C). The depletion of mucin-producing cells is one of the hallmark features of colitis [21]. To detect intestinal functionality and structural alterations resulting from H. hepaticus, AB-PAS staining (Fig. 1D) revealed that WT H. hepaticus infection leaded to a notable decline in the number of positive goblet cells in the colon mucosa, especially in the crypts at 6 and 12 MPI. Conversely, ΔCdtB infection led to a marked increase in both expression and distribution of mucin within goblet cells when compared to WT H. hepaticus infection at 6 MPI. Interestingly, there was no significant difference in the expression of mucin within goblet cells between the WT and ΔCdtB groups.

Tight junctions (TJs) play a pivotal role in maintaining the integrity of the intestinal mucosal barrier, which is essential for the prevention of inflammation. As shown in Fig. 1E, the levels of ZO-1, a key component of TJs, were markedly diminished in the colon of mice infected with WT H. hepaticus. Additionally, the mRNA and protein levels of colonic ZO-1 were substantially reduced in the mice infected with WT strain compared to the controls at both time points (Fig. 1F-G). However, no significant difference was observed in the expression of intestinal ZO-1 mRNA and protein between the mice infected with WT and ΔCdtB strains. These findings indicated that H. hepaticus might promote the development of colitis in BALB/c mice.

H. hepaticus infection could disrupt BBB and induce cerebral damage

To assess the influence of H. hepaticus infection on BBB integrity, we detected the brains of BALB/c mice by Evans Blue (EB) staining. As shown in Fig. 2A, no obvious EB dye was detectable in the brains of control mice at 6 MPI, whereas mild accumulation was observed at 12 MPI. In contrast, mice infected with WT and ΔCdtB strains exhibited more EB leakage in the brain at both timepoints. Furthermore, permeability assessment results indicated the residual EB content in the brain of mice infected with WT strain was higher compared to ΔCdtB infection at both timepoints (Fig. 2B). These data suggested that H. hepaticus CdtB could aggravate damage to BBB in BALB/c mice.

Fig. 2.

Fig. 2

H. hepaticus CdtB aggravated BBB disruption and cerebral damage. (A-B) BBB detection and calculation by Evans blue. (C) Immunofluorescence staining for CdtB in the brain tissue of mice infected with WT H. hepaticus at 6 and 12 months (magnification, × 200). (D) H&E staining of brain sections from control, WT or △CdtB H. hepaticus–infected mice at 6 and 12 months (magnification, × 200). Data are expressed as the means ± SD (n = 7/group). Statistics were analyzed using unpaired two-tailed Student’s t test. **P < 0.01, ****P < 0.0001, n = 7

To evaluate the penetration effect, mice brain responses to H. hepaticus CdtB antigen was characterized. As illustrated in Fig. 2C, the CdtB was observed in the brain of mice infected with WT H. hepaticus. Our findings imply that prolonged infection with H. hepaticus may result in the intrusion of bacterial elements into the brain, even in the absence of the live bacteria presence within the central nervous system.

To further evaluate the pathological consequences of brain injury following H. hepaticus infection, HE staining was employed to access the neuronal damage and degeneration in mice. As shown in Fig. 2D, the HE staining indicated that neuron cells of BALB/c mice in control group exhibited regular morphology with well-defined borders, uniformly stained nuclei, and evenly distributed intercellular substance. In contrast, the neurocytes in the brains of male BALB/c mice infected with WT H. hepaticus exhibited a disorganized arrangement accompanied by cytoplasmic loosening, tissue swelling, pyknosis of nuclei, and shrunken cell bodies at 6 and 12 MPI. More precisely, the CA3 region exhibited comparable structural disorder in infections with both strains compared to the uninfected mice. Furthermore, ΔCdtB infection led to a reduction in pathological damage within both the cortex and dentate gyrus (DG) regions. However, no significant alterations were observed in the CA1 region across all treatment groups. These findings indicated that CdtB could aggravate the cerebral pathology in BALB/c mice during H. hepaticus infection.

H. hepaticus infection decreased the number of Nissl body

To investigate the impact of neuronal death and degeneration following H. hepaticus infection, Nissl staining was performed on the brains of BALB/c mice (Fig. 3A). The results revealed that distinct visualization of neurons in the control group, with abundant presence of Nissl bodies in their cytoplasm. The pyramidal neurons exhibited marked sparsity and disorganization, characterized by a significant reduction in Nissl bodies and their abundance in H. hepaticus infection at 6 and 12 MPI compared to the control mice. However, the neuronal structural disorder observed in mice infected with ΔCdtB was significantly mitigated, particularly in the DG region. Statistical analysis of Nissl staining revealed that the number of Nissl-stained neurons in the cortex, as well as in the CA and DG regions, was significantly reduced in mice infected with WT compared to controls at both 6 and 12 MPI (Fig. 3B). Notably, ΔCdtB infection significantly reduced the population of Nissl-stained neurons predominantly within the cortex at both time points. In addition, ΔCdtB infection increased the number of Nissl body in the CA and DG regions at 6 and 12 MPI compared to WT infection. These results indicate that CdtB could exacerbate cerebral injury through the disruption of Nissl bodies.

Fig. 3.

Fig. 3

Impact of CdtB on Nissl body count and the accumulation of amyloid-β (Aβ). (A) Nissl-stained brain sections of mice in control, WT or △CdtB H. hepaticus–infected groups at 6 and 12 months (magnification, × 200). (B) Quantification of Nissl bodies in different regions of mice brain. (C) Thioflavin-S staining of brain sections from control, WT, and △CdtB H. hepaticus-infected mice at 6 and 12 months (magnification, × 200). Data are expressed as the means ± SD (n = 7). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n = 7

H. hepaticus infection promoted the accumulation of Aβ in the brain

Amyloid plaques are primarily composed of various forms of Aβ1−42, which can cause neuron damage and loss, thereby leading to a decline in cognitive abilities [22]. To further explore the relationship between neuronal deaths and AD, we assessed Aβ deposition within the hippocampus and cortex using ThS staining. The results showed that H. hepaticus infection substantially increased β-sheet-rich amyloid plaques in both the cortex and CA3 region of mice brains (Fig. 3C). However, the mice infected with ΔCdtB led to a significant decrease of β-amyloid deposition in the brain compared to WT strain. Our findings suggest that CdtB could increase Aβ deposition in the brain of mice infected with H. hepaticus.

H. hepaticus infection induced infiltration of gliocyte and damaged nerve cells

To investigate the impact of CdtB on the cerebral cells, we assessed glial fibrillary acidic protein (GFAP), Ionized calcium-binding adapter molecule 1 (Iba-1), and Class III β-tubulin (βIII-tubulin), which serve as reliable biomarkers for astrocytes, microglia, and neurons. The results indicated that either WT or ΔCdtB infection can increase the gliocyte expression of GFAP and Iba-1 in the brain of mice compared to the controls (Fig. 4A and D). When compared to CdtB mutant groups, mice infected with WT exhibited higher cerebral expression levels. βIII-tubulin is a microtubule-associated protein belonging to the tubulin family that is expressed predominantly in neurons [23]. The results showed that mice infected with WT or ΔCdtB decreased the cerebral protein expression level of βIII-tubulin compared to the controls, suggesting that H. hepaticus infection could induce neuronal damage (Fig. 4E and F). These data suggest that H. hepaticus may activate astrocytes and microglia while simultaneously suppressing neuronal activity. Furthermore, CdtB can be considered a potential contributor to cerebral cell dysfunction.

Fig. 4.

Fig. 4

Impact of CdtB on glial cells and neuronal cells. (A, C, E) Immunohistochemistry of GFAP, Iba1 and βIII-tubulin in the brain of mice in the control, WT or △CdtB H. hepaticus–infected group at 6 and 12 months (magnification, × 200). (B, D, E) Western blotting and analysis of GFAP, Iba1 and βIII-tubulin in the brain of mice in the control, WT or △CdtB H. hepaticus–infected group at 6 and 12 months. Data are expressed as the means ± SD (n = 7). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n = 7

H. hepaticus CdtB could enhance cerebral Proinflammatory response and induce DSB in BALB/c mice

To elucidate the features potentially associated with CdtB-induced progression of cerebral injury, we further detected mRNA levels associated with inflammatory genes (Fig. 5A). Infection with WT significantly elevated the mRNA levels of Tnf-α and Il-β when compared to ΔCdtB at 6 MPI, while Il-6 was notably increased at 12 MPI in the brain. In contrast, there was no significant difference in the mRNA levels of Il-6 between WT and ΔCdtB at 6 MPI or for Tnf-α at 12 MPI. When compared to controls, the brain of mice infected with WT contained higher mRNA levels of all target cytokines at 12 MPI. Additionally, mRNA expressions of Il-β and Tnf-α were upregulated at 6 MPI. Furthermore, ΔCdtB increased expression of Il-β at all timepoints and Tnf-α specifically at 12 MPI when compared to controls. These findings suggested that the CdtB toxin enhanced the transcriptional upregulation of a subset of proinflammatory cytokines, thereby contributing to the inflammatory milieu in the brain.

Fig. 5.

Fig. 5

H. hepaticus CdtB exacerbated neural inflammation and induced DNA DSBs, (A) Cytokine transcription levels in the brain of mice in the control, WT or △CdtB H. hepaticus–infected group at 6 and 12 months. For comparison of mRNA levels, the target mRNA was normalized to that of the house-keeping gene β-actin. Data are expressed as the means ± SD (n = 7). (B) γH2AX immunohistochemistry from the brain of mice in the control, WT or △CdtB H. hepaticus–infected group at 6 and 12 months (magnification, × 200). Data are expressed as the means ± SD (n = 7). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, n = 7

DSBs represent one type of detrimental DNA damage, potentially leading to genomic instability if not adequately repaired [24]. To evaluate the effects of CdtB on host DNA damage, γH2AX staining, a highly sensitive biomarker for detecting DSB was performed (Fig. 5B). The results showed that γH2AX was expressed in neuron, suggesting that H. hepaticus infection induced damage to neuronal cells. Compared to WT strain, mice infected with ΔCdtB exhibited fewer γ-H2AX positive cells in the brains at 6 and 12 MPI. In conjunction with our findings on the expression of γH2AX, these observations suggest that DNA damage associated with CdtB is a hallmark characteristic of AD.

Discussion

Gut microbiota is primarily known for its crucial role in adjusting the bidirectional communication between the brain and the gastrointestinal tract, providing insights into the pathogenesis of AD [25]. The signaling along gut-brain axis is modulated by a diverse array of intrinsic and extrinsic stimuli that influence both central and enteric nervous system activities. This interaction is facilitated by a dynamic equilibrium involving intricate regulation associated with the vagus nerve, immune responses, and metabolites produced by gut microbiota. H. hepaticus is recognized for its role in inducing chronic hepatitis and hepatocellular carcinoma, as well as contributing to dysbiosis within the gut microbiome of certain mouse strains [26]. In this study, we found that H. hepaticus infection could elicit neurological-like symptoms in murine models, while CdtB exacerbated brain injury via the gut-brain axis.

Research shows that H. hepaticus can colonize the intestine and is associated with various intestinal and extraintestinal diseases in rodents, including nerve problems [9]. An appropriate model should be established to facilitate their investigation. Accordingly, we infected BALB/c mice, a highly susceptible mouse strain, with H. hepaticus over an extended period. Unlike transgenic mouse models, the infection model more closely reflects the clinical phenotype, providing insights into how hospitalized patients may be at increased risk of infection, which could progress to systemic infection through circulation and potentially contribute to neurodegenerative diseases by compromising the gut-brain axis.

It has been shown that intestinal mucus barrier serves to safeguard the epithelial cells and the underlying immune system from contact with bacteria and false activation [27]. Chronic progressive inflammation and oxidative stress, resulting from prolonged intestinal colonization of H. hepaticus, can compromise the integrity of the intestinal epithelial barrier, thereby enhancing intestinal permeability in immunodeficient mice [28]. Our previous study demonstrated that CdtB is not essential for intestinal colonization of H. hepaticus in B6.129P2-IL10tm1Cgn/J mice [18]. In this study, both ΔCdtB and WT H. hepaticus exhibited comparable levels of intestinal colonization in BALB/c mice, suggesting that lack of CdtB did not affect the colonization efficiency at either time point. However, WT H. hepaticus infection resulted in more severe colitis and reduced mucus production compared to the mutant strain at 6 MPI, indicating that CdtB of H. hepaticus played a crucial role in enhancing the inflammatory response. In addition, we found that ΔCdtB infection could also lead to a significant decrease in the expression of mucin within goblet cells at 12 MPI. A potential explanation for the increased disease severity in ΔCdtB-infected mice is an impaired ability to control bacterial proliferation. The disruption of the intestinal barrier constitutes a critical mechanism in the pathogenesis of colitis induced by intestinal pathogens. It has been documented that H. hepaticus disrupts the tight junction proteins by altering the membrane localization of ZO-1 in colonic epithelial cells, which leads to decrease ZO-1 expression in the colon of Il-17a−/− mice [29]. Similarly, our results also exhibited the substantial impact of H. hepaticus infection on the expression levels of ZO-1 in the colon compared to the control. In alignment with our prior findings, CdtB did not influence the integrity of tight junctions in the colon during infection, thus both strains and their derivatives possess a comparable capacity to penetrate colonic barriers to reach other tissues [18]. We hypothesized that H. hepaticus infection may perturb gut microbiota composition, which compromised the intestinal barrier integrity in BALB/c mice. To further investigate potential mechanisms involved, fecal microbiota sequencing will be necessary for future research.

Ectopic colonization of H. hepaticus from the gut has been widely observed. Substantial evidence suggests that the dysregulated gut microbiota is correlated with structural modifications in the BBB, characterized by a diminished expression of tight junction proteins, which results in enhanced permeability when compared to conventional specific pathogen-free (SPF) mice [30]. Our findings indicated that H. hepaticus infection can compromise BBB integrity via the gut-brain axis, with CdtB antigen detected in the brain, suggesting that CdtB of H. hepaticus may sabotage cerebral defenses during prolonged exposure. However, the initial site of infection and the mechanisms by which H. hepaticus reach the brain remain unclear. As reported, secreted outer membrane vesicles (OMVs) have emerged as a significant contributor to bacterial pathogenesis [31]. H. hepaticus was not detectable in the brains at either timepoint, supporting the hypothesis that OMVs may serve as mediators capable of transporting CdtB virulence factors associated with this poorly invasive bacterium. Consequently, H. hepaticus virulence factors may possess the capacity to breach the BBB, although this mechanism remains incompletely understood.

Non-neuronal cells in the brain, including microglia and astrocytes, play a pivotal role in providing metabolic support, regulating neurotransmitter levels, maintaining the blood-brain barrier, and directly modulating behaviors in mice [32]. Following brain injury, both microglia and astrocytes can be activated, resulting in significant alterations to their morphology, phagocytic capacity, and polarization status. This process culminates in an excessive production of inflammatory mediators that further exacerbate tissue damage [33]. Evidence has elucidated that the gut microbiota, along with its derivatives, can regulate astrocytes activity in both health and disease [34]. Furthermore, microglia serve as a primary responder to beta-amyloid (Aβ) plaques, which also necessitate microbiota-dependent effects [35]. Our study found that GFAP and Iba1, markers indicative of activated astrocytes and microglia, were significantly upregulated in mice infected with H. hepaticus. Additional research from clinical, studies as well as preclinical and postmortem analyses has reported that depressive-like conditions are associated with a decrease in the number or density of astrocytes and their function [36]. Considering these diverse outcomes, it is evident that the quantity and functionality of astrocytes vary across different diseases. Consequently, a comprehensive elucidation of astrocyte dynamic responses in Alzheimer’s disease is imperative for future investigations. A previous study has highlighted that fecal supernatant could induce remodeling of neuronal and glial protein expression within colons of murine models exhibiting autism spectrum disorder, while concurrently decreasing protein levels of βIII-tubulin [37]. Our study revealed that H. hepaticus infection resulted in a reduction in βIII-tubulin protein levels despite no detectable bacteria present in the brains of BALB/c mice. One possibility is that high abundance of H. hepaticus in the colon may secret virulence capable of disrupting neuronal function alongside synaptic connections throughout the nervous system. Consequently, there is increasing focus on the regulation of gut microbiota as a therapeutic strategy for addressing cognitive impairment along with associated disorders.

Traditionally, the amyloid hypothesis posits that Aβ is a detrimental byproduct, with its excessive accumulation promoting the development of AD. Recent findings have suggested that Aβ may also function as an antimicrobial peptide (AMP), providing defense against bacteria, fungi, and viruses in AD [38, 39]. These observations further corroborated our results that H. hepaticus was unable to colonize in the brains of mice. However, bacterial components in the bloodstream can activate the TLR2/NF-κB signaling pathway, facilitating the transport of circulating Aβ across the BBB into the brain [40]. In addition, on exposure to Aβ can activate microglia, resulting in the release of cytokines and impairing their phagocytic and degradative capabilities [41]. It has been established that inflammation is a key inducer of barrier dysfunction caused by bacterial pathogens and derivatives [42]. Many Gram-negative bacteria harboring CDT-encoding genes are significant human and animal pathogens. Structural features of CdtB suggestive of a nuclease function are supported by evidence demonstrating that recombinant EcolCdtB-II, AactCDT, and HhepCdtB can digest bacterial plasmid DNA, and that exposure to CjejCdtB or HducCDT induces DNA double-strand breaks (DSBs) in mammalian cells [43]. Furthermore, CDT has been classified as an inhibitory cyclomodulin based on its ability to modulate the cell cycle and induce cell death, as endonuclease-mediated DNA damage is essential for CdtB-mediated cellular toxicity [44]. Another study showed that Elevated levels of autophagy and apoptosis contribute to neuronal loss in neurodegenerative diseases. CdtB can activate immune-inflammatory response systems (IRS), host cell DNA apoptosis, neuroinflammation and oxidative stress [45]. In this study, CdtB was found to upregulate transcription levels of cerebral Il-6, Tnf-α and Il-1β while increasing the number of γH2AX foci+ cells, suggesting that CdtB of H. hepaticus promoted cerebral inflammation by linking its ability to induce DNA damage with enhanced production of Aβ. Given that DSB can trigger apoptosis and cell death, we propose that DSB abnormalities represent a general pathway leading to neuronal loss via apoptosis in neurodegenerative disorders. Taken together, these findings suggested that H. hepaticus infection could induce brain damage of BALB/c mice associated with AD pathology. Notably, CdtB plays a significant role in the promotion of cerebral inflammation, indicating that the impact of bacterial CDT on brain pathogenicity warrants further investigation.

Conclusions

In conclusion, our findings suggest that H. hepaticus CdtB can promote cerebral infection, proinflammatory responses and induction of brain injury. We provide a new and constructive model for analyzing the relationship and influence between intestinal pathogenic microbial infections and neurodegenerative diseases.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (3.8MB, pptx)

Author contributions

The authors declare they have no conflicts of interest. Conceptualization: Y. Z.; methodology: L. Z. and L. Y; writing and editing: Y. Z.; investigation: T. W., Y. W. and Q. Z.; supervision, project administration and funding acquisition: Q. Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (32273004), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Liqi Zhu, Email: zhuliqi@yzu.edu.cn.

Quan Zhang, Email: zquan@yzu.edu.cn.

References

  • 1.Scheltens P, De Strooper B, Kivipelto M, et al. Alzheimer’s disease. Lancet. 2021;397(10284):1577–90. 10.1016/S0140-6736(20)32205-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hohenfeld C, Kuhn H, Muller C, et al. Changes in brain activation related to visuo-spatial memory after real-time fMRI neurofeedback training in healthy elderly and alzheimer’s disease. Behav Brain Res. 2020;381:112435. 10.1016/j.bbr.2019.112435 [DOI] [PubMed] [Google Scholar]
  • 3.Ma C, Hong F, Yang S. Amyloidosis in Alzheimer’s disease: pathogeny, etiology, and related therapeutic directions. Molecules. 2022;27(4):1210. 10.3390/molecules27041210 [DOI] [PMC free article] [PubMed]
  • 4.Kim MS, Kim Y, Choi H et al. Transfer of a healthy microbiota reduces amyloid and tau pathology in an Alzheimer’s disease animal model. Gut. 2020;69(2):283–94. 10.1136/gutjnl-2018-317431 [DOI] [PubMed]
  • 5.Cryan JF, O’Riordan KJ, Sandhu K, Peterson V, Dinan TG. The gut microbiome in neurological disorders. Lancet Neurol. 2020;19(2):179–94. 10.1016/S1474-4422(19)30356-4 [DOI] [PubMed] [Google Scholar]
  • 6.Sampson TR, Debelius JW, Thron T et al. Gut microbiota regulate motor deficits and neuroinflammation in a model of Parkinson’s disease. Cell. 2016;167(6):1469–e14801412. 10.1016/j.cell.2016.11.018 [DOI] [PMC free article] [PubMed]
  • 7.Liyanage NP, Dassanayake RP, Kuszynski CA, Duhamel GE. Contribution of Helicobacter hepaticus cytolethal distending toxin subunits to human epithelial cell cycle arrest and apoptotic death in vitro. Helicobacter. 2013;18(6):433–43. 10.1111/hel.12084 [DOI] [PMC free article] [PubMed]
  • 8.Nilsson I, Lindgren S, Eriksson S, Wadstrom T. Serum antibodies to Helicobacter hepaticus and Helicobacter pylori in patients with chronic liver disease. Gut. 2000;46(3):410–4. 10.1136/gut.46.3.410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ahn EH, Liu X, Alam AM, Kang SS, Ye K. Helicobacter hepaticus augmentation triggers Dopaminergic degeneration and motor disorders in mice with Parkinson’s disease. Mol Psychiatry. 2023;28(3):1337–50. 10.1038/s41380-022-01910-2 [DOI] [PubMed]
  • 10.Liu Q, Xie T, Xi Y, et al., et al. Sesamol attenuates amyloid peptide accumulation and cognitive deficits in APP/PS1 mice: the mediating role of the gut-brain axis. J Agric Food Chem. 2021;69(43):12717–29. 10.1021/acs.jafc.1c04687 [DOI] [PubMed] [Google Scholar]
  • 11.Martin OCB, Frisan T, Bacterial Genotoxin-Induced DNA. Damage and modulation of the host immune microenvironment. Toxins (Basel). 2020;12(2):63. 10.3390/toxins12020063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gargi A, Reno M, Blanke SR. Bacterial toxin modulation of the eukaryotic cell cycle: are all cytolethal distending toxins created equally? Front Cell Infect Microbiol. 2012;2:124. 10.3389/fcimb.2012.00124 [DOI] [PMC free article] [PubMed]
  • 13.Ge Z, Feng Y, Whary MT et al. Cytolethal distending toxin is essential for Helicobacter hepaticus colonization in outbred Swiss Webster mice. Infect Immun. 2005;73(6):3559–67. 10.1128/IAI.73.6.3559-3567.2005 [DOI] [PMC free article] [PubMed]
  • 14.Pratt JS, Sachen KL, Wood HD, Eaton KA, Young VB. Modulation of host immune responses by the cytolethal distending toxin of Helicobacter hepaticus. Infect Immun. 2006;74(8):4496–504. 10.1128/IAI.00503-06 [DOI] [PMC free article] [PubMed]
  • 15.Pere-Vedrenne C, Cardinaud B, Varon C et al. The cytolethal distending toxin subunit CdtB of Helicobacter induces a Th17-related and antimicrobial signature in intestinal and hepatic cells in vitro. J Infect Dis. 2016;213(12):1979–89. 10.1093/infdis/jiw042 [DOI] [PubMed]
  • 16.Ahn C, Yang YA, Neupane DP, et al. Mechanisms of typhoid toxin neutralization by antibodies targeting glycan receptor binding and nuclease subunits. iScience. 2021;24(5):102454. 10.1016/j.isci.2021.102454 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ge Z, Feng Y, Ge L et al. Helicobacter hepaticus cytolethal distending toxin promotes intestinal carcinogenesis in 129Rag2-deficient mice. Cell Microbiol. 2017;19(7):12728. 10.1111/cmi.12728 [DOI] [PMC free article] [PubMed]
  • 18.Zhu L, Zhu C, Cao S, Zhang Q. Helicobacter hepaticus induce colitis in male IL-10(-/-) mice dependent by cytolethal distending toxin B and via the activation of jak/stat signaling pathway. Front Cell Infect Microbiol. 2021;11:616218. 10.3389/fcimb.2021.616218 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xu M, Pokrovskii M, Ding Y et al. c-MAF-dependent regulatory T cells mediate immunological tolerance to a gut pathobiont. Nat. 2018;554(7692):373–7. 10.1038/nature25500 [DOI] [PMC free article] [PubMed]
  • 20.Li Y, Liu B, Zhao T, et al. Comparative study of extracellular vesicles derived from mesenchymal stem cells and brain endothelial cells attenuating blood-brain barrier permeability via regulating Caveolin-1-dependent ZO-1 and Claudin-5 endocytosis in acute ischemic stroke. J Nanobiotechnol. 2023;21(1):70. 10.1186/s12951-023-01828-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.van der Post S, Jabbar KS, Birchenough G et al. Structural weakening of the colonic mucus barrier is an early event in ulcerative colitis pathogenesis. Gut. 2019;68(12):2142–51. 10.1136/gutjnl-2018-317571 [DOI] [PMC free article] [PubMed]
  • 22.Min JH, Sarlus H, Oasa S, Harris RA. Thioflavin-T: application as a neuronal body and nucleolar stain and the blue light photo enhancement effect. Sci Rep. 2024;14(1):24846. 10.1038/s41598-024-74359-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Palacios E, Lobos-González L, Guerrero S, et al. Helicobacter pylori outer membrane vesicles induce astrocyte reactivity through nuclear factor-κappa B activation and cause neuronal damage in vivo in a murine model. J Neuroinflammation. 2023;20(1):66. 10.1186/s12974-023-02728-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Gao Z, Luan X, Wang X et al. DNA damage response-related NcRNAs as regulators of therapy resistance in cancer. Front Pharmacol. 2024;15:1390300. 10.3389/fphar.2024.1390300 [DOI] [PMC free article] [PubMed]
  • 25.Megur A, Baltriukiene D, Bukelskiene V, Burokas A. The microbiota-gut-brain axis and alzheimer’s disease: neuroinflammation is to blame?? Nutrients. 2020;13(1):37. 10.3390/nu13010037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Cao S, Miao J, Qian M et al. Helicobacter hepaticus infection promotes the progression of liver preneoplasia in balb/c mice via the activation and accumulation of high-mobility group box-1. Front microbiol. 2021;12:789752. 10.3389/fmicb.2021.789752 [DOI] [PMC free article] [PubMed]
  • 27.Kobayashi T, Siegmund B, Le Berre C, et al. Ulcerative colitis. Nat Rev Dis Primers. 2020;6(1):74. 10.1038/s41572-020-0205-x [DOI] [PubMed] [Google Scholar]
  • 28.Jeffery R, Ilott NE, Powrie F. Genetic and environmental factors shape the host response to Helicobacter hepaticus: insights into IBD pathogenesis. Curr Opin Microbiol. 2022;65:145–55. 10.1016/j.mib.2021.10.012 [DOI] [PubMed] [Google Scholar]
  • 29.Zhu L, Wu Z, Zhu C et al. The deletion of IL-17A enhances Helicobacter hepaticus colonization and triggers colitis. J Inflamm Res. 2022;15:2761–73. 10.2147/JIR.S359100 [DOI] [PMC free article] [PubMed] [Retracted]
  • 30.Braniste V, Al-Asmakh M, Kowal C, et al. The gut microbiota influences blood-brain barrier permeability in mice. Sci Transl Med. 2014;6(263):263ra158. 10.1126/scitranslmed.3009759 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Turner L, Bitto NJ, Steer DL, et al. Helicobacter pylori outer membrane vesicle size determines their mechanisms of host cell entry and protein content. Front Immunol. 2018;9(1466). 10.3389/fimmu.2018.01466 [DOI] [PMC free article] [PubMed]
  • 32.Cho WH, Noh K, Lee BH, et al. Hippocampal astrocytes modulate anxiety-like behavior. Nat Commun. 2022;13(1):6536. 10.1038/s41467-022-34201-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hu X, Leak RK, Shi Y, et al. Microglial and macrophage polarization-new prospects for brain repair. Nat Rev Neurol. 2015;11(1):56–64. 10.1038/nrneurol.2014.207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Loh JS, Mak WQ, Tan LKS, et al. Microbiota-gut-brain axis and its therapeutic applications in neurodegenerative diseases. Signal Transduct Target Ther. 2024;9(1):37. 10.1038/s41392-024-01743-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zeng H, Huang J, Zhou H et al. Integrative in situ mapping of single-cell transcriptional states and tissue histopathology in a mouse model of Alzheimer’s disease. Nat Neurosci. 2023;26(3):430–46. 10.1038/s41593-022-01251-x [DOI] [PMC free article] [PubMed]
  • 36.Rial D, Lemos C, Pinheiro H, et al. Depression as a glial-based synaptic dysfunction. Front Cell Neurosci. 2015;9:521. 10.3389/fncel.2015.00521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Gonzales J, Marchix J, Aymeric L, et al. Fecal supernatant from adult with autism spectrum disorder alters digestive functions, intestinal epithelial barrier, and enteric nervous system. Microorganisms. 2021;9(8):1723. 10.3390/microorganisms9081723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Fulop T, Witkowski JM, Bourgade K et al. Can an infection hypothesis explain the beta amyloid hypothesis of Alzheimer’s disease? Front Aging Neurosci. 2018;10:224. 10.3389/fnagi.2018.00224 [DOI] [PMC free article] [PubMed]
  • 39.Vigasova D, Nemergut M, Liskova B, Damborsky J. Multi-pathogen infections and alzheimer’s disease. Microb Cell Fact. 2021;20(1):25. 10.1186/s12934-021-01520-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Nie R, Wu Z, Ni J, et al. Porphyromonas gingivalis infection induces amyloid-beta accumulation in monocytes/macrophages. J Alzheimers Dis. 2019;72(2):479–94. 10.3233/JAD-190298 [DOI] [PubMed] [Google Scholar]
  • 41.Jiang T, Zhang YD, Gao Q et al. TREM2 ameliorates neuronal tau pathology through suppression of microglial inflammatory response. Inflammation. 2018;41(3):811–823. 10.1007/s10753-018-0735-5 [DOI] [PubMed]
  • 42.Butkevych E, Lobo de Sá FD, Nattramilarasu PK, Bücker R. Contribution of epithelial apoptosis and subepithelial immune responses in campylobacter jejuni-induced barrier disruption. Front Microbiol. 2020;11:344. 10.3389/fmicb.2020.00344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jinadasa RN, Bloom SE, Weiss RS, Duhamel GE. Cytolethal distending toxin: a conserved bacterial genotoxin that blocks cell cycle progression, leading to apoptosis of a broad range of mammalian cell lineages. Microbiology. 2011;157(Pt 7):1851–75. 10.1099/mic.0.049536-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Oswald E, Nougayrède JP, Taieb F, Sugai M. Bacterial toxins that modulate host cell-cycle progression. Curr Opin Microbiol. 2005;8(1):83–91. 10.1016/j.mib.2004.12.011 [DOI] [PubMed] [Google Scholar]
  • 45.Thisayakorn P, Thipakorn Y, Tantavisut S, et al. Increased IgA-mediated responses to the gut paracellular pathway and blood-brain barrier proteins predict delirium due to hip fracture in older adults. Front Neurol. 2024;15(1294689). 10.3389/fneur.2024.1294689 [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (3.8MB, pptx)

Data Availability Statement

No datasets were generated or analysed during the current study.


Articles from Gut Pathogens are provided here courtesy of BMC

RESOURCES