Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2025 Sep 11;104(11):105818. doi: 10.1016/j.psj.2025.105818

Baicalin alleviates oxidative stress in DF-1 cell line via the Mfn2/MAMs/Ca (2+) pathway

Zhaoyan Lin a,b, Jiao Wang a,b, Junxin Li a,b, Yu Zheng a,b, Bohan Zheng a,b, Qinjin Li a,b, Xiaohong Huang a,b,⁎
PMCID: PMC12483671  PMID: 40974997

Abstract

Oxidative stress is intricately associated with a variety of chicken diseases, and represents a significant challenge within the poultry industry. Baicalin (BA), a compound extracted from the plant Scutellaria Baicalensis, possesses potent antioxidant properties, however, the effects and mechanisms underlying the antioxidant activity of BA in chickens remain to be fully elucidated. This study aimed to demonstrate the antioxidant effects of BA in vitro, and to explore the underlying antioxidant mechanism. In this study, hydrogen peroxide (H2O2) was used to construct a model of oxidative stress in DF-1 cell line, and the antioxidant effect of BA in DF-1 cells was detected. The results indicated that BA significantly ameliorated the decline in total antioxidant capacity of DF-1 cells induced by H2O2, and preserved the mitochondrial function of DF-1 cells. Concurrently, H2O2 induced abnormal enrichment of mitochondria⁃associated membranes (MAMs) in DF-1 cells, leading to mitochondrial Ca2+ overload, and BA significantly mitigated this effect. Furthermore, transcriptomic sequencing and western blot analysis suggested that the Mitofusin-2 (Mfn2) gene is involved in the antioxidant process of BA. Moreover, following the siRNA-mediated interference of the Mfn2 gene, the antioxidant efficacy of BA was observed to be significantly diminished. In conclusion, BA alleviates H2O2-induced oxidative stress in DF-1 cells via the Mfn2/MAMs/Ca2+ pathway.

Keywords: Baicalin, Oxidative stress, Ca2+, MAM, Mfn2

Introduction

Oxidative stress refers to an imbalance in the oxidative-antioxidant system, resulting in the accumulation of excessive reactive oxygen species (ROS) and damage to biological macromolecules such as nucleic acids, proteins and lipids (Halliwell and Whiteman, 2004; Jaganjac et al., 2022). In the poultry industry, pathological states of oxidative stress can adversely affect both the survival rate and meat quality of chickens (Oke et al., 2024). Therefore, oxidative stress remains one of the pressing issues to be addressed in the poultry industry.

As an important second messenger in cells, Ca2+ is closely related to cell mproliferation, programmed death, muscle-stimulated contraction, gene transcription, and signal transmission (Cardanho-Ramos and Morais, 2021). Under conditions of oxidative stress, the intracellular Ca2+ homeostasis is disrupted (X. Liu et al., 2022). The intracellular Ca2+ and ROS signaling systems can influence each other, dysfunction in either system may exacerbate detrimental effects, thereby contributing to the pathogenesis of various disorders (Görlach et al., 2015).

Mitochondria-associated membranes (MAMs) are sites of close apposition between the mitochondria and the endoplasmic reticulum (ER), serving as a platform for material exchange and signal transduction between the two organelles, they are intimately involved in protein folding, lipid synthesis, and Ca2+ transport (Rodríguez-Arribas et al., 2017; Wang et al., 2021). Generally, Ca2+ stored in ER are conveyed to the mitochondria through MAMs, however, under pathological conditions, an abnormal enrichment of MAMs occurs, allowing a large influx of Ca2+ into the mitochondria, and leads to mitochondrial Ca2+ overload, subsequently triggers oxidative damage (Barazzuol et al., 2021; Wang et al., 2021). Therefore, modulating the abnormal enrichment of MAMs to prevent mitochondrial Ca2+ overload might represent a potential strategy for combating oxidative stress.

Mitofusin-2 (Mfn2) is a key regulator of mitochondrial fusion, which helps mitochondria resist oxidative damage (M. Ding et al., 2022a). Studies have shown that Mfn2 is also enriched in MAMs, serves as an important factor in the regulation of MAMs formation and Ca2+ transport (Cao et al., 2021; Yang et al., 2023).

Baicalin (BA), a flavonoid compound extracted from Scutellaria Baicalensis, exhibits low water solubility but good lipophilicity (Zhu et al., 2021). Its degradation is influenced by pH and temperature (Xing et al., 2005), in vivo data indicate that the concentration of BA in chicken lung tissue is higher than that in plasma (Bao et al., 2021). BA possesses a spectrum of biological activities, including antioxidant (Bai et al., 2023; Liang et al., 2023; W. J. Liu et al., 2025; Ma et al., 2021; Shi et al., 2022), antitumor (R. J. Wen et al., 2023a), anti-inflammatory (He and He, 2023; Y. b), and antibacterial (Fu et al., 2024; Perruchot et al., 2019) properties. BA has been reported to alleviate heat stress and Mycoplasma Gallisepticum infection in chickens (Zmrhal et al., 2023; Zou et al., 2021), however, the direct impact and potential mechanisms of BA on poultry oxidative stress remain unclear.

In present study, the in vitro antioxidant capability of BA in chicken was detected, and the relationship between BA and the Mfn2/MAMs/Ca2+ signaling pathway was explored. The results contribute to elucidating the antioxidant mechanism of BA and the potential future application of BA in combating oxidative stress in poultry industry.

Materials and methods

Cell maintenance

Chicken fibroblast cell line (DF-1, Institute of Basic Medical Sciences, Beijing, China) were cultured in DMEM (Thermo Scientific, Waltham, USA), with 10 % fetal bovine serum (FBS, Thermo Scientific, Waltham, USA) and 1 % penicillin/streptomycin (Solarbio Life Sciences, Beijing, China). Cells were cultured at 37°C in a 5 % CO2 humidified incubator.

Drug treatment

BA was purchased from MedChemExpress Inc. (Monmouth Junction, NJ, USA) and was dissolved in dimethyl sulfoxide (DMSO). H2O2 (3 %) was purchased from Hengjian Pharmaceutical Co., Ltd (Guangdong, China), and was diluted in doble distilled water (ddH2O). DF-1 cells were treated with different doses of BA for 24 h, then BA was removed, cells were incubated with culture medium containing 500 μM H2O2 for another 4 h before subsequent experiments. The control treatment for the assays was administered using DMSO at an equivalent concentration to that of the BA treatment.

Cell viability assay

Cell viability was detected by Cell Counting Kit 8 (CCK-8, Glpbio, Montclair, CA, USA). Briefly, DF-1 cells (1 × 104 cells/mL) were plated in 96-well plates and treated with different doses of drugs. Then the CCK-8 reagent was added into the wells and cells were incubated for 1 h. The OD450nm value of each well was measured using a microplate reader (Molecular Devices, 22202-SANGMSMA1, Shanghai, China). The mean optical density (OD, absorbance) of five wells in the indicated groups was used to calculate the percentage of cell viability as follows: percentage of cell viability = Atreatment/Acontrol × 100 % (where A = absorbance). The average absorbance of the control group was set to 100 %. The experiments were carried out in triplicate (n = 3).

Antioxidant capacity assay

The total antioxidant capacity of cells was detected using the total antioxidant capacity assay kit with ferric reducing ability of plasma (FRAP) method (Beyotime Biotechnology Inc., Shanghai, China). Briefly, DF-1 cells (1 × 106 cells/mL) were plated in 6-well plates and treated with drugs, then cells were collected and homogenized using an ultrasonic grinder, the supernatant was collected into a 96-well plate and the Ferric-tripyridyltriazine (Fe3+-TPTZ) reagents were added. The antioxidant capacity was assessed based on the level of reduction of Fe³⁺-TPTZ to Fe²⁺-TPTZ. Standard solutions of FeSO₄ in the concentrations range of 0.15 - 1.5 mM were prepared to plot the standard curve. The concentration of Fe²⁺ - TPTZ in each sample was measured using a microplate reader (Molecular Devices, 22202-SANGMSMA1, Shanghai, China). The experiments were carried out in quintuplicate (n = 4).

Superoxide dismutase (SOD) activity assay

The SOD activity was measured using the SOD Assay Kit (Nanjing Jiancheng Bioengineering Inc., Jiangsu, China). Briefly, DF-1 cells (1 × 106 cells/mL) were plated in 6-well plates and treated with drugs, then cells were collected and homogenized using an ultrasonic grinder, the supernatant was collected into a 96-well plate and the appropriate reagents were added. The wells without supernatant were set as the blank control group. Protein levels of DF-1 cells were quantified through bicinchoninic acid (BCA) analysis (Kangwei Century Biotechnology Co., Jiangsu, China). The OD550nm value of each well was measured using a microplate reader (Molecular Devices, 22202-SANGMSMA1, Shanghai, China). SOD activity was calculated as follows: SOD activity (U/mgprot) = [(Acontrol-Areatment)/Acontrol/50 % × (total volume/sample volume)] / protein concentration (mg/ml). (where A = absorbance). The experiments were carried out in quintuplicate (n = 4).

ROS assay

ROS levels in DF-1 cells were quantified using ROS Detection Kit (Beyotime Biotechnology Inc., Shanghai, China). DF-1 cells (1 × 106 cells/mL) were plated in 6-well plates and treated with drugs, then the DCFH-DA probe was diluted with serum-free culture, added into the plates and incubate at 37°C for 20 min. The images were captured with a fluorescence microscope (IRX50, Sunny Optical Technology Inc., Jiangsu, China), and the fluorescence intensity was measured using ImageJ (Version 1.52i, National Institutes of Health, USA) software. The experiments were carried out in triplicate (n = 3) and six photograph were acquired for each group.

Mitochondrial membrane potential (ΔΨm) assay

DF-1 cells (1 × 106 cells/mL) were plated into 6-well plates and treated with drugs. Later, ΔΨm in cells was detected following the instruction of Mitochondrial Membrane Potential Assay Kit with JC-1 (Beyotime Biotechnology Inc., Shanghai, China). The images were captured with a fluorescence microscope (IRX50, Sunny Optical Technology Inc., Jiangsu, China), and the fluorescence intensity was measured using ImageJ (Version 1.52i, National Institutes of Health, USA) software, six photograph were acquired for each group. The results were also detected by flow cytometry (Agilent NovoCyte, USA) and analysed by FlowJo (Version 10, BD Biosciences, USA) software. The experiments were carried out in triplicate (n = 3).

Mitochondrial superoxide assay

The mitochondrial superoxide levels were detected following the instruction of MitoSOX Red Kit (GC68230, Glpbio Inc., Montclair, CA, USA). Briefly, 1 × 106 DF-1 cells were inoculated into a 6-well plate and treated with drugs, incubated with 5 μM MitoSOX Red for 20 min. The images were captured with a fluorescence microscope (IRX50, Sunny Optical Technology Inc., Jiangsu, China), and the fluorescence intensity was measured using ImageJ (Version 1.52i, National Institutes of Health, USA) software. The experiments were carried out in quadruplicate (n = 4) and eight photograph were acquired for each group.

Transmission electron microscope (TEM) scanning assay

Briefly, 1 × 106 DF-1 cells were inoculated into a 6-well plate and treated with drugs. Cells were harvested and fixed using 2.5 % glutaraldehyde, followed by dehydration through a graded series of ethanol. The samples were then dried. Ultimately, the morphology of the cells was analyzed and documented using transmission electron microscopy (HT7800, Hitachi Group, Tokyo, Japan). The experiments were carried out in triplicate (n = 3) and nine photograph were acquired for each group.

Mitochondria and ER co-localization assay

Briefly, DF-1 cells (1 × 106 cells/mL) were seeded on 6-well plates and treated with drugs, then the mitochondria and ER were labeled with Mitochondrial Red CMXRos (Beyotime Biotechnology Inc., Shanghai, China) and ER-Tracker Green (Beyotime Biotechnology Inc., Shanghai, China), respectively following the instructions. The images were captured with a confocal laser scanning microscope (STELLARIS 5, Leica Inc., Wetzlar, Germany). The Pearson correlation coefficient between mitochondria and ER was calculated using ImageJ (Version 1.52i, National Institutes of Health, USA) software. The experiment was repeated nine times (n = 9).

Mitochondrial Ca2+ assay

Mitochondrial Ca2+ concentration was measured using the specific fluorescent probe Rhod-2 (Yisheng Biotech, shanghai, China) following the instructions. DF-1 cells (1 × 106 cells/mL) were plated in 6-well plates and treated with drugs, then the Rhod-2 probe was added, cells were incubate at 37°C for 20 min. The images were captured with a fluorescence microscope (IRX50, Sunny Optical Technology Inc., Jiangsu, China) and the fluorescence intensity was measured using ImageJ (Version 1.52i, National Institutes of Health, USA) software. The experiments were carried out in quintuplicate (n = 4).

Transcriptome sequencing assay

The transcriptome sequencing assay was done by Majorbio Inc. (Shanghai, China). Total RNA was extracted from the tissue using TRIzol® reagent according the manufacturer’s instructions. RNA purification, reverse transcription, library construction and sequencing were performed at Shanghai Majorbio Bio-pharm Biotechnology Inc. (Shanghai, China) according to the manufacturer’s instructions (Illumina, San Diego, CA). To identify differential expression genes (DEGs) between two different samples, the expression level of each transcript was calculated according to the transcripts per million reads (TPM) method. Sequencing was performed on NovaSeqXPlus platform. The enrichment analysis of DEGs was conducted through Gene Ontology (GO) enrichment analysis. The experiments were carried out in triplicate (n = 3). The transcriptome sequencing data reported in this paper have been submitted to sequence read archive (SRA) database of NCBI, and have been assigned the accession number: PRJNA1209415.

RNA isolation and real-time PCR

Cellular RNA was extracted using the AG RNAex Pro Kit (AG21101, Accurate Biotech, Hunan, China). RNA concentration was determined using a 260/280 nm absorbance ratio, and total RNA was converted to cDNA using Evo M-MLV Reverse Transcription Reagent Master Mix (AG11705, Accurate Biotech, Hunan, China). The mRNA expression levels of the genes were evaluated using a fluorescence quantitative analyzer (CFX96, BOLE Life Medical Products Co., LTD., Shanghai, China). The RT-qPCR was carried out under the following conditions: reverse transcription at 42°C for 5 min and enzyme activation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing and extension at 60°C for 35 s. The mRNA expression levels were calculated using the 2ΔΔ Ct method. Primer sequences were shown in Table 1. The experiments were carried out in triplicate (n = 3).

Table 1.

Primers for RT-qPCR.

Gene Primer sequence(5′−3′)
MFN2 F: AGCTCATGGTGTCGATGGTC
R: CCAGGTGAGGCGTTCATACA
MCUB F: TTGCTTGCCGGAACAGATACT
R: ACTTCGTCAGAGGGCACCAG
ITPR1 F: CTGTGGGAGGTAGAGGTGGT
R: TGACACTCCTGGTCATCTTCC
VDAC3 F: GGCTGTCCCACCATCATACAG
R: GTATTGGAAGAACCAGTTGCAGT
RASA4B F: TCTGGACCTGCTCTTTGAACT
R: ATCCCTGTCACCTTGAGGAAAG
ACTIN F: GCTACAGCTTCACCACCACA
R: TCTCCTGCTCGAAATCCAGT
Open in a new tab

Western blot analysis

Protein was extracted from harvested DF-1 cells and quantified through BCA analysis (Kangwei Century Biotechnology Co., Jiangsu, China), and the same amount of protein was electrophoresed on a 10 % SDS polyacrylamide gel, and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes (Cytiva Life Sciences, USA). The membranes were blocked with 5 % milk in TBST for 1 h at room temperature. They were then treated overnight at 4°C with the primary antibodies, incubated with anti-Mfn2 (12186-1-AP, Proteintech, 1:1000), anti-GAPDH (10494-1-lg, Proteintech, 1:10000). The membranes were washed and incubated with secondary antibodies conjugated with horseradish peroxidase (HRP) anti-rabbit IgG (RGAR001, Proteintech, 1:10000) for 1 h at RT, and exposed under chemiluminescent imaging analysis system (MicroChemi4.2, DNR Bio Imaging Systems, Isreal). Densitometry analysis was conducted using ImageJ (Version 1.52i, National Institutes of Health, USA) software. The experiments were carried out in triplicate (n = 3).

Transient transfection of Mfn2 siRNA

Commercial Mfn2 siRNA was obtained from Oligobio Inc. (Beijing, China) and used to target chicken Mfn2 (Gene ID: 419484). Cells were transfected with siRNA (50 nM) for 24 h before drug treatment by using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific Inc., Massachusetts, USA) according to the manufacturer’s instructions. Non-specific siRNA was used as a negative control (NC, Oligobio Inc., Beijing, China).

Statistical analysis

The statistical analysis were performed using GraphPad Prism software (version 10.4.0, GraphPad software Inc., San Diego, CA, USA). A two-tailed unpaired t-test with Welch’s correction was applied when the variances of two groups were proven equal by the F test. One - way ANOVA was used for multiple comparisons. Homogeneity of variances was assessed using the Brown Forsythe test and Bartlett's test, with nonsignificant results indicating variance homogeneity. A P value of 0.05 or less indicated statistical significance.

Results

BA alleviates oxidative stress induced by H2O2 in DF-1 cells

In order to determine the concentrations of BA and H2O2 to be applied, CCK8 assays were conducted. The results indicated that treatment with BA at concentrations below 80 μM for 24 h did not exert significant toxicity on DF-1 cells (Fig. 1A). In contrast, after treatment with various doses of H2O2 for 4 h, the viability of DF-1 cells was significantly diminished, with cell activity decreasing to below 50 % at a concentration of 700 μM H₂O₂ (Fig. 1B). Consequently, treatment with 500 μM H₂O₂ for 4 h was selected as the conditions for the oxidative stress model.

Fig. 1.

Fig 1

Open in a new tab

BA alleviates oxidative stress induced by H2O2 in DF-1 cells. (A) Treatment with BA at concentrations below 80 μM for 24 h did not exert significant toxicity on DF-1 cells. (B) DF-1 cell activity decreased to below 50 % at the treatment of 700 μM H₂O₂ for 4 h. (C) The total antioxidant capacity of cells was detected using ferric reducing ability of plasma (FRAP) method, BA at concentrations of 2.5-15 μM effectively alleviated the decrease in total antioxidant capacity of DF-1 cells induced by H₂O₂. (D) BA at concentrations of 2.5-15 μM effectively enhanced the reduction in SOD enzyme activity of DF-1 cells induced by H₂O₂. (E) ROS levels in DF-1 cells were quantified using the DCFH-DA probe, BA at a concentration of 10 μM significantly reduced the H2O2-induced elevation of intracellular ROS levels in DF-1 cells. Bar: 400 μm. Abbreviations: BA, Baicalin. SOD, superoxide dismutase. ROS, reactive oxygen species. P-values: ***P < 0.001. ns, non-significant.

To assess the antioxidant capacity of BA, the total antioxidant capability, SOD acticity and ROS levels were measured. The results demonstrated that H2O2 significantly reduced the total antioxidant capability and the SOD activity of DF-1 cells, and significantly increased the content of cellular ROS (P < 0.001); in contrast, pre-treatment with 10 μM BA significantly reversed these parameters (P < 0.001), thereby combating oxidative stress (Fig. 1C, Fig. 1D and Fig. 1E). Therefore, a concentration of 10 μM BA was selected for subsequent experiments.

BA ameliorates H2O2-induced mitochondrial damage in DF-1 cells

The decline of ΔΨm indicates the change of mitochondrial membrane permeability and mitochondrial function damage, which is one of the important markers of cellular oxidative stress. Therefore, the ΔΨm of DF-1 cells were detected by JC-1 probe. The results showed that the ΔΨm of DF-1 cells treated by H2O2 decreased significantly compared with that in the control group (P < 0.001), while BA pretreatment could significantly alleviate this phenomenon (P < 0.01, Fig. 2A and Fig. 2B). Meanwhile, mitoSOX assays revealed that H₂O₂ markedly elevated mitochondrial superoxide levels in DF-1 cells compared with the control group (P < 0.001), whereas BA effectively attenuated this rise under oxidative stress (P < 0.001, Fig. 2C).

Fig. 2.

Fig 2

Open in a new tab

BA protects the mitochondria of DF-1 cells from H2O2. The ΔΨm of DF-1 cells were detected by JC-1 probe, analysed by (A) fluorescence microscope and (B) flow cytometry. In normal mitochondria, JC-1 aggregates in the mitochondrial matrix to form polymers that emit red fluorescence; when the mitochondrial membrane potential decreases, JC-1 exists only as monomers in the cytoplasm, emitting green fluorescence. Bar: 200 μm. (C) Mitochondrial superoxide levels were assayed with mitoSOX Red. Bar: 200 μm. (D) Mitochondrial morphology was observed by TEM. Arrows: mitochondria. Bar: 1 μm. Abbreviation: BA, Baicalin. ΔΨm, mitochondrial membrane potential. P-values: **P < 0.01, ***P < 0.001.

To observe the changes in mitochondria of DF-1 cells, TEM assays were performed. The results indicated that the mitochondria of DF-1 cells in the H₂O₂ group exhibited significant swelling, damage, and loss of cristae; the mitochondria in DF-1 cells pre-treated with BA, despite some cristae loss, were more similar to that in the control group in overall morphology (Fiuge 2D). These results suggested that BA protected the mitochondria of DF-1 cells from H2O2.

BA alleviates the abnormal enrichment of MAMs in DF-1 cells caused by H2O2

Abnormal enrichment of MAMs typically leads to mitochondrial Ca2+ overload, thereby triggering oxidative stress. Consequently, the level of MAMs enrichment was assessed by TEM assays and the co-localization of mitochondria and ER. The results indicated that under oxidative stress, MAMs were highly enriched, with a significant increase in the ER-related mitochondria riatio and the Pearson correlation coefficient between mitochondria and ER (P < 0.001); compared to the H2O2 group, the ER-related mitochondria riatio and the Pearson correlation coefficient in the BA group significantly decreased (P < 0.01). These results suggested that H2O2 induced abnormal enrichment of MAMs in DF-1 cells, while BA ameliorated this change (Fig. 3A and Fig. 3B).

Fig. 3.

Fig 3

Open in a new tab

BA alleviates the abnormal enrichment of MAMs in DF-1 cells caused by H2O2. (A) The MAMs enrichment of DF-1 cells was detected by TEM scanning assay. Blue Arrows: mitochondria. Green Lines: ER. Bar: 1 μm. (B) The enrichment of MAMs in DF-1 cells was detected by the co-localization of mitochondria and ER, as well as the calculation of the Pearson correlation coefficient, the mitochondria and ER were labeled with Mitochondrial Red CMXRos and ER-Tracker Green, respectively. Bar: 50 μm. (C) The Ca2+ levels within the mitochondria were assessed by Rhod-2 probe. Bar: 200 μm. Abbreviations: BA, Baicalin. ER, endoplasmic reticulum. Mito, mitochondria. P-values: **P < 0.01, ***P < 0.001.

Furthermore, the relative changes in Ca2+ levels within the mitochondria were assessed. The results showed that the mitochondrial Ca2+ levels were significantly higher in the H2O2 group compared to that in the control group (P < 0.001), while the mitochondrial Ca2+ levels in BA group significantly decreased compared to that in the H2O2 group (P < 0.001, Fig. 3C).

BA mitigates H2O2-induced oxidative stress in DF-1 cells via the Mfn2/MAMs/Ca2+ signaling pathway

In order to explore the antioxidant mechanism of BA, a transcriptomic sequencing was conducted, over 25,000 genes were examined, and more than 1,000 genes were found to be altered under the intervention of H2O2 or BA (Fig. 4A). Among these, 100 genes related to oxidative stress were analyzed for expression changes (Fig. 4B), with the varying genes being enriched in signaling pathways associated with oxidative stress, as revealed by GO enrichment analysis (Fig. 4C).

Fig. 4.

Fig 4

Open in a new tab

The potential antioxidant mechanisms of BA are associated with antioxidant genes including Mfn2. (A) Volcano plot showed the number of differentially expressed genes (DEGs) in DF-1 cells across different groups. (B) Among the DEGs, the expression levels of 100 genes related to oxidative stress were displayed in a heatmap. (C) Gene Ontology (GO) pathway enrichment analysis indicated that the effects of BA were enriched in multiple signaling pathways associated with oxidative stress. (D) Read counts of several mitochondrial Ca2+ transport related genes in DF-1 cells from each group were determined by RNA sequencing. (E) The mRNA levels of several mitochondrial Ca2+ transport related genes in DF-1 cells of each group were detected by RT-qPCR. (F) Protein expression levels of Mfn2 in DF-1 cells of each group were assessed by Western blot. Abbreviation: BA, Baicalin. P-values: *P < 0.05, **P < 0.01, ***P < 0.001.

To further elucidate the antioxidant mechanism of BA, the expression of several mitochondria Ca2+ transport associated genes was profiled by RNA sequencing and subsequently verified by RT-qPCR (Fig. 4D and Fig. 4E). Notably, the expression of the Mfn2 gene was significantly downregulated in the H2O2 group compared to the control group (P < 0.05), while significantly upregulated in the BA group compared to the H2O2 group (P < 0.01, Fig. 4D and Fig. 4E), as confirmed by Western blot assay (Fig. 4F). These results indicated that BA activated antioxidant-related signaling pathways within DF-1 cells, and its antioxidant mechanism might be associated with the Mfn2 gene.

Next, to verify whether BA alleviates oxidative stress through the Mfn2 related pathway, the expression of the Mfn2 gene was silenced by transient transfection of Mfn2 siRNA, and confirmed by Western blot asaay (P < 0.05, Fig. 5A). The total antioxidant capacity assay results revealed that, after drug treatments, the total antioxidant capacity of DF-1 cells in si-NC group was higher than that in the BA group (P < 0.01), while the total antioxidant capacity of DF-1 cells in the si-Mfn2 group was significantly lower than that in both the si-NC and BA groups (P < 0.001, Fig. 5B). Meanwhile, the ROS, mitoSOX and ΔΨm assays were performed after the interference and drug treatments, and the results indicated that there were no significant differences between the si-NC group and the BA group (P > 0.05), while significant differences were observed between the si-Mfn2 group and the si-NC group (P < 0.05, Fig. 5C, Fig. 5D and Fig. 5E). These results indicated that the interference of the Mfn2 gene significantly diminished the antioxidant capacity of BA, thereby suggesting that BA exerts its antioxidant effects through the mediation of Mfn2.

Fig. 5.

Fig 5

Open in a new tab

BA exerts antioxidant effects in DF-1 cells via Mfn2 mediation. (A) The Mfn2 siRNA transient transfection was confirmed by Western blot assay. The interference of the Mfn2 gene in DF-1 cells significantly diminished the effects of BA on the following aspects: (B) the enhancement of total antioxidant capability in DF-1 cells by BA; (C) the suppression of ROS production by BA; (D) the reduction of mitochondrial superoxide levels by BA; and (E) the protection of ΔΨm in DF-1 cells by BA. Abbreviation: NC, negative control. BA, Baicalin. ROS, reactive oxygen species. P-values: *P < 0.05, **P < 0.01, ***P < 0.001. ns, non-significant.

Finally, the TEM, co-localization of mitochondria and ER, and mitochondrial Ca2+ assays were conducted after the si-Mfn2 interference and drug treatments in DF-1 cells. The enrichment of MAMs in DF-1 cells of the si-NC group showed no significant difference compared with the BA group (P > 0.05), while the enrichment of MAMs in cells of the si-Mfn2 group was significantly higher than that in the si-NC group (P < 0.001, Fig. 6A and Fig. 6B). Additionally, the mitochondrial Ca2+ levels in DF-1 cells of the si-NC group were not significantly different from those in the BA group (P > 0.05), whereas the mitochondrial Ca2+ levels in cells of the si-Mfn2 group were significantly higher than those in the si-NC group (P < 0.001, Fig. 6C). These results indicated that the ability of BA to alleviate H₂O₂-induced abnormal enrichment of MAMs and to reduce mitochondrial Ca2+ overload under oxidative stress was significantly weakened after Mfn2 gene interference. In other words, BA mitigated oxidative stress via the Mfn2/MAMs/Ca²⁺signaling pathway.

Fig. 6.

Fig 6

Open in a new tab

BA mitigates oxidative stress in DF-1 cells via the Mfn2/MAMs/Ca2+ signaling pathway. (A) The MAMs enrichment of DF-1 cells was detected by TEM scanning assay. Blue Arrows: mitochondria. Green Lines: ER. Bar: 1 μm. (B) The enrichment of MAMs in DF-1 cells was detected by the co-localization of mitochondria and ER, as well as the calculation of the Pearson correlation coefficient. Bar: 50 μm. (C) The Ca2+ levels within the mitochondria were assessed by Rhod-2 probe. Bar: 400 μm. Abbreviations: BA, Baicalin. ER, endoplasmic reticulum. Mito, mitochondria. P-values: ***P< 0.001. ns, non-significant.

Discussion

Oxidative stress is closely related to a variety of diseases in chickens, such as ascites syndrome in broilers (Li et al., 2022; Yu et al., 2023), Mycoplasma Gallisepticum infection (Hu et al., 2021), and egg-laying stress in laying hens (X. Ding et al., 2022b), etc. Oxidative stress is a critical factor in these diseases, as the disease induces oxidative stress, which in turn causes tissue damage and further promotes disease progression. BA has been identified as an antioxidant agent in humans and other animals, however, research on its antioxidant effects in poultry remains limited.

In present study, the antioxidant capability of BA on DF-1 cells was identified, and the relationship of BA and Mfn2/MAMs/Ca2+ signaling pathway was explored. In this study, BA was applied to DF-1 cells prior to the establishment of the oxidative stress model, suggesting that BA could potentially be used as a feed additive in the poultry industry for the prevention of oxidative stress. Additionally, future work could explore different timing regimens of BA administration (e.g., concurrent with or after H₂O₂ exposure) and include positive controls such as Vitamin C or Trolox.

The current study only encompasses in vitro assays involving a single chicken cell line. Since the substantial differences between in vitro and in vivo experiments, it is essential to conduct further research on the application of BA in poultry in the future. For instance, potential areas of investigation could include the alleviation of oxidative stress in broiler chickens by BA and its underlying mechanisms, as well as the effects and mechanisms of BA on fatty liver syndrome in laying hens (characterized by oxidative stress).

MAMs are important intracellular signaling platforms that allow Ca2+-encoded messages between the ER and mitochondria to regulate essential functions, including metabolism, energy production, and apoptosis (Marchi et al., 2018). An imbalance in Ca2+ homeostasis leads to mitochondrial dysfunction, which induces apoptosis (Ye et al., 2021). In present study, the effect of BA in mitigating the abnormal enrichment of MAMs and mitochondrial Ca2+ overload under oxidative stress was confirmed. However, the transfer of Ca2+ from the ER to mitochondria requires the coordinated action of multiple mediators on MAMs, such as inositol 1,4,5-triphate receptor (IP3R) (Filadi and Pizzo, 2019; Ye et al., 2021), voltage-dependent anion channel (VDAC) (Hajnóczky et al., 2002; Y. F. Song et al., 2024), and mitochondrial calcium uniporter (MCU) (Shanmughapriya et al., 2015), etc. The mRNA levels of these genes has already been quantified in this study, however, the potential alterations in the expression levels of these proteins during BA's antioxidant process warrant further investigation in future studies. This would facilitate the integration of these findings with the current study's results to provide a more comprehensive elucidation of BA's antioxidant mechanisms.

Mfn2 involves in ER-mitochondrial Ca2+ transfer, and plays a bidirectional regulatory role in Ca2+ transport (Yang et al., 2023), silencing Mfn2 gene leads to the enrichment of MAMs, resulting in excessive Ca2+ transfer and ultimately causing mitochondrial Ca2+ overload (Filadi et al., 2015). Moreover, previous studies have shown that over-expression of Mfn2 can inhibit MAMs-related signaling pathways, protect mitochondrial function, and thereby guard against cellular damage caused by diseases (Chen et al., 2023; Z. Song et al., 2022). Therefore, introducing over-expression experiments related to Mfn2 could better elucidate the role of Mfn2 in oxidative stress in DF-1 cells and further complement the antioxidant mechanisms of BA.

In present study, the up-regulation of Mfn2 gene by BA was detected, and the antioxidant capability of BA was confirmed to be achieved by regulating Mfn2. In the results involving the interference of the Mfn2 gene, the total antioxidant capacity of the Si-NC group was significantly higher than that of the BA group, this may be attributed to the interference caused by siRNA. Given that the assay employs the ferrous ion reduction method, it is possible that siRNA affects the ability of DF-1 cells to reduce iron ions. However, the precise reasons remain to be elucidated. Nonetheless, this change did not affect the final conclusion of this study.

There are numerous mediators related with Mfn2, such as Dynamin-related protein 1 (Drp1) (Mishra and Thakur, 2024), extracellular regulated protein kinases (ERKs) (Yuan et al., 2023), etc. Whether the antioxidant properties of BA are associated with these Mfn2-related proteins remains to be verified in subsequent studies.

In conclusion, BA alleviates oxidative stress in DF-1 cells via the Mfn2/MAMs/ Ca2+ pathway, and further research needs to be conducted in the future.

CRediT authorship contribution statement

Zhaoyan Lin: Writing – original draft, Methodology, Data curation, Conceptualization. Jiao Wang: Writing – original draft, Software, Conceptualization. Junxin Li: Data curation. Yu Zheng: Methodology. Bohan Zheng: Methodology. Qinjin Li: Writing – review & editing. Xiaohong Huang: Project administration.

Disclosures

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal in terest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgments

This work was supported by the National Natural Science Foundation of China [grant number 32402954, 2024; KAB24021XA]; and the Fujian Provincial Department of Finance, Fujian, China [grant number 2069999, 2023; KLY23108XA].

The authors thank Analysis and Testing Center of Fujian Agriculture and Forestry University for their help in the experiment.

References

  1. Bai X., Yao M., Zhu X., Lian Y., Zhang M. Baicalin suppresses interleukin-1β-induced apoptosis, inflammatory response, oxidative stress, and extracellular matrix degradation in human nucleus pulposus cells. Immunopharmacol. Immunotoxicol. 2023;45:433–442. doi: 10.1080/08923973.2023.2165942. [DOI] [PubMed] [Google Scholar]
  2. Bao J., Wu Z., Ishfaq M., Wang J., Miao Y., Niu D., Li R., Li J., Chen C. Pharmacokinetic/pharmacodynamic profiles of baicalin against mycoplasma gallisepticum in an in vivo infection model. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barazzuol L., Giamogante F., Calì T. Mitochondria associated membranes (mams): architecture and physiopathological role. Cell Calcium. 2021;94 doi: 10.1016/j.ceca.2020.102343. [DOI] [PubMed] [Google Scholar]
  4. Cao Y., Chen Z., Hu J., Feng J., Zhu Z., Fan Y., Lin Q., Ding G. Mfn2 regulates high glucose-induced mams dysfunction and apoptosis in podocytes via perk pathway. Front. Cell Dev. Biol. 2021;9 doi: 10.3389/fcell.2021.769213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cardanho-Ramos C., Morais V.A. Mitochondrial biogenesis in neurons: how and where. Int J Mol Sci. 2021;22 doi: 10.3390/ijms222313059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen Y., Li S., Yin M., Li Y., Chen C., Zhang J., Sun K., Kong X., Chen Z., Qian J. Isorhapontigenin attenuates cardiac microvascular injury in diabetes via the inhibition of mitochondria-associated ferroptosis through prdx2-mfn2-acsl4 pathways. Diabetes. 2023;72:389–404. doi: 10.2337/db22-0553. [DOI] [PubMed] [Google Scholar]
  7. Ding M., Shi R., Cheng S., Li M., De D., Liu C., Gu X., Li J., Zhang S., Jia M., Fan R., Pei J., Fu F. Mfn2-mediated mitochondrial fusion alleviates doxorubicin-induced cardiotoxicity with enhancing its anticancer activity through metabolic switch. Redox. Biol. 2022;52 doi: 10.1016/j.redox.2022.102311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ding X., Cai C., Jia R., Bai S., Zeng Q., Mao X., Xu S., Zhang K., Wang J. Dietary resveratrol improved production performance, egg quality, and intestinal health of laying hens under oxidative stress. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Filadi R., Greotti E., Turacchio G., Luini A., Pozzan T., Pizzo P. Mitofusin 2 ablation increases endoplasmic reticulum-mitochondria coupling. Proc. Natl. Acad. Sci. 2015:E2174–E2181. doi: 10.1073/pnas.1504880112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Filadi R., Pizzo P. Er-mitochondria tethering and ca(2+) crosstalk: the ip(3)r team takes the field. Cell Calcium. 2019;84 doi: 10.1016/j.ceca.2019.102101. [DOI] [PubMed] [Google Scholar]
  11. Fu S., Li J., You J., Liu S., Dong Q., Fu Y., Luo R., Sun Y., Tian X., Liu W., Zhang J., Ding Y., Zhang Y., Wang W., Guo L., Qiu Y. Baicalin attenuates pd-1/pd-l1 axis-induced immunosuppression in piglets challenged with glaesserella parasuis by inhibiting the pi3k/akt/mtor and ras/mek/erk signalling pathways. Vet. Res. 2024;55:95. doi: 10.1186/s13567-024-01355-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Görlach A., Bertram K., Hudecova S., Krizanova O. Calcium and ros: a mutual interplay. Redox. Biol., 2015;6:260–271. doi: 10.1016/j.redox.2015.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hajnóczky G., Csordás G., Yi M. Old players in a new role: mitochondria-associated membranes, vdac, and ryanodine receptors as contributors to calcium signal propagation from endoplasmic reticulum to the mitochondria. Cell Calcium. 2002;32:363–377. doi: 10.1016/s0143416002001872. [DOI] [PubMed] [Google Scholar]
  14. Halliwell B., Whiteman M. Measuring reactive species and oxidative damage in vivo and in cell culture: how should you do it and what do the results mean? Br. J. Pharmacol. 2004;142:231–255. doi: 10.1038/sj.bjp.0705776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. He J., He J. Baicalin mitigated il-1β-induced osteoarthritis chondrocytes damage through activating mitophagy. Chem. Biol. Drug Des. 2023;101:1322–1334. doi: 10.1111/cbdd.14215. [DOI] [PubMed] [Google Scholar]
  16. Hu W., Zhang W., Shah S.W.A., Ishfaq M., Li J. Mycoplasma gallisepticum infection triggered histopathological changes, oxidative stress and apoptosis in chicken thymus and spleen. Dev. Comp. Immunol. 2021;114 doi: 10.1016/j.dci.2020.103832. [DOI] [PubMed] [Google Scholar]
  17. Jaganjac M., Milkovic L., Zarkovic N., Zarkovic K. Oxidative stress and regeneration. Free Radic. Biol. Med. 2022;181:154–165. doi: 10.1016/j.freeradbiomed.2022.02.004. [DOI] [PubMed] [Google Scholar]
  18. Li L., Jia Q., Chen L., Wang W. Changes in the expression of mif and other key enzymes of energy metabolism in the myocardia of broiler chickens with ascites syndrome. Animals (Basel) 2022;12:2488. doi: 10.3390/ani12192488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Liang J., Zhou Y., Cheng X., Chen J., Cao H., Guo X., Zhang C., Zhuang Y., Hu G. Baicalin attenuates h(2)o(2)-induced oxidative stress by regulating the ampk/nrf2 signaling pathway in ipec-j2 cells. Int. J. Mol. Sci. 2023;24:9435. doi: 10.3390/ijms24119435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Liu W.J., Chen W.W., Chen J.Y., Sun Y.B., Chang D., Wang C.X., Xie J.D., Lin W., Li S.H., Xu W., Lin Y.X., Zheng Y.F., Zhou X., Huang M.Q. Baicalin attenuated metabolic dysfunction-associated fatty liver disease by suppressing oxidative stress and inflammation via the p62-keap1-nrf2 signalling pathway in db/db mice. Phytother. Res. 2025;39:1663–1678. doi: 10.1002/ptr.8010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu X., Hussain R., Mehmood K., Tang Z., Zhang H., Li Y. Mitochondrial-endoplasmic reticulum communication-mediated oxidative stress and autophagy. Biomed. Res. Int. 2022 doi: 10.1155/2022/6459585. 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ma L., Wu F., Shao Q., Chen G., Xu L., Lu F. Baicalin alleviates oxidative stress and inflammation in diabetic nephropathy via nrf2 and mapk signaling pathway. Drug Des. Devel. Ther., 2021;15:3207–3221. doi: 10.2147/DDDT.S319260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Marchi S., Patergnani S., Missiroli S., Morciano G., Rimessi A., Wieckowski M.R., Giorgi C., Pinton P. Mitochondrial and endoplasmic reticulum calcium homeostasis and cell death. Cell Calcium. 2018;69:62–72. doi: 10.1016/j.ceca.2017.05.003. [DOI] [PubMed] [Google Scholar]
  24. Mishra E., Thakur M.K. Tat-beclin-1 ameliorates memory by improving neuronal cytoarchitecture and mitigating mitochondrial dysfunction in scopolamine-induced amnesic male mice. ACS Pharmacol. Transl. Sci. 2024;7:3462–3475. doi: 10.1021/acsptsci.4c00283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Oke O.E., Akosile O.A., Oni A.I., Opowoye I.O., Ishola C.A., Adebiyi J.O., Odeyemi A.J., Adjei-Mensah B., Uyanga V.A., Abioja M.O. Oxidative stress in poultry production. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.104003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Perruchot M.H., Gondret F., Robert F., Dupuis E., Quesnel H., Dessauge F. Effect of the flavonoid baicalin on the proliferative capacity of bovine mammary cells and their ability to regulate oxidative stress. Peer J. 2019;7:e6565. doi: 10.7717/peerj.6565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Rodríguez-Arribas M., Yakhine-Diop S.M.S., Pedro J.M.B., Gómez-Suaga P., Gómez-Sánchez R., Martínez-Chacón G., Fuentes J.M., González-Polo R.A., Niso-Santano M. Mitochondria-associated membranes (mams): overview and its role in parkinson's disease. Mol. Neurobiol., 2017;54:6287–6303. doi: 10.1007/s12035-016-0140-8. [DOI] [PubMed] [Google Scholar]
  28. Shanmughapriya S., Rajan S., Hoffman N.E., Zhang X., Guo S., Kolesar J.E., Hines K.J., Ragheb J., Jog N.R., Caricchio R., Baba Y., Zhou Y., Kaufman B.A., Cheung J.Y., Kurosaki T., Gill D.L., Madesh M. Ca2+ signals regulate mitochondrial metabolism by stimulating creb-mediated expression of the mitochondrial ca2+ uniporter gene mcu. Sci. Signal. 2015;8:ra23. doi: 10.1126/scisignal.2005673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Shi H., Qiao F., Lu W., Huang K., Wen Y., Ye L., Chen Y. Baicalin improved hepatic injury of nash by regulating nrf2/ho-1/nrlp3 pathway. Eur. J. Pharmacol. 2022;934 doi: 10.1016/j.ejphar.2022.175270. [DOI] [PubMed] [Google Scholar]
  30. Song Y.F., Bai Z.Y., Lai X.H., Luo Z., Hogstrand C. Ip3r-grp75-vdac and relevant ca(2+) signaling regulate dietary palmitic acid-induced de novo lipogenesis by mitochondria-associated er membrane (mam) recruiting seipin in yellow catfish. J. Nutr. 2024 doi: 10.1016/j.tjnut.2024.04.021. S0022-3166(0024)00224-00224. [DOI] [PubMed] [Google Scholar]
  31. Song Z., Song H., Liu D., Yan B., Wang D., Zhang Y., Zhao X., Tian X., Yan C., Han Y. Overexpression of mfn2 alleviates sorafenib-induced cardiomyocyte necroptosis via the mam-camkiiδ pathway in vitro and in vivo. Theranostics. 2022;12:1267–1285. doi: 10.7150/thno.65716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wang N., Wang C., Zhao H., He Y., Lan B., Sun L., Gao Y. The mams structure and its role in cell death. Cells, 2021;10:657. doi: 10.3390/cells10030657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wen R.J., Dong X., Zhuang H.W., Pang F.X., Ding S.C., Li N., Mai Y.X., Zhou S.T., Wang J.Y., Zhang J.F. Baicalin induces ferroptosis in osteosarcomas through a novel nrf2/xct/gpx4 regulatory axis. Phytomedicine. 2023;116 doi: 10.1016/j.phymed.2023.154881. [DOI] [PubMed] [Google Scholar]
  34. Xing J., Chen X., Zhong D. Stability of baicalin in biological fluids in vitro. J. Pharm. Biomed. Anal. 2005;39:593–600. doi: 10.1016/j.jpba.2005.03.034. [DOI] [PubMed] [Google Scholar]
  35. Yang J.F., Xing X., Luo L., Zhou X.W., Feng J.X., Huang K.B., Liu H., Jin S., Liu Y.N., Zhang S.H., Pan Y.H., Yu B., Yang J.Y., Cao Y.L., Cao Y., Yang C.Y., Wang Y., Zhang Y., Li J., Xia X., Kang T., Xu R.H., Lan P., Luo J.H., Han H., Bai F., Gao S. Mitochondria-er contact mediated by mfn2-serca2 interaction supports cd8(+) t cell metabolic fitness and function in tumors. Sci. Immunol. 2023;8:eabq2424. doi: 10.1126/sciimmunol.abq2424. [DOI] [PubMed] [Google Scholar]
  36. Ye L., Zeng Q., Ling M., Ma R., Chen H., Lin F., Li Z., Pan L. Inhibition of ip3r/ca2+ dysregulation protects mice from ventilator-induced lung injury via endoplasmic reticulum and mitochondrial pathways. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.729094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yu J., Liu X., Wang K., Wang H., Han Y., Kang J., Deng R., Zhou H., Duan Z. Underlying mechanism of qiling jiaogulan powder in the treatment of broiler ascites syndrome. Poult Sci. 2023;102 doi: 10.1016/j.psj.2022.102144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yuan Z.L., Mo Y.Z., Li D.L., Xie L., Chen M.H. Inhibition of erk downregulates autophagy via mitigating mitochondrial fragmentation to protect sh-sy5y cells from ogd/r injury. Cell Commun. Signal. 2023;21:204. doi: 10.1186/s12964-023-01211-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhu T., Wang L., Feng Y., Sun G., Sun X. Classical active ingredients and extracts of chinese herbal medicines: pharmacokinetics, pharmacodynamics, and molecular mechanisms for ischemic stroke. Oxid. Med. Cell Longev. 2021 doi: 10.1155/2021/8868941. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zmrhal V., Svoradova A., Venusova E., Slama P. The influence of heat stress on chicken immune system and mitigation of negative impacts by baicalin and baicalein. Animals (Basel) 2023;13:2564. doi: 10.3390/ani13162564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zou M., Yang L., Niu L., Zhao Y., Sun Y., Fu Y., Peng X. Baicalin ameliorates mycoplasma gallisepticum-induced lung inflammation in chicken by inhibiting tlr6-mediated nf-κb signalling. Br. Poult. Sci. 2021;62:199–210. doi: 10.1080/00071668.2020.1847251. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES