Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2025 Sep 30;15:34000. doi: 10.1038/s41598-025-11774-5

Spatiotemporal regulation of endoplasmic reticulum stress visualized by live imaging of bipA mRNA in Aspergillus oryzae

Pakornswit Sathongdejwisit 1, Yuki Morita 1, Yoshinori Katakura 1, Kaoru Takegawa 1, Adokiye Berepiki 2, Yujiro Higuchi 1,✉
PMCID: PMC12484549  PMID: 41028809

Abstract

The molecular mechanisms of the endoplasmic reticulum (ER) stress response have been elucidated in detail in many eukaryotic organisms. However, there is still a lack of cellular biological knowledge about the ER stress response in filamentous fungi. In this study, we utilized the MS2 system to analyze the mRNA of bipA, which encodes a typical ER chaperone expressed in response to dithiothreitol (DTT)-induced ER stress in living cells of Aspergillus oryzae. Fluorescence microscopy revealed the temporal changes in the amount of bipA mRNA in the cell with or without DTT. It was also shown that when ER stress was induced with DTT, bipA mRNA expression was observed from the apical to the basal regions of the hyphal cells. Moreover, although some of the ER stress-induced bipA mRNA showed microtubule-dependent long-distance dynamics, most of it was observed to be static. Furthermore, treatment with cycloheximide, a translation inhibitor, increased the long-range dynamics of bipA mRNA, suggesting that static bipA mRNA is being translated. Collectively, we have clarified the mechanism of gene expression and regulation of intracellular mRNA levels in response to ER stress in the filamentous fungus A. oryzae cells.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-11774-5.

Keywords: Aspergillus oryzae, Endoplasmic reticulum stress, Filamentous fungi, Microtubule, mRNA

Subject terms: Cell biology, Microbiology

Introduction

Filamentous fungi generally have high protein secretion capabilities, and thus research on membrane traffic, with a focus on the secretion pathway, has been carried out1–3. The yellow Koji mold Aspergillus oryzae is an essential filamentous fungus in the fermentation and brewing industries, and it has a very high capacity for secreting and producing useful enzymes4,5. In particular, it is thought that amylase proteins, which are starch-degrading enzymes, are produced in the order of tens of grams per liter of culture, and are mainly secreted from the tips of hyphae6,7. In A. oryzae, amylases are produced abundantly, and their mRNAs are also transcribed in extremely large quantities8,9. Although the regulatory mechanisms of amylase production are becoming clearer, there is still not much information about from which nuclei mRNA is produced and how its localization is controlled in hyphal cells.

The regulation of mRNA localization within the cell determines the translation site of the encoded protein and therefore has an important influence on protein function10–14. In A. oryzae, mRNAs of amyB, which encodes alpha-amylase, and actA, which encodes actin, a cytoskeletal component key for secretion, were analyzed using single-molecule fluorescence in situ hybridization (smFISH)15. In the presence of maltose, an inducer of amylase genes, the amyB mRNA was found to be present throughout the hyphal cell, but not at the tip region, where proteins are mainly secreted, while the actA mRNA was found to be present at the tip region15. In addition, smFISH analysis for the mRNA localization of enhanced green fluorescent protein (EGFP) fusion proteins has revealed that there are differences in localization and stability of mRNA in A. oryzae hyphal cells16.

More recently, the localization of the mRNA encoding the glucoamylase GlaA, a rate-limiting secretory enzyme in saccharification, was analyzed in living cells of A. oryzae using the MS2 system17,18. In this study, an MS2-binding site (MBS) sequence was introduced downstream of the endogenous glaA locus, and the MS2-coat protein (MCP), which specifically binds to the MBS, was fused to EGFP to visualize glaA mRNA18. Using this approach, it was found that glaA mRNA is specifically produced in the nuclei of the apical regions and near the septa. It is known that secretory proteins such as GlaA are secreted from the hyphal tips and septa, and the fact that glaA mRNA is produced near these secretory sites suggests that efficient translational control exists. In addition, it was suggested that under conditions such as high temperature stress and endoplasmic reticulum (ER) stress, glaA mRNA localization is altered or is rapidly degraded. Furthermore, in A. oryzae, in addition to mRNA encoding secretory proteins, btuA mRNA, which encodes beta-tubulin, a component of the microtubules, was similarly analyzed using the MS2 system19. It was found that, unlike glaA mRNA, btuA mRNA is produced in the nuclei of all hyphal regions. Furthermore, it was shown that btuA mRNA is produced in large quantities after nuclear division in a cell cycle-dependent manner, and it was thought that btuA may be regulated by translation depending on the amount of mRNA19.

In recent years, it has become clear that ER stress occurs in A. oryzae cells when they secrete a large amount of proteins20,21. Research on the unfolded protein response (UPR) has mainly been conducted using biochemical methods, i.e. by analyzing gene expression from cell extracts22. In A. oryzae, the UPR genes bipA and clxA, encoding chaperones that function in the ER, and pdiA, encoding a protein disulfide isomerase, have been well studied23,24. In particular, BipA has been analyzed for its localization at the protein level as an ER marker25. However, it is unclear how UPR occurs spatiotemporally within A. oryzae hyphal cells, and the details of its regulatory mechanism are not yet clear. In this study, we focused on bipA as a marker for UPR and constructed an experimental system that can monitor mRNA in real time using the MS2 system. This study aimed to clarify under what culture conditions ER stress is induced at the hyphal cell level.

Results

Live imaging of bipA mRNA by the MS2 system in A. oryzae cells

Previously, the MS2 system was successfully used to visualize the mRNA of glucoamylase and β-tubulin in A. oryzae18,19and thus we applied the same method to bipA to investigate ER stress (Supplementary Fig. S1A). We introduced 24 copies of the aptamer MBS sequence into the downstream region of bipA gene locus (AO090003000257), and generated the bipA-MS2 strain, which expresses MCP, a protein that specifically binds to MBS, fused with 2 copies of EGFP. In this case, the promoter region of bipA is in its native state, allowing analysis of the original bipA expression pattern. In addition, by fusing the nuclear localization signal (NLS) derived from SV40 virus to MCP-2×EGFP, the EGFP signal was observed in the nucleus when bipA mRNA was not expressed, and in the cytoplasm when it was expressed (Supplementary Fig. S1A).

To analyze whether the introduction of the MS2 system affects the functionality of bipA, growth assays under normal temperature were performed on the bipA-MS2 strain (Supplementary Fig. S1B, C). Even in medium supplemented with DTT, an ER stress inducer, at concentrations of 2 mM and 5 mM, the bipA-MS2 strain exhibited growth similar to that of the control strain as well as the MCP strain, which does not contain 24×MBS but expresses NLS-MCP-2×EGFP. These results indicate that the MS2 system does not affect growth in the bipA-MS2 strain.

To clearly distinguish whether bipA mRNA is localized in the nucleus or cytoplasm, a plasmid construct for expressing SV40-NLS fused with the red fluorescent protein mCherry was integrated into the sC locus, generating the bipA-MS2-NLS strain. Even under normal culture conditions without DTT, bipA mRNA was observed in nuclei and the cytoplasm, suggesting that bipA mRNA is expressed even in the basal state without ER stress induction (Fig. 1A). After adding 1 mM DTT for 1 h, bipA mRNA was observed in the cytoplasm in greater amounts than under the normal culture conditions (Supplementary Fig. S2). To exclude the possibility that the EGFP fluorescence observed in the cytoplasm was due to leaking out of the NLS-MCP-2×EGFP from the nucleus caused by DTT-induced ER stress, the same observation was performed in the MCP-NLS strain. In fact, under DTT treatment in the MCP-NLS strain, EGFP fluorescence remained in the nucleus and was not observed in the cytoplasm (Supplementary Fig. S2). Furthermore, in the bipA-MS2-NLS strain, the number of EGFP fluorescence dots observed in the cytoplasm after 1 mM DTT treatment was reduced by treatment with the transcription inhibitor actinomycin D, indicating that the observed EGFP fluorescence is indeed transcription-dependent bipA mRNA (Fig. 1B, C).

Fig. 1.

Fig. 1

Visualization of bipA mRNA by the MS2 system in A. oryzae living cells. (A) Visualization of bipA mRNA (green) and nuclei (magenta), illustrating mRNA expression surrounding the nuclei in apical cells. The enlarged image on the right shows mRNAs indicated by white arrowheads. Scale bars, 5 μm. (B) Live cell imaging of bipA mRNA (green) and nuclei (magenta) in the apical region of bipA-MS2-NLS cells treated with DMSO or actinomycin D (ActD) in the presence of 1 mM DTT. Scale bars, 5 μm. (C) The number of bipA mRNA dots localized in the cytoplasm under co-treatment with 1 mM DTT and DMSO (20.9 ± 6.06) or ActD (10.1 ± 5.04). Error bars represent the standard deviation of the mean. Data were analyzed using an unpaired two-tailed t-test. Statistical significance: ***p < 0.001. Each condition was performed with n = 9 independent hyphae from 3 biological replicates.

Effect of DTT concentration and treatment time on bipA mRNA expression

We further analyzed the effect of DTT concentration on bipA mRNA expression. In previous biochemical analyses, a concentration of 10 mM has been used to induce ER stress, so we reduced this concentration by a factor of 10 in a dilution series18,21. As a result, at a DTT concentration of 0.01 mM, the induction level of bipA mRNA was similar to that of the mock control (Fig. 2A, B). Additionally, under the microscopic analysis conditions used in this study, 10 mM DTT was probably too high a concentration to induce bipA mRNA expression due to its cytotoxicity, and the highest induction was observed at 1 mM (Fig. 2A, B). Furthermore, qRT-PCR analysis of bipA mRNA levels confirmed that the concentration-dependent induction pattern was consistent with the results of the microscopic analysis (Fig. 2C).

Fig. 2.

Fig. 2

Visualization and quantification of bipA mRNA levels under various DTT concentrations and time points. (A) Visualization of bipA mRNA (green) and nuclei (magenta) in the apical region after treatment with 0.01, 0.1, 1, and 10 mM DTT for 1 h. Scale bars, 5 μm. (B) The number of bipA mRNA dots under treatments of various DTT concentrations in the apical regions (Mock, 6.16 ± 2.12; 0.01 mM DTT, 6.86 ± 2.44; 0.1 mM DTT, 11.4 ± 3.62; 1 mM DTT, 21.6 ± 4.24; and 10 mM DTT, 5.95 ± 1.53). Data were analyzed using one-way ANOVA with Tukey’s post hoc test. Statistically significant differences were indicated using compact letter display (p < 0.05). Error bars represent the standard deviation of the mean. Each condition was conducted with n = 9 independent hyphae from 3 biological replicates. (C) Relative expression levels of bipA mRNA under each DTT concentration compared with the no-treatment control. Data were analyzed using one-way ANOVA with Tukey’s post hoc test. Statistical significance: **p < 0.01. Error bars represent the standard deviation of the mean. Each condition was performed with n = 3 independent samples from 3 biological replicates. (D) Visualization of bipA mRNA (green) and nuclei (magenta) in the apical region under 1 mM DTT treatment at each time point. Scale bars, 5 μm. (E) The number of bipA mRNA dots in the apical region after treatment with 1 mM DTT at different time points (0.25 h, 12.6 ± 3.36; 0.5 h, 18.4 ± 3.83; 1 h, 21.5 ± 4.14; 1.5 h, 18.8 ± 3.63; 2 h, 15.1 ± 7.49; 2.5 h, 13.0 ± 5.84; and 3 h, 9.92 ± 4.65). Data were analyzed using one-way ANOVA with Tukey’s post hoc test. Statistically significant differences were indicated using compact letter display (p < 0.05). Error bars represent the standard deviation of the mean. Each condition was conducted with n = 9 independent hyphae from 3 biological replicates.

Next, we analyzed the time-dependent changes in bipA mRNA expression induced by 1 mM DTT treatment, which concentration most strongly induces bipA mRNA expression. The results revealed that the amount of bipA mRNA observed in the cytoplasm reached its peak 1 h after DTT treatment and then gradually decreased thereafter (Fig. 2D, E). These indicate the successful visualization and quantification of the intracellular dynamics of bipA mRNA levels induced by ER stress.

Furthermore, we quantified the intracellular levels of bipA mRNA by removing or replenishing DTT after 1 h of 1 mM DTT treatment. The results showed that no changes were observed 30 min after washout, but the intracellular levels of bipA mRNA significantly decreased starting at 1 h and were almost undetectable by 1.5 h (Fig. 3A, B). The same experiment was performed using qRT-PCR, and although the relative expression level of bipA mRNA was low after 0.5 h of washout, a significant decrease in bipA mRNA was observed after 1.5 h of washout, consistent with the results of microscopic analysis (Fig. 3C). These findings suggest the existence of a mechanism that regulates intracellular bipA mRNA levels in response to ER stress.

Fig. 3.

Fig. 3

Residual of bipA mRNA after washout of DTT. (A) Visualization of bipA mRNA in the apical region under washout from 1 mM DTT treatment compared with mock. Scale bars, 5 μm. (B) The number of bipA mRNA dots in the apical region after treatment with 1 mM DTT for 1 h, followed by washout and observation at various time points (0.5 h, 19.5 ± 5.61; 1 h, 9.36 ± 6.19; 1.5 h, 1.02 ± 0.68; 2 h, 0.96 ± 0.91; 2.5 h, 0.84 ± 1.14; and 3 h, 0.99 ± 0.86). A mock test, in which 1 mM DTT was replenished instead of washing out, was performed in parallel (0.5 h, 20.0 ± 3.71; 1 h, 17.5 ± 2.71; 1.5 h, 12.8 ± 3.12; 2 h, 12.1 ± 2.99; 2.5 h, 12.2 ± 4.15; and 3 h, 10.8 ± 2.49). Data were analyzed using two-way ANOVA with Sidak’s multiple comparisons test. Statistical significance: ****p < 0.0001. Error bars represent the standard deviation of the mean. Each condition was conducted with n = 9 independent hyphae from 3 biological replicates. (C) Relative expression levels of bipA mRNA under each DTT concentration compared between the mock and washout conditions at 0.5, 1.5 and 3.0 h. Data were analyzed using two-way ANOVA with Sidak’s multiple comparisons test. Statistical significance: *p < 0.05; ** p < 0.01. Error bars represent the standard deviation of the mean. Each condition was performed with n = 3 independent samples from 3 biological replicates.

Distribution and localization of bipA mRNA expression in hyphal cells

We have analyzed the amount of bipA mRNA at the apical region, but we also analyzed the expression response in the middle and basal regions. Additionally, we investigated the effects of 1 mM and 0.01 mM DTT on bipA mRNA induction at the apical region; 1 mM DTT showed the strongest induction, while 0.01 mM DTT showed no induction. The results showed that, similar to the apical region, 0.01 mM DTT did not induce bipA mRNA in the middle and basal regions, while 1 mM DTT induced bipA mRNA expression in all regions (Fig. 4A–D).

Fig. 4.

Fig. 4

Hyphal distribution of bipA mRNA under DTT treatment. (A) Visualization of bipA mRNA in apical, middle and basal regions under mock or DTT treatments. Scale bars, 5 μm. (B–D) The number of bipA mRNA dots in the apical, middle, and basal hyphal regions under 1 mM and 0.01 mM DTT treatments compared with the no-treatment control. In the apical region (B), the number of bipA mRNA dots was 6.16 ± 2.12 under mock, 21.6 ± 4.24 under 1 mM DTT and 6.73 ± 2.33 under 0.01 mM DTT treatments. In the middle region (C), the number of bipA mRNA dots was 4.39 ± 1.34 under mock, 19.0 ± 3.77 under 1 mM DTT and 3.63 ± 2.03 under 0.01 mM DTT treatments. In the basal region (D), the number of bipA mRNA dots was 4.39 ± 1.88 under mock, 20.9 ± 3.17 under 1 mM DTT and 3.44 ± 1.25 under 0.01 mM DTT treatments. Data were analyzed using one-way ANOVA with Tukey’s post hoc test. For each graph, statistically significant differences among the three conditions within the same region were indicated using a compact letter display (p < 0.05). Error bars represent the standard deviation of the mean. Each condition was conducted with n = 9 independent hyphae from 3 biological replicates.

ER stress-induced bipA mRNA is thought to be translated at the ER membrane and functions as a chaperone protein within the ER. To determine the proportion of bipA mRNA localized to the ER membrane, we analyzed its localization. In previous studies, since mCherry was fused to AoSec61, a translocon at the ER membrane, and used as an ER membrane marker protein18, this construct was introduced into the bipA-MS2 strain. Additionally, because bipA mRNA was found to be expressed uniformly throughout hyphal cells, we performed colocalization analysis of bipA mRNA and the ER at the apical region. Even under conditions where hyphae were treated with 1 mM DTT for 1 h, the reticulated structure of the ER was observed, and most of the bipA mRNA co-localized with the ER membrane (Fig. 5A, B).

Fig. 5.

Fig. 5

Colocalization of bipA mRNA with the ER under DTT treatment. (A) Colocalization of bipA mRNA (green) and ER (magenta). Enlarged images of the hyphal region show colocalization of bipA mRNA with ER signals. Scale bars: full image, 5 μm; enlarged image, 2 μm. (B) Colocalization analysis under 1 mM DTT treatment was performed. A 2D intensity histogram shows black dots concentrated along the diagonal, indicating colocalization. Pearson’s R value = 0.87.

Intracellular dynamics of bipA mRNA

It has been previously demonstrated that glaA and btuA mRNA exhibit microtubule-dependent long-range motility18,19. To investigate whether similar dynamics exist for bipA mRNA, we first generated a strain of bipA-MS2 expressing mCherry fused to α-tubulin AtuA for microtubule visualization. Under ER stress induced with 1 mM DTT for 1 h, colocalization of microtubules observed with mCherry-AtuA and bipA mRNA was observed (Fig. 6A). To further quantify the dynamics of bipA mRNA and its association with microtubules, we used nocodazole, a microtubule polymerization inhibitor. Nocodazole treatment disrupted the tubular structure of microtubules, but we confirmed that bipA mRNA was similarly expressed and distributed upon treatment with 1 mM DTT (Fig. 6B).

Fig. 6.

Fig. 6

Colocalization of bipA mRNA with microtubules under DTT and nocodazole treatments. Colocalization of bipA mRNA (green) and microtubules (magenta) under 1 mM DTT with DMSO (A) or nocodazole (B) treatments. Scale bars, 5 μm.

To track the intracellular dynamics of bipA mRNA with high sensitivity, we performed fluorescence microscopy analysis of EGFP under nocodazole and 1 mM DTT treatment without simultaneously observing mCherry-AtuA. Under normal culture conditions without DTT treatment, bipA mRNA exhibiting long-range motility was observed, and this motility was significantly reduced by nocodazole treatment (Fig. 7A, B). Next, although long-range motility was exceptionally observed even under DTT treatment, most bipA mRNA dots did not exhibit long-range dynamics, and no significant difference was observed between nocodazole treatment and the control DMSO treatment (Fig. 7C, D). This suggests that much of the bipA mRNA induced by DTT treatment is translated on the ER membrane and exists in a static state.

Fig. 7.

Fig. 7

Dynamics of bipA mRNA under DTT and nocodazole treatments. (A, C) Dynamics of bipA mRNA analyzed using the TrackMate plugin, with mRNAs shown in green, highlighting tracking overlaps and maximum displacement under various conditions: DMSO, nocodazole, and with or without 1 mM DTT. Enlarged hyphal images illustrate maximum displacement tracking. Scale bars: full image, 5 μm; enlarged image, 2 μm. (B, D) Histograms show displacement distributions of bipA mRNA under each condition. Each condition was conducted with n = 3 independent hyphae from 3 biological replicates. Non-parametric Mann–Whitney U test showed significant differences: Mock–DMSO versus Mock–Nocodazole, p = 0.0012; 1 mM DTT–DMSO vversus1 mM DTT–Nocodazole, no significance, p = 0.4786. (Mock–DMSO: n = 1918, median = 0.112 μm, max = 4.643 μm, min = 0.001 μm; Mock–Nocodazole: n = 774, median = 0.090 μm, max = 1.187 μm, min = 0.003 μm; 1 mM DTT–DMSO: n = 6908, median = 0.133 μm, max = 3.737 μm, min = 0.0005 μm; 1 mM DTT–Nocodazole: n = 6311, median = 0.127 μm, max = 1.921 μm, min = 0.002 μm).

Finally, cycloheximide (CHX), a translation inhibitor, was used to analyze whether static bipA mRNA was being translated. First, to confirm that CHX is effective in A. oryzae cells, we used a strain expressing EGFP in the cytoplasm and confirmed that EGFP was not expressed in the presence of CHX (Supplementary Fig. S3). When CHX treatment was performed on the bipA mRNA visualization strain, the number of bipA mRNA molecules showing long-range dynamics significantly increased (Fig. 8A, B). Furthermore, when CHX treatment was performed simultaneously with DTT treatment, the number of bipA mRNA increased, and the proportion of long-range dynamics also significantly increased (Fig. 8C, D). These results suggest that static bipA mRNA is being translated.

Fig. 8.

Fig. 8

Dynamics of bipA mRNA under DTT and cycloheximide treatments. (A, C) Dynamics of bipA mRNA analyzed using the TrackMate plugin, with mRNAs shown in green, highlighting tracking overlaps and maximum displacement under CHX treatments, and with or without 1 mM DTT. Enlarged hyphal images illustrate maximum displacement tracking. Scale bars: full image, 5 μm; enlarged image, 2 μm. (B, D) Histograms show displacement distributions of bipA mRNA under each condition. Note that the data for Mock DMSO and 1 mM DTT DMSO are the same as those in Fig. 7. Each condition was conducted with n = 3 independent hyphae from 3 biological replicates. Non-parametric Mann–Whitney U test showed significant differences: Mock–DMSO versus Mock–CHX, p = < 0.0001; 1 mM DTT–DMSO vs. 1 mM DTT–CHX, p = < 0.0001. (Mock–CHX: n = 1467, median = 0.180 μm, max = 2.197 μm, min = 0.005 μm; 1 mM DTT–CHX: n = 7594, median = 0.233 μm, max = 2.805 μm, min = 0.002 μm).

Discussion

In this study, we focused on bipA, a UPR marker, and successfully visualized UPR in real time and spatially in A. oryzae cells by introducing the MS2 system. DTT treatment, which induces ER stress, has been primarily used at concentrations of around 10 mM in previous studies18,21. However, in this study, the strongest induction was observed at 1 mM. This is likely because, under the overnight culture conditions in glass-bottom dishes used for microscopic observation, mycelial cells were less aggregated compared to the liquid culture in flasks over several days, allowing the cellular response to low concentrations of DTT.

Previous studies on ER stress have primarily relied on biochemical methods23,24. By investigating cellular-level responses, it becomes possible to explore new research perspectives, including the evaluation of culture conditions. For example, in filamentous fungi, it has been revealed that the glaA mRNA, encoding secretory glucoamylase, is selectively expressed in the nuclei of the apical region. On the other hand, bipA mRNA, which encodes a UPR gene, was found to be expressed in the nuclei of all hyphal regions, and this expression pattern was similar to that of btuA mRNA, which encodes β-tubulin. Furthermore, this study revealed that bipA mRNA rapidly disappeared from the cytoplasm within approximately one hour after DTT was removed from the culture medium. This suggests that there is a mechanism that allows cells to respond quickly to ER stress and, at the same time, appropriately control the amount of mRNA present in the cell when the stress is relieved.

When performing expression analysis at the cellular level, fluorescent proteins have been fused to promoters responsive to ER stress or endogenous BiP26,27. However, in such experimental systems, while ER stress can be monitored during induction, the relatively stable nature of the fluorescent proteins used as reporters makes it difficult to monitor the timing at which the stress response subsides. In contrast, in this study, we directly analyzed bipA mRNA from UPR genes using the MS2 system, enabling real-time visualization and monitoring of UPR dynamics. This approach now allows us to quantitatively assess the extent of ER stress at the cellular level by using the dynamics of bipA mRNA in the cytoplasm as an indicator under various culture and stress conditions.

BipA fused with EGFP has been found to be present in higher concentrations toward the apical end of each hyphal cell25. It remains unclear whether this localization pattern forms at the time of BipA synthesis or whether it is formed through the transport of synthesized proteins. Additionally, the relationship between BipA localization and that of IreA, an endoribonuclease of ER membrane proteins involved in the UPR, is of interest. Moreover, analysis using CHX, a translation inhibitor, suggested that static bipA mRNA may be translated. Against this background, it is necessary to analyze the sites of de novo BipA synthesis using the SunTag method, which enables real-time visualization of the localization of newly synthesized proteins28–32. As with the MS2 method, it is necessary to confirm that there are no artificial effects due to the addition of tag sequences in the SunTag method. However, if no issues are found, it will also be possible to analyze the relationship between the dynamics of bipA mRNA and the timing of translation. In Ustilago maydis, it has been revealed that mRNA in the translated state exhibits dynamics as polysomes transported by early endosomes33,34. In addition, RNA-binding proteins may also be involved in mRNA dynamics35–38. Therefore, it is necessary to analyze proteins that interact with bipA mRNA to elucidate the molecular mechanisms that control its dynamics and translation. In addition to bipA, by conducting similar analyses on clxA and pdiA, which have been previously analyzed as UPR response genes23,24, it is expected that more detailed spatiotemporal molecular mechanisms of UPR in filamentous fungi will be elucidated.

It has been established that the UPR is induced during the secretion of heterologous proteins in A. oryzae23. However, the specific culture conditions and the extent of UPR induction remain unclear. Therefore, by applying the bipA mRNA visualization system established in this study during the production of useful heterologous secretory proteins, it will be possible to analyze the UPR at the cellular level. We will clarify the relationship between bipA mRNA expression levels measured by fluorescence microscopy and biochemical mRNA quantification by qRT-PCR, as well as heterologous protein secretion production levels, under various culture conditions and stress induction conditions. Through these analyses, we aim to gain useful insights into the relationship between culture conditions and high-level protein secretion by real-time visualization of ER stress. By gaining a better understanding of stress response mechanisms in this way, it is expected that strategies can be developed to effectively control ER stress in cells and achieve advanced secretion of target proteins.

Methods

Culture media

Minimal medium (M) (0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4⋅7 H2O, 0.002% FeSO4⋅7 H2O and 2% glucose, pH 5.5), M supplemented with 0.15% methionine (MM), M or MM supplemented with 0.1% of uracil and negligible quantity of uridine (M + UU, MM + UU), Czapek-Dox (CD) medium (0.3% NaNO3, 0.2% KCl, 0.1% KH2PO4, 0.05% MgSO4⋅7 H2O, 0.002% FeSO4⋅7H2O, and 2% glucose, pH 5.5), CD supplemented with 0.15% methionine (CDm), CDm supplemented with 0.1 µg/ml pyrithiamine (CDm + pyri), and CD or CDm supplemented with 0.1% of uracil and a trace amount of uridine (CD + UU, CDm + UU) were utilized for culture in each experiment due to the auxotrophy of each strain.

To exclude both pyrG marker and Cre expression cassette, the Cre/loxP system was induced by culturing on an Mm + UU agar plate with the addition of 2% xylose. To complement the pyrG gene, culturing on a CDm agar plate with addition of pyrithiamine.

Growth measurement was performed using CDm medium with or without the addition of 2 or 5 mM DTT. NSlDN1 was used as a negative control, whereas MCP was determined for its effect of the MBS cassette compared to the bipA-MS2 strain. The amount of conidia for inoculation was 1.0 × 105 conidia/10 µl, and subsequently incubated at 30oC for 3 days before measuring the diameter of the fungal colony in each condition.

Plasmid and strain construction

All A. oryzae strains and plasmids used in this study are summarized in Tables 1 and Table 2, respectively. The bipA-MBS cassette was generated from glaA-MBS cassette as template for MBS cassette18using PrimeSTAR MAX DNA polymerase (Takara) (YM115; CAGAGCCCCCTGGCAATCGC and YM122; GCGGCCGCGTTAACCGCTCA) and bipA gene was amplified by conventional PCR using PrimeSTAR GXL DNA polymerase (Takara) from the genomic DNA of RIB40 (PS9; GGT TAACGCGGCCGCCAAGGTCCAGGCTCTTCTCGA and PS10 : TGCCAGGGGGCTCTGTTACAGTTCGTCATGCCCAGAGG). The two cassettes were ligated using Fusion HD Cloning Kit (Takara) to perform the insertion of MBS cassette after the bipA ORF. Then, the transformant with 24×MBS (approximately 1.6 kb) was selected. To construct a complete bipA-MBS cassette, the plasmid vector containing 24×MBS was amplified using PrimeSTAR MAX DNA polymerase (YM116; TACCGTTCGTATAATGTATGCTATACGAAGTTATC and YM130; GCGGCCGCTATGGTGCACTC) before ligating with around 1 kb of bipA 3’-UTR from the amplification by conventional PCR using PrimeSTAR GXL DNA polymerase from the genomic DNA of wild type strain (PS11; ATTATACGAACGGTAAATATTTAGAGGGATGTATGGAGTT and PS12 : CACCATAGCGGCCGCCACCACGCCTATACAAAATTTAC), generating the complete bipA-MBS casstte. After that, the bipA-MBS casstte was digested by NotI and transformed into NSPlD1 to generate bipA-24×MBSa strain. Then, the pyrG marker was excluded by Cre-loxP system, resulting to generate bipA-24×MBSb strain. Then, the strain was transformed with the plasmid carrying the MCP with 2 copies of EGFP, the pgPpNM2G plasmid18generating the bipA-MS2ΔpyrG strain containing the fully MS2 system. Next, pyrG was complemented by the plasmid pgSmaI-pyrG-ptrA18creating bipA-MS2, which was the strain used in fungal growth measurement. For bipA-MS2 with nuclear localization, pgPtmCN18 was inserted into the bipA-MS2 strain, producing bipA-MS2-NLS strain. And for bipA-MS2 with ER and microtubule localization, the pgPpS61mCS and pgPamCAtuA18 was inserted to localize ER and microtubule, constructing bipA-MS2-Aosec61 and bipA-MS2-AtuA strains, respectively.

Table 1.

Strains used in this study.

Strain Genotype References
RIB40 Wild-type
NSPlD1 niaD− sC− adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA 42
NSlDN1 niaD− niaD sC− adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA pyrG 24
PaG niaD− (PamyB-egfp niaD) sC− AosC adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA 16
MCPG2 niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA 19
MCP niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA pyrG This study
MCP-NLS niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− (PAotps1-mcherry-nls AosC) adeA- ΔargB::adeA− ΔligD::argB ΔpyrG::adeA pyrG This study
bipA-MS2 niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA bipA-24×mbs::pyrG pyrG This study
bipA-MS2-NLS niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− (PAotps1-mcherry-nls AosC) adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA bipA-24×mbs::pyrG pyrG This study
bipA-MS2-Aosec61 niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− (PpgkA-Aosec61-mcherry AosC) adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA bipA-24×mbs::pyrG pyrG This study
bipA-MS2-AtuA niaD− (PpgkA-nls-mcp-2×egfp niaD) sC− (PatuA-mcherry-atuA AosC) adeA− ΔargB::adeA− ΔligD::argB ΔpyrG::adeA bipA-24×mbs::pyrG pyrG This study

Table 2.

Plasmids used in this study.

Plasmid Content References
glaA-MBS cassette NotI-glaA ORF-lox66-pyrG-Cre-lox71-glaA 3’UTR-NotI 18
bipA-MBS cassette NotI-bipA ORF-lox66-pyrG-Cre-lox71-bipA 3’UTR-NotI This study
pgPpNM2G PpgkA-nls-mcp-2×egfp-TamyB-niaD 18
pgSmaI-pyrG-ptrA SmaI-pryG-ptrA 18
pgPtmCN PAotps1-mcherry-nls-TamyB-AosC 18
pgPpS61mCS PpgkA-Aosec61-mcherry-TamyB-AosC 18
pgPamCAtuA PatuA-mcherry-atuA-TamyB-AosC 18

MCPG2 strain was complemented with pyrG gene using the same plasmid as above for auxotrophy, generating MCP strain, used for fungal growth measurement19. For visualization of the nuclear localization, pgPtmCN18 was introduced into the MCP strain, creating MCP-NLS strain.

Quantitative RT-PCR analysis

The amount of bipA mRNA was determined by using quantitative reverse transcription PCR (qRT-PCR) which was followed as previously described39. The bipA-MS2-NLS strain was inoculated at 1.0 × 105 conidia in 100 ml of CD medium. After culturing at 30oC for 20 h at 170 rpm, mock and DTT treatments were performed and RNA extraction was carried out using RNeasy® Plant mini Kit (Qiagen). The cDNAs were synthesized by the SuperPrep Cell Lysis & RT Kit for qPCR (Toyobo). For qRT-PCR analysis, Thermal Cycler Dice real Time System TP-800 instrument (Takara) and Thunderbird SYBR qPCR MIX (Toyobo) were used. The housekeeping gene gpdA was used for normalization, and its expression was measured by using gpdA-Fw-RT (CGTCGAGTCCACTGGTGTCTT) and gpdA-Rv-RT (TTGTTGACACCCATAACGAACATGG)39. The expression of bipA mRNA level was measured by using bipA-RT-F (CGCAAGTACGATGACAAGGATGTC) and bipA-RT-R (CTCAGGAGTGAAGGTCTTGGGG).

For qRT-PCR of bipA mRNA in the washout experiment, 1.0 × 105 conidia of the bipA-MS2-NLS strain were inoculated in 100 ml of CD medium and cultured at 30oC for 20 h at 170 rpm. Thereafter, a 1 mM DTT treatment was performed for 1 h before washing with 100 ml of CD medium. Subsequently, the washed mycelium was re-inoculated immediately in the fresh 100 ml of CD medium with or without 1 mM DTT. The mycelium was collected after culturing for various times, as 0.5, 1.5 and 3 h of both mock and washout conditions before proceeding with the qRT-PCR as described above.

Fluorescence microscopy

Two hundred µl of the sterilised culture medium with a 0.2 μm filter was applied into polylysine-coated glass bottom dishes, which were inoculated with 8.0 × 104 conidia/8 µl of each strain and cultured for 20 h at 30°C before observation under microscope as previously described18. To induce the ER stress, Dithiothreitol (DTT, stock concentration of 1 mg/µl in deionized water) was used. To inhibit RNA synthesis, actinomycin D (ActD, stock concentration of 100 mg/µl in DMSO, FUJIFILM) was utilized. To inhibit microtubule synthesis, nocodazole (Noc, stock concentration of 10 mg/ml in DMSO, Sigma) was applied. To inhibit protein translation, cycloheximide (CHX, stock concentration of 100 mg/ml in DMSO, FUJIFILM) was used.

THUNDER Imager Live Cell (Leica microsystem) and its platform were employed to perform live cell imaging as previously described in detail19. In this study, the EGFP and mCherry fluorescent signals observation along with the fungal morphology was performed similarly as previous study18. The fluorescence images were processed through Instant Computational Clearing (ICC) as in earlier studies18,19 which were followed by these settings: bipA mRNA, FITC = 0.4 μm; mCherry-NLS, TXRED/RFP = 1.6 μm; mCherry-Aosec61 and mCherry-AtuA, TXRED/RFP = 0.4 μm.

Live cell imaging analysis of bipA mRNA

To quantify each dot represented as individual mRNA, RS-FISH plugin in ImageJ Fiji was implemented40,41. The imaging process was followed from a previous study18. Briefly, the stacks of EGFP of bipA mRNA and mCherry of nuclear localization were converted from 16 bit to 8 bit and then colored as green and magenta (for visualization to color-blind individuals), respectively. Next, these merged stacks were cropped for each hyphal region, referring to each condition. After that, the stack was segmented, and the nuclei were processed through binary segmentation before subtraction with bipA mRNA by the image calculator. The eliminated-nuclear fluorescence of the bipA mRNA stack was then subtracted by Math function and adding Gaussian blur before processing through RS-FISH plugin. The RS-FISH setup for mRNA quantification was performed as follows, with some modifications to the previously reported method19. For Radial Symmetry, the Mode was set as Interactive while the ZYX of 1.000 was used. RANSAC and the anisotropy coefficient for Dog were applied. Linear Interpolation was chosen for the Spot intensity. The counts of bipA mRNA were quantified with Adjust difference-of-gaussian values set to sigma = 1.5 and Threshold = 0.007.

To investigate the relationship between DTT concentration and bipA expression, the DTT concentration of 10-fold dilution of 10, 1, 0.1, 0.01 mM and mock (as negative control) were treated after the standard conidial culturing condition (8.0 × 104 conidia/8 µl, 20 h at 30 °C) for 1 h before observing only apical region under microscope. Then, the quantification of bipA mRNA by RS-FISH was conducted as described above. For washout, after culturing at 30°C for 20 h, 1 mM DTT was added and the culture was incubated for 1 h. Subsequently, the cells were washed twice with DTT-free medium or subjected to mock treatment, and the amount of bipA mRNA in the apical region was measured and quantified at 0.25, 0.5, 1, 1.5, 2, 2.5, and 3 h.

To analyze the co-localization between the bipA mRNA and ER, colocalization finder in plugin of the ImageJ Fiji was used to calculate the correlation coefficients as previously described in glaA-MS2 dynamics analysis18.

Inhibitor treatments

To examine the effect of transcription inhibition on bipA mRNA expression under ER stress, actinomycin D (ActD) was used at a final concentration of 100 µg/ml together with 1 mM DTT for 1 h incubation at 30oC after the standard conidial culturing condition (8.0 × 104 conidia/8 µl, 20 h at 30°C), before observation under microscope and mRNA quantification.

To determine the dynamics of bipA mRNA during the inhibition of microtubule polymerization under ER stress, 1 mM DTT was added for 30 min after the standard conidial culturing condition (8.0 × 104 conidia/8 µl, 20 h at 30°C). Subsequently, nocodazole (or DMSO as the control) was added at a final concentration of 100 µg/ml with 1 mM DTT and incubated for 30 min before observation under microscope.

To investigate the effect of cycloheximide (CHX), a translation inhibitor, we used the PaG strain expressing cytoplasmic EGFP. First, to suppress EGFP expression, cells were cultured for 20 h in CD medium with 2% glucose replaced by 2% glycerol. Subsequently, to induce EGFP, cells were cultured for 3 h in CD medium replaced by 2% maltose, and DMSO or CHX at a final concentration of 100 µg/ml was added simultaneously. To examine the dynamics of bipA mRNA during the inhibition of translation under ER stress, 1 mM DTT was added for 30 min after the standard conidial culturing condition (8.0 × 104 conidia/8 µl, 20 h at 30°C). Subsequently, 100 µg/ml CHX (or DMSO as the control) was added with 1 mM DTT and incubated for 30 min before observation under microscope.

Analysis of tracking dynamics of bipA mRNA

To Track bipA mRNA in both ER and microtubules, TrackMate plug-in was utilized to analyze the dynamics, which have been widely used in previous studies18,19. In this study, the DoG detector was applied and set to the 0.3 μm for the object diameter and the quality threshold was set to 0.5. The initial threshold for spot filtering was set autonomously. Next, the LapTracker was set as follows: the distance between frames was 0.5 μm, while the gap distance was 0.8 μm in one frame. The gap frame reduced to only one frame compared to other previous studies18,19 ensuring to capture the dynamics of bipA mRNA in the overexpression under DTT treatment for quantitative analysis.

Statistical analysis

The unpaired two-tailed t testing, one-way analysis of variance (ANOVA) testing with Tukey’s post hoc testing, two-way ANOVA testing with Sidak’s multiple comparisons testing, and non-parametric Mann–Whitney U testing were performed using GraphPad Prism version 10.5.0.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (347.7KB, pdf)

Acknowledgements

We would like to thank Keishu Kawatomi, Haruka Koga and Yukie Shima for experimental help. We are grateful to the Center for Advanced Instrumental and Educated Supports at the Faculty of Agriculture, Kyushu University for technical assistance with fluorescence microscopy. This study was supported by the Royal Thai Government Scholarship to P.T. and JSPS KAKENHI grant numbers JP22H02245, JP23K23512 and JP25K01935 to Y.H.

Author contributions

P.T. performed experiments. P.T., Y.M., Y.K., K.T., A.B. and Y.H. analyzed data. P.T., A.B. and Y.H. wrote the paper. Y.H. devised the project.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Shoji, J. Y., Kikuma, T. & Kitamoto, K. Vesicle trafficking, organelle functions, and unconventional secretion in fungal physiology and pathogenicity. Curr. Opin. Microbiol.20, 1–9 (2014). [DOI] [PubMed] [Google Scholar]
  • 2.Higuchi, Y. Membrane traffic related to endosome dynamics and protein secretion in filamentous fungi. Biosci, Biotechnol, Biochem. 85, 1038–1045 (2021). [DOI] [PubMed] [Google Scholar]
  • 3.Pinar, M. & Peñalva, M. A. The fungal RABOME: RAB GTPases acting in the endocytic and exocytic pathways of Aspergillus Nidulans (with excursions to other filamentous fungi). Mol. Microbiol.116, 53–70 (2021). [DOI] [PubMed] [Google Scholar]
  • 4.Machida, M. et al. Genome sequencing analysis of Aspergillus oryzae. Nature438, 1157–1161 (2005). [DOI] [PubMed] [Google Scholar]
  • 5.Higuchi, Y. Membrane traffic in Aspergillus oryzae and related filamentous fungi. J. Fungi. 7, 534 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kitamoto, K. Cell biology of the Koji mold Aspergillus oryzae. Biosci. Biotechnol. Biochem.79, 863–869 (2015). [DOI] [PubMed] [Google Scholar]
  • 7.Hayakawa, Y., Ishikawa, E., Shoji, J., Nakano, H. & Kitamoto, K. Septum-directed secretion in the filamentous fungus Aspergillus oryzae. Mol. Microbiol.81, 40–55 (2011). [DOI] [PubMed] [Google Scholar]
  • 8.Gomi, K. Regulatory mechanisms for amylolytic gene expression in the Koji mold Aspergillus oryzae. Biosci. Biotechnol. Biochem.83, 1385–1401 (2019). [DOI] [PubMed] [Google Scholar]
  • 9.Tanaka, M. & Gomi, K. Induction and repression of hydrolase genes in Aspergillus oryzae. Front. Microbiol.12, 677603 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gavis, E. R. & Lehmann, R. Localization of nanos RNA controls embryonic Polarity. Cell71, 301–313 (1992). [DOI] [PubMed] [Google Scholar]
  • 11.Müntjes, K., Devan, S. K., Reichert, A. S. & Feldbrügge, M. Linking transport and translation of mRNAs with endosomes and mitochondria. EMBO Rep.22, e52445 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Das, S., Vera, M., Gandin, V., Singer, R. H. & Tutucci, E. Intracellular mRNA transport and localized translation. Nat. Rev. Mol. Cell. Biol.22, 483–504 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cassella, L. & Ephrussi, A. Subcellular Spatial transcriptomics identifies three mechanistically different classes of localizing RNAs. Nat. Commun.13, 6355 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hobson, B. D. et al. Subcellular and regional localization of mRNA translation in midbrain dopamine neurons. Cell. Rep.38, 110208 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Higuchi, Y. & Takegawa, K. Single-molecule FISH reveals subcellular localization of α-amylase and actin mRNAs in the filamentous fungus Aspergillus oryzae. Front. Microbiol.11, 578862 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Morita, Y., Katakura, Y., Takegawa, K. & Higuchi, Y. Correlative localization analysis between mRNA and enhanced green fluorescence protein-fused protein by a single-molecule fluorescence in situ hybridization using an Egfp probe in Aspergillus oryzae. Front. Fungal Biol.2, 721398 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tutucci, E., Vera, M. & Singer, R. H. Single-mRNA detection in living S. cerevisiae using a re-engineered MS2 system. Nat. Protoc.13, 2268–2296 (2018). [DOI] [PubMed] [Google Scholar]
  • 18.Morita, Y., Takegawa, K., Collins, B. M. & Higuchi, Y. Polarity-dependent expression and localization of secretory glucoamylase mRNA in filamentous fungal cells. Microbiol. Res.282, 127653 (2024). [DOI] [PubMed] [Google Scholar]
  • 19.Kawatomi, K. et al. Live cell imaging of β-tubulin mRNA reveals spatiotemporal expression dynamics in the filamentous fungus Aspergillus oryzae. Sci. Rep.14, 13797 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tanaka, M., Shintani, T. & Gomi, K. Unfolded protein response is required for Aspergillus oryzae growth under conditions inducing secretory hydrolytic enzyme production. Fungal Genet. Biol.85, 1–6 (2015). [DOI] [PubMed] [Google Scholar]
  • 21.Tanaka, M. et al. Physiological ER stress caused by amylase production induces regulated Ire1-dependent mRNA decay in Aspergillus oryzae. Commun. Biol.6, 1009 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Acosta-Alvear, D., Harnoss, J. M., Walter, P. & Ashkenazi, A. Homeostasis control in health and disease by the unfolded protein response. Nat. Rev. Mol. Cell. Biol.26, 193–212 (2025). [DOI] [PubMed] [Google Scholar]
  • 23.Ohno, A., Maruyama, J., Nemoto, T., Arioka, M. & Kitamoto, K. A carrier fusion significantly induces unfolded protein response in heterologous protein production by Aspergillus oryzae. Appl. Microbiol. Biotechnol.92, 1197–1206 (2011). [DOI] [PubMed] [Google Scholar]
  • 24.Morita, Y., Kikumatsu, F., Higuchi, Y., Katakura, Y. & Takegawa, K. Characterization and functional analysis of ERAD-related AAA + ATPase Cdc48 in Aspergillus oryzae. Fungal Biol.124, 801–813 (2020). [DOI] [PubMed] [Google Scholar]
  • 25.Maruyama, J., Kikuchi, S. & Kitamoto, K. Differential distribution of the Endoplasmic reticulum network as visualized by the BipA-EGFP fusion protein in hyphal compartments across the septum of the filamentous fungus, Aspergillus oryzae. Fungal Genet. Biol.43, 642–654 (2006). [DOI] [PubMed] [Google Scholar]
  • 26.Lajoie, P., Fazio, E. N. & Snapp, E. L. Approaches to imaging unfolded secretory protein stress in living cells. Endoplasmic Reticulum Stress Dis.1, 27–39 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kyeong, M. & Lee, J. S. Endogenous bip reporter system for simultaneous identification of ER stress and antibody production in Chinese hamster ovary cells. Metab. Eng.72, 35–45 (2022). [DOI] [PubMed] [Google Scholar]
  • 28.Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S. & Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell159, 635–646 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pichon, X. et al. Visualization of single endogenous polysomes reveals the dynamics of translation in live human cells. J. Cell. Biol.214, 769–781 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang, C., Han, B., Zhou, R. & Zhuang, X. Real-time imaging of translation on single mRNA transcripts in live cells. Cell. 165, 990–1001 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wu, B., Eliscovich, C., Yoon, Y. J. & Singer, R. H. Translation dynamics of single mRNAs in live cells and neurons. Science352, 1430–1435 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yan, X., Hoek, T. A., Vale, R. D. & Tanenbaum, M. E. Dynamics of translation of single mRNA molecules in vivo. Cell165, 976–989 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Baumann, S., König, J., Koepke, J. & Feldbrügge, M. Endosomal transport of Septin mRNA and protein indicates local translation on endosomes and is required for correct Septin filamentation. EMBO Rep.15, 94–102 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Higuchi, Y., Ashwin, P., Roger, Y. & Steinberg, G. Early endosome motility spatially organizes polysome distribution. J. Cell. Biol.204, 343–357 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Béthune, J., Jansen, R. P., Feldbrügge, M. & Zarnack, K. Membrane-associated RNA-binding proteins orchestrate organelle-coupled translation. Trends Cell. Biol.29, 178–188 (2019). [DOI] [PubMed] [Google Scholar]
  • 36.Gasparski, A. N., Mason, D. E., Moissoglu, K. & Mili, S. Regulation and outcomes of localized RNA translation. Wiley Interdiscip Rev. RNA. 13, e1721 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Child, J. R. et al. Examining SRP pathway function in mRNA localization to the endoplasmic reticulum. RNA29, 1703–1724 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Porat, J. & Flynn, R. A. Cell surface RNA biology: new roles for RNA binding proteins. Trends Biochem. Sci.50, 402–416 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Togo, Y., Higuchi, Y., Katakura, Y. & Takegawa, K. Early endosome motility mediates α-amylase production and cell differentiation in Aspergillus oryzae. Sci. Rep.7, 15757 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 9, 676–682 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bahry, E. et al. RS-FISH: precise., interactive., fast., and scalable FISH spot detection. Nat. Methods. 19, 1563–1567 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Maruyama, J. & Kitamoto, K. Multiple gene disruptions by marker recycling with highly efficient gene-targeting background (∆ligD) in Aspergillus oryzae. Biotechnol. Lett.30, 1811–1817 (2008). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (347.7KB, pdf)

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES