Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2005 Oct;43(10):5026–5033. doi: 10.1128/JCM.43.10.5026-5033.2005

Novel Multiplex PCR Assay for Characterization and Concomitant Subtyping of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus

Kunyan Zhang 1,2,3,4,5,*, Jo-Ann McClure 1, Sameer Elsayed 2,3,5, Thomas Louie 3,4, John M Conly 1,2,3,4,5
PMCID: PMC1248471  PMID: 16207957

Abstract

Staphylococcal cassette chromosome mec (SCCmec) typing is essential for understanding the molecular epidemiology of methicillin-resistant Staphylococcus aureus (MRSA). SCCmec elements are currently classified into types I to V based on the nature of the mec and ccr gene complexes, and are further classified into subtypes according to their junkyard region DNA segments. Previously described traditional SCCmec PCR typing schemes require multiple primer sets and PCR experiments, while a previously published multiplex PCR assay is limited in its ability to detect recently discovered types and subtypes such as SCCmec type V and subtypes IVa, b, c, and d. We designed new sets of SCCmec type- and subtype-unique and specific primers and developed a novel multiplex PCR assay allowing for concomitant detection of the methicillin resistance (mecA gene) (also serving as an internal control) to facilitate detection and classification of all currently described SCCmec types and subtypes I, II, III, IVa, b, c, d, and V. Our assay demonstrated 100% sensitivity and specificity in accurately characterizing 54 MRSA strains belonging to the various known SCCmec types and subtypes, when compared with previously described typing methods. Further application of our assay in 453 randomly selected local clinical isolates confirmed its feasibility and practicality. This novel assay offers a rapid, simple, and feasible method for SCCmec typing of MRSA, and may serve as a useful tool for clinicians and epidemiologists in their efforts to prevent and control infections caused by this organism.


Methicillin, the first semisynthetic penicillin to be developed, was introduced in 1959 to overcome the problem of penicillin-resistant Staphylococcus aureus due to β-lactamase (penicillinase) production (17). However, methicillin-resistant S. aureus (MRSA) strains were identified soon after its introduction (2, 14). MRSA strains have acquired and integrated into their genome a 21- to 67-kb mobile genetic element, termed the staphylococcal cassette chromosome mec (SCCmec), which harbors the methicillin resistance (mecA) gene and other antibiotic resistance determinants (10, 12, 19). Since then, strains of MRSA have spread and become established as major nosocomial pathogens worldwide (1, 5, 8, 26, 32). Recently, these organisms have evolved and emerged as a major cause of community-acquired infections (16, 31). These newly emerging community-acquired MRSA strains possess novel, small, mobile SCCmec type IV or V genetic elements which contain the mecA gene with or without additional antibiotic resistance genes and are more easily transferred to other strains of S. aureus than larger SCCmec (types I, II, and III) elements (22, 31). The emerging spread of these community-acquired MRSA strains poses a significant threat to public health (16, 31).

SCCmec is a mobile genetic element characterized by the presence of terminal inverted and direct repeats, two essential genetic components (the mec gene complex and the ccr gene complex), and the junkyard (J) regions (10, 12, 19). The mec gene complex is composed of IS431mec, mecA, and intact or truncated sets of regulatory genes, mecR1 and mecI. The ccr gene complex encodes the recombinases (ccr) that mediate the integration of SCCmec into and its excision from the recipient chromosome and are, therefore, responsible for its mobility. The rest of the SCCmec element is comprised of J regions (J1, J2, and J3) that are located between and around the mec and ccr complexes and contain various genes or pseudogenes whose does not appear to be essential or useful for the bacterial cell, although notable exceptions include plasmid- or transposon-mediated resistance genes for non-β-lactam antibiotics or heavy metals (13). To date, there are three classes (A, B, and C) of mec complex and four allotypes (types 1, 2, 3, and 5) of ccr complex. Different combinations of these complex classes and allotypes generate various SCCmec types (Table 1). SCCmec elements are currently classified into types I, II, III, IV, and V based on the nature of the mec and ccr gene complexes, and are further classified into subtypes according to differences in their J region DNA (10, 12, 19).

TABLE 1.

Current SCCmec types and type IV subtypes

SCCmec typea mec complexb ccr complexc Original strain GenBank no. (reference)
I Class B Type 1 NCTC10442 AB033763 (10)
II Class A Type 2 N315 D86934 (10)
III Class A Type 3 85/2082 AB37671 (10)
IVa Class B Type 2 CA05 AB063172 (19)
IVb Class B Type 2 8/6-3P AB063173 (19)
IVc Class B Type 2 MR108 AB096217 (13)
IVd Class B Type 2 JCSC4469 AB097677
V Class C Type 5 WIS [WBG8318]- JCSC3624 AB12121 (12)
a

Subtypes of SCCmec IV differ based on the junkyard (J) region DNA.

b

Class A mec: IS431-mecA-mecR1-mecI; class B mec: IS431-mecA-ΔmecR1-IS1272; class C mec: IS431-mecA-ΔmecR1-IS431.

c

Type 1 ccr: ccrB1-ccrA1; type 2 ccr: ccrB2-ccrA2; type 3 ccr: ccrB3-ccrA3; type 5 ccr: ccrC.

A thorough understanding of the molecular epidemiology and evolution of MRSA is required to help detect, track, control and prevent human disease due to this organism. Full characterization of MRSA requires definition of not only the putative bacterial genetic background but also of the complex and heterologous SCCmec elements. SCCmec typing is an important molecular tool and its importance in community clonal outbreaks is increasingly being recognized (16, 22, 31). The new MRSA nomenclature scheme recently set by the International Union of Microbiology Societies incorporates SCCmec typing information in conjunction with that provided by multilocus sequence typing (7, 28, 29). Previously described SCCmec traditional PCR typing schemes have required the use of many (20 to 30) primer sets and multiple individual PCR experiments (23). The only previously described multiplex PCR assay for SCCmec typing (24) is more difficult to interpret and is limited in its ability to detect SCCmec subtypes IVa, b, c, and d plus the newly described type V, these groups being implicated in currently emerging community MRSA outbreaks (12, 31).

Here we report a recently developed novel multiplex PCR assay capable of detecting and classifying all currently described SCCmec types plus the major subtypes, with simultaneous discrimination of MRSA from methicillin-susceptible S. aureus (MSSA).

MATERIALS AND METHODS

Bacterial strains and isolates.

The SCCmec typing standard MRSA control strains, including type I (NCTC10442), type II (N315), type III (85/2082), type IVa (CA05), type IVb (8/6-3P), type IVc (MR108), type IVd (JCSC4469), and type V (WIS [WBG8318]-JCSC3624) (Table 1), were obtained from K. Hiramatsu and T. Ito at the Juntendo University in Tokyo, Japan (10, 12, 19, 23). Additional SCCmec reference strains, including type I (COL and PER34) and type III (ANS46), were kindly provided by H. de Lencastre, Rockefeller University, New York (24). The Canadian epidemic MRSA reference strains, CMRSA-1 to 6, and strain N02-590 were provided by M. Mulvey, National Microbiology Laboratory, Health Canada, Winnipeg, Canada (30).

Our local strains of MRSA belonging to various SCCmec types were obtained from Calgary Laboratory Services (CLS), Calgary, Alberta, Canada, and which had previously underwent complete phenotypic and genotypic analyses at the Centre for Antimicrobial Resistance, Calgary, Alberta, Canada (Table 3). Clinical MRSA isolates used for assessing the applicability and utility of our multiplex PCR (M-PCR) assay were randomly selected from the CLS frozen clinical isolate stock collected over the August 1999 to November 2004 time period. Additional historical clinical MRSA strains were recovered from five tertiary acute-care teaching hospitals located in 4 cities in 3 provinces of the Canadian Prairies (Winnipeg, Manitoba; Saskatoon, Saskatchewan; Calgary, Alberta; and Edmonton, Alberta) during the 1989 to 1994 period (6).

TABLE 3.

Comparison of our assay with the traditional PCR and an M-PCR SCCmec typing method

Straina Traditional PCR typingb
Oliveira's M-PCRc Our novel assay
mec complex type ccr complex type SCCmec type
NCTC10442 B 1 I I I
COL B 1 I I I
PER34 B 1 I I I
N315 A 2 II II II
CMRSA-2 A 2 II II II
MRSA-80 A 2 II II II
CLS-5153 A 2 II II II
CLS-5371 A 2 II II II
CLS-440 A 2 II II II
CLS-72251 A 2 II II II
CLS-69500 A 2 II II II
CLS-68961 A 2 II II II
CLS-6146 A 2 II II II
CLS-4021 A 2 II II II
CLS-2516 A 2 II II II
CLS-52692 A 2 II II II
CLS-19095 A 2 II II II
85/2082 A 3 III IIIB III
ANS46 A 3 III III III
CMRSA-3 A 3 III IIIA III
CMRSA-6 A 3 III III III
CLS-5861 A 3 III III III
CLS-1777 A 3 III III III
H163 A 3 III III III
H478 A 3 III III III
H527 A 3 III III III
CA05 B 2 IV IV IVa
N02-590 B 2 IV IV IVa
CLS-2207 B 2 IV IV IVa
CLS-3860 B 2 IV IV IVa
CLS-2772 B 2 IV IV IVa
CLS-1236 B 2 IV IV IVa
CLS-884 B 2 IV IV IVa
CLS-2772 B 2 IV IV IVa
CLS-4550 B 2 IV IV IVa
CLS-2245 B 2 IV IV IVa
CLS-5897 B 2 IV IV IVa
CLS-847 B 2 IV IV IVa
CLS-846 B 2 IV IV IVa
CLS-2525 B 2 IV IV IVa
CLS-3497 B 2 IV IV IVa
CLS-5401 B 2 IV IV IVa
CLS-5381 B 2 IV IV IVa
CLS-284 B 2 IV IV IVa
8/6-3P B 2 IV IV IVb
CLS-4584 B 2 IV IV IVb
CLS-5827 B 2 IV IV IVb
CLS-6572 B 2 IV IV IVb
MR108 B 2 IV IV IVc
CLS-1040 B 2 IV IV IVc
H434 B 2 IV IV IVc
JCSC 4469 B 2 IV IV IVd
CMRSA-5 B 2 IV IV IVd
JCSC 3624 WIS [WBG8318] C2 5 V III V
a

The SCCmec typing standard MRSA control strains were: type 1 (NCTC10442), type II (N315), type III (85/2082), type IVa (CA05), type IVb (8/6-3P), type IVc (MR108), type IVd (JCSC4469), and type V (WIS [WBG8318]-JCSC3624); additional SCCmec reference strains were type 1 (COL and PER34) and type III (ANS46); The Canadian epidemic MRSA reference strains were CMRSA-1 to 6 and strain N02-590. Our local SCCmec type control strains are designated CLS and H.

b

Traditional PCR SCCmec typing methods (10, 12, 19, 23).

c

Oliveira's multiplex PCR assay (24).

Identification and phenotypic susceptibility testing of staphylococcal isolates.

The staphylococcal isolates were identified morphologically and biochemically by standard laboratory procedures (21). The coagulase plasma test (Remel, Lenexa, KS) was performed on organisms exhibiting typical staphylococcal colony morphology to allow for discrimination of S. aureus from coagulase-negative staphylococci. Screening for methicillin and other antibiotic resistance phenotypes was done by VITEK (bioMerieux, Inc. Durham, NC) along with the NCCLS oxacillin agar screen, while confirmation of methicillin resistance was achieved using an in-house assay for the mecA gene (9).

Sequence alignment and primer design.

New sets of SCCmec type- and subtype-unique and specific primers, as well as the novel specific primers for mecA gene, and for typing mec and ccr gene complexes (Table 2) were designed based on the comprehensive analyses and alignments of the S. aureus and MRSA genomes and SCCmec sequences currently available in the GenBank database (National Center for Biotechnology Information; updated as of December, 2004). Gene targets, strains and accession numbers for each primer pair are as follows: type I, ORF E008 of strain NCTC10442 (AB033763); type II, kdpE of strain N315 (D86934); type III, ORF CZ049 of strain 85/2082 (AB37671); type IVa, ORF CQ002 of strain CA05 (AB063172); type IVb, ORF CM001 of strain 8/6-3P (AB063173); type IVc, ORF CR002 of strain MR108 (AB096217); type IVd, ORF CG001 of strain JCSC4469 (AB097677); type V, ORF V011 of strain JCSC3624 (AB12121); mecA, mecA gene of strain NCTC8325 (X52593); mecI, of strain N315; IS1272 and mecR1, R of strain CA05; ccrC, of strain JSCS 3624. The ccrAB primers are as previously described (10). The oligonucleotide primers used in this study were synthesized and purchased from QIAGEN Operon (QIAGEN Inc., Alameda, CA).

TABLE 2.

Primers used in this study

Primer Oligonucleotide sequence (5′-3′) Concn (μM) Amplicon size (bp) Specificity Reference
Type I-F GCTTTAAAGAGTGTCGTTACAGG 0.048 613 SCCmec I This study
Type I-R GTTCTCTCATAGTATGACGTCC
Type II-F CGTTGAAGATGATGAAGCG 0.032 398 SCCmec II This study
Type II-R CGAAATCAATGGTTAATGGACC
Type III-F CCATATTGTGTACGATGCG 0.04 280 SCCmec III This study
Type III-R CCTTAGTTGTCGTAACAGATCG
Type IVa-F GCCTTATTCGAAGAAACCG 0.104 776 SCCmec IVa This study
Type IVa-R CTACTCTTCTGAAAAGCGTCG
Type IVb-F TCTGGAATTACTTCAGCTGC 0.092 493 SCCmec IVb This study
Type IVb-R AAACAATATTGCTCTCCCTC
Type IVc-F ACAATATTTGTATTATCGGAGAGC 0.078 200 SCCmec IVc This study
Type IVc-R TTGGTATGAGGTATTGCTGG
Type IVd-F5 CTCAAAATACGGACCCCAATACA 0.28 881 SCCmec IVd This study
Type IVd-R6 TGCTCCAGTAATTGCTAAAG
Type V-F GAACATTGTTACTTAAATGAGCG 0.06 325 SCCmec V This study
Type V-R TGAAAGTTGTACCCTTGACACC
MecA147-F GTG AAG ATA TAC CAA GTG ATT 0.046 147 mecA This study
MecA147-R ATG CGC TAT AGA TTG AAA GGA T
mecI-F CCCTTTTTATACAATCTCGTT 0.08 146 Class A mec This study
mecI-R ATATCATCTGCAGAATGGG
IS1272-F TATTTTTGGGTTTCACTCGG 0.08 1,305 Class B mec This study
mecR1-R CTCCACGTTAATTCCATTAATACC
ccrAB-β2 ATTGCCTTGATAATAGCCITCT 0.08 10
ccrAB-α2 AACCTATATCATCAATCAGTACGT 0.08 700 Type 1 ccr 10
ccrAB-α3 TAAAGGCATCAATGCACAAACACT 0.08 1,000 Type 2 ccr 10
ccrAB-α4 AGCTCAAAAGCAAGCAATAGAAT 0.08 1,600 Type 3 ccr 10
ccrC-F ATGAATTCAAAGAGCATGGC 0.08 336 Type 5 ccr This study
ccrC-R GATTTAGAATTGTCGTGATTGC

DNA extraction.

Frozen bacteria were subcultured twice onto 5% sheep blood Columbia agar plates (PML Microbiologicals, Wilsonville, OR) prior to DNA extraction. For rapid DNA extraction, one to five bacterial colonies were suspended in 50 μl of sterile distilled water and heated at 99°C for 10 min. After centrifugation at 30,000 × g for 1 min, 2 μl of the supernatant was used as template in a 25-μl PCR (33).

PCR amplification.

Our SCCmec M-PCR typing assay contained 9 pairs of primers including the unique and specific primers for SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, and the primers for the mecA gene (Table 2). The M-PCR assay used for characterization of mec gene and ccr gene complexes, respectively, contained 4 primers each (mecI-F, mecI-R, IS1272-F and mecR1-R for mec gene M-PCR, and ccrAB-β2, ccrAB-α2, ccrAB-α3, and ccrAB-α4 for ccr gene M-PCR) (Table 2). The single target amplification PCR was used to determine type 5 ccr using ccrC-F and ccrC-R primers (Table 2). These primers and their respective concentrations used in the PCR are listed in Table 2. All PCR assays were performed directly from bacterial suspensions obtained after the rapid DNA extraction method. An aliquot of 2 μl of this suspension was added to 23 μl of PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate(dATP, dUTP, dGTP, and dCTP) (Invitrogen Inc., Carlsbad, CA), various concentrations of the respective primers (Table 2), and 1.0 unit of Platinum Taq DNA polymerase (Invitrogen Inc., Carlsbad, CA).

The amplification was performed in a GeneAmp PCR system 9700 or 9600 Thermal Cycler (Applied Biosystems, Foster City, CA) beginning with an initial denaturation step at 94°C for 5 min followed by 10 cycles of 94°C for 45 seconds, 65°C for 45 seconds, and 72°C for 1.5 min and another 25 cycles of 94°C for 45 seconds, 55°C for 45 seconds, and 72°C for 1.5 min, ending with a final extension step at 72°C for 10 min and followed by a hold at 4°C. For the single target amplification, PCR was run in 23 μl of PCR mixture but containing 0.2 μM of each primer, with cycling parameters beginning with an initial denaturation step at 94°C for 5 min followed by 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min, ending with a final extension step at 72°C for 10 min. For comparative purposes, SCCmec typing using Oliveira's method was performed using primer and PCR conditions described previously (24). All PCR assay runs incorporated a reagent control (without template DNA). The PCR amplicons were visualized using a UV light box after electrophoresis on a 2% agarose gel containing 0.5 μg/ml ethidium bromide.

Limiting dilution experiments for estimation of M-PCR sensitivity.

The sensitivity of amplification of various pairs of primers by M-PCR was estimated by limiting dilution experiments. Briefly, bacterial cultures from overnight growth at 37°C on 5% sheep blood agar plates were suspended in sterile saline to a density corresponding to a 1.0 McFarland turbidity standard. These suspensions were then used to prepare serial 10-fold dilutions using sterile double distilled water. DNA extraction, using the rapid method described previously, was performed on 50 μl of each dilution. The standard M-PCR assay was performed to determine its sensitivity. The lower limits of detection (or minimal numbers of CFU detectable) of the target genes by M-PCR were then calculated based on correlation of the 1.0 McFarland standard to 3 × 108 CFU/ml.

Validation and application of SCCmec typing method.

Our M-PCR assay was first optimized in the standard control strains and then validated with other control strains, and simultaneously compared with the traditional SCCmec typing methods including mec and ccr gene complex typing (described above) and a previously described multiplex PCR assay-Oliveira's method (24). To assess the applicability and utility of our SCCmec typing assay, 453 randomly selected local clinical isolates from our MRSA clinical isolate frozen stock collection for the 1989 to 2004 time period were tested. To verify our assay's ability to differentiate MRSA from MSSA, comparison of our assay with standard phenotypic susceptibility testing (VITEK) and the conventional mecA gene PCR test (above) was conducted in 150 randomly selected local clinical MSSA isolates, in addition to the above 453 clinical MRSA isolates.

RESULTS

Identification and selection of unique and specific loci and primer design for SCCmec types and subtypes.

To design the SCCmec type- and subtype-unique and specific primers, an extensive BLAST sequence similarity search was conducted and was followed by comprehensive analyses and alignments of the S. aureus and MRSA genomes and SCCmec sequences currently available in the GenBank database. These loci consisted of open reading frames (ORFs) or sequence fragments, including ORF E008 of strain NCTC10442 (AB033763), kdpE of strain N315 (D86934), ORF CZ049 of strain 85/2082 (AB37671), ORF CQ002 of strain CA05 (AB063172), ORF CM001 of strain 8/6-3P (AB063173), ORF CR002 of strain MR108 (AB096217), ORF CG001 of strain JCSC4469 (AB097677), and ORF V011 of strain JCSC3624 (AB12121), and were found to be unique and specific for SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, respectively (refer to Materials and Methods for details of gene targets, strains, and accession numbers). The corresponding SCCmec type- and subtype-unique and specific primers were designed (Table 2) and their uniqueness and specificity were further confirmed with a GenBank database BLAST search. Utilization of these primers in our novel M-PCR assay allowed us to specifically detect the currently described SCCmec types and subtypes of MRSA strains and clinical isolates.

New M-PCR for typing and subtyping SCCmec types I to V, and simultaneous detection of methicillin resistance (mecA gene).

We developed a new and simple single M-PCR assay to determine (classify) SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, and simultaneously discriminate MRSA from MSSA. The M-PCR assay targeted the unique and specific loci of SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, with concomitant mecA gene detection, the last serving as a determinant of methicillin resistance but also serving as an internal positive control for the assay.

To ensure the individual primer pairs were adequate for the amplification of all nine loci (gene fragments), the single-target PCR protocol with each individual primer pair was conducted prior to the M-PCR optimization, using eight SCCmec standard control strains: type I (NCTC10442), type II (N315), type III (85/2082), type IVa (CA05), type IVb (8/6-3P), type IVc (MR108), type IVd (JCSC4469) and type V (WIS [WBG8318]-JCSC3624) (Tables 1 and 3). Each individual PCR amplification reaction yielded the fragment of the expected size, i.e., 613, 398, 280, 776, 493, 200, 881, 325, and 147 bp for the unique and specific loci of SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, and mecA gene in their corresponding strains, respectively. The optimized M-PCR condition as described above was obtained through assaying different primer concentrations and other PCR components. Amplification in a single M-PCR produced distinct bands corresponding to their respective molecular sizes that were easily recognizable in agarose gels stained with ethidium bromide (Fig. 1).

FIG. 1.

FIG. 1.

New multiplex PCR assay identifies SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, and simultaneously detects the methicillin resistance (mecA gene). Type I, lanes 1 to 3 (strains NCTC10442, COL, and PER34, respectively); type II, lanes 4 to 6 (strains N315, CLS-5153, and CLS-440, respectively); type III, lanes 7 to 9 (strains 85/2082, ANS46, and CMRSA-3, respectively); type IVa, lanes 10 to 12 (strains CA05, N02-590, and CLS-2207, respectively); type IVb, lanes 13 to 15 (strains 8/6-3P, CLS-4584, and CLS-5827, respectively); type IVc, lanes 16 and 17 (strains MR108 and CLS-1040, respectively); type IVd, lanes 18 and 19 (strains JCSC4469 and CMRSA-5, respectively); type V, lane 20 (strain WIS [WBG8318]-JCSC3624); lane 21, negative control; and lanes M, molecular size markers, 100-bp DNA ladder (BioLabs). Refer to Table 3 for details of each strain.

Sensitivity of M-PCR.

The sensitivity of our M-PCR assay was examined in 8 SCCmec standard control strains for type I (NCTC10442), type II (N315), type III (85/2082), type IVa (CA05), type IVb (8/6-3P), type IVc (MR108), type IVd (JCSC4469) and type V (WIS [WBG8318]-JCSC3624). This assay was capable of detecting, with reproducibility, a band in ethidium bromide-stained gels at dilutions corresponding to 6 × 104 CFU per PCR for all eight type- and subtype-specific genes. However, the sensitivity for the internal control mecA gene varied slightly depending on the strains examined, being 6 × 105 CFU per PCR for the strains NCTC10442 (type I), JCSC4469 (type IVd) and WIS (type V), and 6 × 104 CFU per PCR for all other type or subtype strains [N315 (type II), 85/2082 (type III), CA05 (type IVa), 8/6-3P (type IVb), and MR108 (type IVc)]. This sensitivity is quite compatible with the single target PCR assay (1 × 104 to 6 × 105) (data not shown), suggesting that our M-PCR assay is sufficiently robust.

Validation of M-PCR assay.

To validate the M-PCR assay, we simultaneously compared our assay with the traditional PCR SCCmec typing scheme including mec and ccr gene complex typing and a previously described M-PCR assay (24). Validation of our assay was performed by testing a total of 54 well-characterized MRSA strains with known SCCmec types including type I (n = 3), type II (n = 14), type III (n = 9), type IVa (n = 18), type IVb (n = 4), type IVc (n = 3), type IVd (n = 2), type V (n = 1). We found a 100% concordance in typing SCCmec types I-IV between the PCR results of our M-PCR, traditional SCCmec typing method, and Oliveira's assay (Table 3) except for one type V strain. However, in the WIS strain (type V), both our assay and the traditional SCCmec typing method correctly identified this strain as SCCmec type V, but Oliveira's M-PCR falsely categorized the strain as SCCmec type III (Table 3). In addition, our assay had more discriminatory power and was able to further classify type IV strains into subtypes IVa, b, c, and d (Table 3).

To address our assay's ability in differentiating MRSA from MSSA, we tested 150 randomly selected local clinical MSSA isolates, in addition to the above 54 MRSA control strains and the 453 clinical MRSA isolates (below) and found a mecA gene band (147 bp) in all MRSA isolates but not in any MSSA isolates, hence being 100% concordant with phenotypic susceptibility (VITEK) and conventional mecA gene PCR test results.

Applicability and accuracy of M-PCR.

To assess the applicability and accuracy of the M-PCR assay, we further applied our SCCmec typing assay to test a total of 453 local clinical MRSA isolates randomly selected from our clinical stock collection for the 16-year period from 1989 to 2004. Among them, 235 (51.88%), 122 (26.93%), 74 (16.34%), 5 (1.1%), and 4 (0.88%) isolates belonged to SCCmec types and subtypes II, III, IVa, IVb, and IVc, but no SCCmec types and subtypes I, IVd, or V were found among the isolates tested. However, there were 13 (2.87%) isolates that were not typeable using our assay, with five (1.10%) isolates having multiple bands and eight (1.77%) isolates with amplification of only the mecA gene.

These not-typeable isolates were further characterized using the traditional PCR SCCmec typing method and Oliveira's M-PCR assay. In five multiple-band isolates, one isolate presenting two bands of 200 bp and 280 bp (corresponding to types IVc and III by our new assay) was also not-typeable by the traditional PCR but was found to be type III by Oliveira's M-PCR, while the other four isolates with bands of 398 bp and either 613 bp or 200 bp (corresponding to types II and either type I or IVc by our new assay) were typed as types II in both other assays (Table 4), and may represent undescribed new variant subtypes of SCCmec type II. However, among the other eight isolates with amplification of only the mecA gene, only one isolate (mecA-band 8) was determined to be type IV by both the traditional PCR SCCmec typing method and Oliveira's M-PCR assay, while the remaining (7 isolates) had incongruent typing results among the two other typing methods (Table 4), potentially representing new types or variant subtypes.

TABLE 4.

Comparison of SCCmec typing results for traditional PCR and Oliviera's multiplex PCR assays for isolates not typeable by our multiplex PCR assay

Isolatea Our novel assayb
Traditional PCR typingc Oliveira's M-PCRd
Specific PCR product(s) (bp) Corresponding to:
Multiband 1 200 + 280 Type IVc + III Not typeable Type III
Multiband 2 398 + 613 Type II + I Type II Type II
Multiband 3 398 + 613 Type II + I Type II Type II
Multiband 4 398 + 200 Type II + IVc Type II Type II
Multiband 5 398 + 200 Type II + IVc Type II Type II
mecA band 1 147 mecA gene Not typeable Type IV
mecA band 2 147 mecA gene Not typeable Not typeable
mecA band 3 147 mecA gene Type IV Type I
mecA band 4 147 mecA gene Type IV Not typeable
mecA band 5 147 mecA gene Type II Type IV
mecA band 6 147 mecA gene Type II Type IV
mecA band 7 147 mecA gene Type I Not typeable
mecA band 8 147 mecA gene Type IV Type IV
a

Not-typeable isolates (multiple bands or single mecA gene band) using our new assay.

b

Our new multiplex PCR assay.

c

Traditional PCR SCCmec typing methods (10, 12, 19, 23).

d

Oliveira's multiplex PCR assay (24).

DISCUSSION

SCCmec typing is one of the most important molecular tools available for understanding the epidemiology and clonal strain relatedness of MRSA, particularly with the emerging outbreaks of community-acquired MRSA occurring on a worldwide basis. However, due to the very complex and diverse structure of the SCCmec element, SCCmec typing is usually achieved by DNA sequence analysis (21 to 67 kb) (10, 11, 25), Southern blot analysis using three or more restriction enzymes and several key probes specific for each SCCmec type (25), and by PCR. Previously described traditional PCR SCCmec typing schemes target the individual regions of the classes of the mec complex (IS431-mecA, IS1272-mecA, and mecI-mecRI), the allotypes of the ccr complex (ccrA1, ccrA2, ccrA3, ccrB1, ccrB2, ccrB3, and ccrC), and individual subtypes of the J regions, and therefore require the use of many primer sets and PCR experiments (12, 23). These methods are laborious, time-consuming and expensive, resulting in limited utility for clinical and surveillance purposes.

Oliveira and de Lencastre developed a multiplex PCR strategy for mec element type assignment and defined types of SCCmec based on genes located within the J-regions of SCCmec elements as follows: locus A, located downstream of the pls gene and is specific for SCCmec type-1; locus B, internal to the kdp operon, which is specific for SCCmec type II; locus C, internal to the mecI gene present in SCCmec types II and III; locus D, internal to the dcs region present in type I, II, and IV; locus E, located in the region between integrated plasmid pI258 and transposon Tn554, specific for SCCmec type III; locus F, which is also specific for SCCmec type-III located in the region between Tn554 and orfX; locus G, the left junction between IS431 and pUB110; and locus H, the left junction between IS431 and pT181 (24). This is the only single-step multiplex PCR assay published to date, but it too has its limitations. Since it is much simpler and easier to perform than the traditional (nonmultiplex) PCR assays for SCCmec typing, it has been increasingly used in favor of the traditional method. As a result, different SCCmec types are named according to the standard SCCmec type definition first established by Hiramatsu's group (T. Ito, X. Ma, Y. Kondo, P. Changtrakool, S. Traklsomboon, C. Tiensasitorn, M. Jamklang, T. Chavalit, J. Song, and K. Hiramastsu, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. 115, 2004).

In addition to hampered interpretation due to the presence of multiple bands for each SCCmec type (because of non-type-specific targets) and difficulties in assay optimization, Oliveira's assay (24) has limitations in detecting the newly described SCCmec type V, misclassifying them as type III (Table 3), while failing to discriminate type IV into subtypes a, b, c, and d (24). Since the newer SCCmec types IV and V have recently been associated with community-acquired infection (12, 31), detecting type V and discriminating type IV into subtypes IVa, b, c, and d may play an important role in the understanding of the epidemiology and ultimate prevention and control of currently emerging community MRSA clonal outbreaks. Therefore, a more robust and simpler SCCmec typing assay is urgently required.

We designed eight new sets of SCCmec type- and subtype-unique and specific primers and 1 new set of methicillin resistance (mecA gene-based) primers based on comprehensive analyses and alignments of the MSSA and MRSA genomes and SCCmec sequences, and have successfully developed a novel multiplex PCR SCCmec typing assay (in a single multiplex PCR with a single band for each type or subtype) capable of classifying MRSA isolates into SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd, and V, according to the current updated SCCmec typing system, while simultaneously being able to discriminate MRSA from MSSA.

Simultaneous comparison of our new assay with the traditional PCR SCCmec typing method (including mec and ccr gene complex typing) and Oliveira's assay demonstrated 100% sensitivity and specificity when testing a large number of control strains. Further application of our assay in randomly selected local clinical isolates confirmed its feasibility and practicality. This novel assay offers a rapid, simple, and feasible method for SCCmec typing of MRSA, and may serve as a useful tool for clinicians and epidemiologists in their efforts to prevent and control infections caused by these organisms. It has been used in our regional MRSA surveillance program and helped identify and confirm the emergence of an outbreak of community-acquired MRSA infection in Calgary, Canada in 2004, with resultant expedient implementation of prevention and control measures (J. Conly, M. Gilbert, K. Zhang, D. Gregson, S. Elsayed, M. Mulvey, K. Laupland, L. Louie, H. Rabin, B. Baylis, and P. Boiteau, Abstr. AMMI Canada-CACMID 2005 Annual Conference, Abstr. and Presentation G5, 2005; M. Gilbert, J. Suishansian, J. MacDonald, D. Gregson, S. Elsayed, K. Zhang, K. Laupland, M. Louie, T. Louie, D. Nielsen, G. Keays, A. Honish, D. Gravel, M. Mulvey, J. Gillespie, J. Conly, Abstr. AMMI Canada-CACMID 2005 Annu. Conf., abstr. and presentation G2, 2005).

It has only recently been shown that some methicillin-susceptible staphylococci, including MSSA and methicillin-susceptible coagulase-negative staphylococci, could harbor SCC elements that contain the essential features of SCCmec but lack the mecA gene (4, 15, 18, 20). These SCC elements serve as a vehicle of transfer for various genetic markers including genes mediating antibiotic resistance or virulence. The potential role of SCC for mediating gene movement in staphylococci is awaiting further investigation. Hence, our multiplex assay (incorporating a concomitant mecA gene into specific SCCmec typing system) may play a critical role in this regard.

Both the traditional PCR SCCmec typing scheme and Oliveira's multiplex PCR technique are PCR methods targeting unique loci. Not-typeable MRSA isolates are encounted when using the traditional PCR SCCmec typing scheme and Oliveira's multiplex PCR technique but the nontypeability rate is variable. Ito et al. used their traditional PCR typing method to type 617 MRSA isolates from Asian countries and found 5 (0.81%) strains were not-typeable (T. Ito, X. Ma, Y. Kondo, P. Changtrakool, S. Traklsomboon, C. Tiensasitorn, M. Jamklang, T. Chavalit, J. Song, and K. Hiramastsu, Abstr. 44th Intersci. Conf. Antimicrob. Agents Chemother., abstr. 115, 2004).

Perez-Roth et al. (27) found 11 not-typeable clones out of 375 isolates (2.93%) (due to unmatching patterns) when typing MRSA clinical isolates during a 5-year period (1998 to 2002) in a Spanish hospital, and Chung et al. (3) found 4 out of 113 isolates (3.54%) were not-typeable when typing MRSA strains recovered at a Florida hospital, when both groups of investigators used Oliveira's assay. We used our newly developed assay to type 453 local clinical randomly selected isolates and found 13 (2.87%) not-typeable isolates. Except for one isolate (mecA-band 8), the remaining 12 isolates (Table 4) are potentially new types or subtypes. The explanation for these observations, as quoted by others, may be related to the presence of new structural types and subtypes or structural rearrangements and recombination of the mec element (3, 27). Further investigations, including sequencing the mec element, are needed in order to characterize these currently not-typeable isolates.

Our newly described assay was designed to target the SCCmec type- and subtype-unique and specific gene loci, based on the currently available sequence data of the MRSA and MSSA genomes and variable SCCmec type and subtype sequences in the GenBank database. This new assay is more robust and has greater simplicity in its ability to classify all known types in a single PCR compared to currently available typing methodologies. However, we acknowledge the potential future limitations of our assay because of the possibility that as more SCCmec elements from newly emerging clinical isolates are sequenced, new SCCmec types and subtypes will be discovered, necessitating a reconfiguration of our assay to allow for the detection of these newer types.

Acknowledgments

We thank K. Hiramatsu and T. Ito for the kind gift of the SCCmec control strains NCTC10442, N315, 85/2082, CA05, 8/6-3P, MR108, JCSC4469, and WIS, H. de Lencastre for the strains COL, PER34, and ANS46, and M. Mulvey for strains CMRSA-1 to -6 and N02-590. We also thank Wally Krulicki for assistance in subculturing the historical isolates.

This work was partially supported by a CHR/CLS Research Grant to K.Z. and operating support from the Centre for Antimicrobial Resistance (CAR), CHR/CLS/University of Calgary.

REFERENCES

  • 1.Ayliffe, G. A. 1997. The progressive intercontinental spread of methicillin-resistant Staphylococcus aureus. Clin. Infect. Dis. 24:S74-79. [DOI] [PubMed] [Google Scholar]
  • 2.Barber, M. 1961. Methicillin-resistant staphylococci. J. Clin. Pathol. 14:385-393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chung, M., G. Dickinson, H. De Lencastre, and A. Tomasz. 2004. International clones of methicillin-resistant Staphylococcus aureus in two hospitals in Miami, Florida. J. Clin. Microbiol. 42:542-547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Corkill, J. E., J. J. Anson, P. Griffiths, and C. A. Hart. 2004. Detection of elements of the staphylococcal cassette chromosome (SCC) in a methicillin-susceptible (mecA gene negative) homologue of a fucidin-resistant MRSA. J. Antimicrob. Chemother. 54:229-231. [DOI] [PubMed] [Google Scholar]
  • 5.Crossley, K., D. Loesch, B. Landesman, K. Mead, M. Chern, and R. Strate. 1979. An outbreak of infections caused by strains of Staphylococcus aureus resistant to methicillin and aminoglycosides. I. Clinical studies. J. Infect. Dis. 139:273-279. [DOI] [PubMed] [Google Scholar]
  • 6.Embil, J., K. Ramotar, L. Romance, M. Alfa, J. Conly, S. Cronk, G. Taylor, B. Sutherland, T. Louie, E. Henderson, and et al. 1994. Methicillin-resistant Staphylococcus aureus in tertiary care institutions on the Canadian prairies 1990-1992. Infect. Control Hosp. Epidemiol. 15:646-651. [DOI] [PubMed] [Google Scholar]
  • 7.Enright, M. C., D. A. Robinson, G. Randle, E. J. Feil, H. Grundmann, and B. G. Spratt. 2002. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc. Natl. Acad. Sci. USA 99:7687-7692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fluit, A. C., J. Verhoef, and F. J. Schmitz. 2001. Frequency of isolation and antimicrobial resistance of gram-negative and gram-positive bacteria from patients in intensive care units of 25 European university hospitals participating in the European arm of the SENTRY Antimicrobial Surveillance Program 1997-1998. Eur. J. Clin. Microbiol. Infect. Dis. 20:617-625. [DOI] [PubMed] [Google Scholar]
  • 9.Hussain, Z., L. Stoakes, V. Massey, D. Diagre, V. Fitzgerald, S. El Sayed, and R. Lannigan. 2000. Correlation of oxacillin MIC with mecA gene carriage in coagulase-negative staphylococci. J. Clin. Microbiol. 38:752-754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ito, T., Y. Katayama, K. Asada, N. Mori, K. Tsutsumimoto, C. Tiensasitorn, and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1323-1336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ito, T., Y. Katayama, and K. Hiramatsu. 1999. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob. Agents Chemother. 43:1449-1458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ito, T., X. X. Ma, F. Takeuchi, K. Okuma, H. Yuzawa, and K. Hiramatsu. 2004. Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrC. Antimicrob. Agents Chemother. 48:2637-2651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ito, T., K. Okuma, X. X. Ma, H. Yuzawa, and K. Hiramatsu. 2003. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resist. Update 6:41-52. [DOI] [PubMed] [Google Scholar]
  • 14.Jevons, M. P. 1961. “Celbenin”-resistant staphylococci. Br. Med. J. 1:124-125. [Google Scholar]
  • 15.Katayama, Y., F. Takeuchi, T. Ito, X. X. Ma, Y. Ui-Mizutani, I. Kobayashi, and K. Hiramatsu. 2003. Identification in methicillin-susceptible Staphylococcus hominis of an active primordial mobile genetic element for the staphylococcal cassette chromosome mec of methicillin-resistant Staphylococcus aureus. J. Bacteriol. 185:2711-2722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lindsay, J. A., and M. T. Holden. 2004. Staphylococcus aureus: superbug, super genome? Trends Microbiol. 12:378-385. [DOI] [PubMed] [Google Scholar]
  • 17.Livermore, D. M. 2000. Antibiotic resistance in staphylococci. Int. J. Antimicrob. Agents 16(Suppl. 1):S3-10. [DOI] [PubMed] [Google Scholar]
  • 18.Luong, T. T., S. Ouyang, K. Bush, and C. Y. Lee. 2002. Type 1 capsule genes of Staphylococcus aureus are carried in a staphylococcal cassette chromosome genetic element. J. Bacteriol. 184:3623-3629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ma, X. X., T. Ito, C. Tiensasitorn, M. Jamklang, P. Chongtrakool, S. Boyle-Vavra, R. S. Daum, and K. Hiramatsu. 2002. Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents Chemother. 46:1147-1152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mongkolrattanothai, K., S. Boyle, T. V. Murphy, and R. S. Daum. 2004. Novel non-mecA-containing staphylococcal chromosomal cassette composite island containing pbp4 and tagF genes in a commensal staphylococcal species: a possible reservoir for antibiotic resistance islands in Staphylococcus aureus. Antimicrob. Agents Chemother. 48:1823-1836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Murray, P. R. (ed.). 2003. Manual of clinical microbiology, 8th ed. American Society for Microbiology Press, Washington, D.C.
  • 22.O'Brien, F. G., T. T. Lim, F. N. Chong, G. W. Coombs, M. C. Enright, D. A. Robinson, A. Monk, B. Said-Salim, B. N. Kreiswirth, and W. B. Grubb. 2004. Diversity among community isolates of methicillin-resistant Staphylococcus aureus in Australia. J. Clin. Microbiol. 42:3185-3190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Okuma, K., K. Iwakawa, J. D. Turnidge, W. B. Grubb, J. M. Bell, F. G. O'Brien, G. W. Coombs, J. W. Pearman, F. C. Tenover, M. Kapi, C. Tiensasitorn, T. Ito, and K. Hiramatsu. 2002. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol. 40:4289-4294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Oliveira, D. C., and H. de Lencastre. 2002. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 46:2155-2161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Oliveira, D. C., A. Tomasz, and H. de Lencastre. 2001. The evolution of pandemic clones of methicillin-resistant Staphylococcus aureus: identification of two ancestral genetic backgrounds and the associated mec elements. Microb. Drug Resist. 7:349-361. [DOI] [PubMed] [Google Scholar]
  • 26.Panlilio, A. L., D. H. Culver, R. P. Gaynes, S. Banerjee, T. S. Henderson, J. S. Tolson, and W. J. Martone. 1992. Methicillin-resistant Staphylococcus aureus in U.S. hospitals, 1975-1991. Infect. Control Hosp. Epidemiol. 13:582-586. [DOI] [PubMed] [Google Scholar]
  • 27.Perez-Roth, E., F. Lorenzo-Diaz, N. Batista, A. Moreno, and S. Mendez-Alvarez. 2004. Tracking methicillin-resistant Staphylococcus aureus clones during a five-year period (1998 to 2002) in a Spanish hospital. J. Clin. Microbiol. 42:4649-4656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Robinson, D. A., and M. C. Enright. 2003. Evolutionary models of the emergence of methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47:3926-3934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Robinson, D. A., and M. C. Enright. 2004. Multilocus sequence typing and the evolution of methicillin-resistant Staphylococcus aureus. Clin. Microbiol. Infect. 10:92-97. [DOI] [PubMed] [Google Scholar]
  • 30.Simor, A. E., M. Ofner-Agostini, E. Bryce, A. McGeer, S. Paton, and M. R. Mulvey. 2002. Laboratory characterization of methicillin-resistant Staphylococcus aureus in Canadian hospitals: results of 5 years of National Surveillance, 1995-1999. J. Infect. Dis. 186:652-660. [DOI] [PubMed] [Google Scholar]
  • 31.Vandenesch, F., T. Naimi, M. C. Enright, G. Lina, G. R. Nimmo, H. Heffernan, N. Liassine, M. Bes, T. Greenland, M. E. Reverdy, and J. Etienne. 2003. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9:978-984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Voss, A., D. Milatovic, C. Wallrauch-Schwarz, V. T. Rosdahl, and I. Braveny. 1994. Methicillin-resistant Staphylococcus aureus in Europe. Eur. J. Clin. Microbiol. Infect. Dis. 13:50-55. [DOI] [PubMed] [Google Scholar]
  • 33.Zhang, K., J. Sparling, B. L. Chow, S. Elsayed, Z. Hussain, D. L. Church, D. B. Gregson, T. Louie, and J. M. Conly. 2004. New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J. Clin. Microbiol. 42:4947-4955. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES