Influence of TPH2 DNA methylation and family functioning, parenting styles on OCD severity

Abstract

Objective

The etiology of obsessive–compulsive disorder (OCD) is multifactorial and remains incompletely understood. While both the Tryptophan hydroxylase 2 (TPH2) gene and the family environment have been implicated in OCD, few studies have examined their combined effects. This study aimed to investigate the association between TPH2 DNA methylation and family functioning and parenting styles in patients with OCD.

Method

A total of 58 individuals with OCD and 89 age- and gender- matched healthy controls were recruited. DNA methylation levels at 12 CpG sites in the promoter region of TPH2 were quantified using the MassARRAY system. OCD symptom severity was assessed using the Yale-Brown Obsessive Compulsive Scale (Y-BOCS). Parenting styles and family functioning were evaluated using the Egna Minnen Barndoms Uppfostran (EMBU) and Family Assessment Device (FAD), respectively.

Results

(1) Methylation at CpG site 6 was significantly associated with OCD status in a binary logistic regression model and remained significant after Bonferroni correction. (2) In the OCD group, CpG sites 2 and 1/3/8 showed negative correlations with the ‘general functioning’ and ‘roles’ subscales of the FAD, respectively, while CpG site 7 was positively correlated with ‘affective involvement’. Methylation levels at CpG sites 2, 4, 5, 9 and 10 significantly differed based on the presence or absence of specific parenting styles in EMBU. (3) Regarding symptom severity, methylation at CpG sites 6, 9 and 12, as well as FAD dimensions (problem-solving, communication, affective responsiveness, general functioning), father's punishment, and mother's preference, were significantly associated with Y-BOCS scores.

Conclusion

DNA methylation at specific CpG sites in the TPH2 promoter region may play a critical role in the pathogenesis and symptom severity of OCD. Methylation patterns also correlated with family functioning and parenting styles. These findings suggest that TPH2 methylation may mediate the link between adverse family environments and OCD, possibly through reduced serotonin synthesis and impaired emotion regulation. Our results support a gene–environment interaction model contributing to OCD vulnerability.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12888-025-07217-0.

Introduction

Obsessive–compulsive disorder (OCD) is a neuropsychiatric disorder characterized by obsessive thoughts and compulsive behaviors, which significantly impair patients'quality of life and impose considerable financial and emotional burdens on families and society [24, 44]. The disability-adjusted life years (DALYs) attributed to OCD are more than those of multiple sclerosis and Parkinson's disease combined [18]. Although OCD has received increasing attention due to its substantial impact, its etiology remains incompletely understood. Both genetic and environmental factors are believed to contribute to the risk and progression of OCD [42, 55]. Among environment influences, parenting styles and family functioning have been identified as significant correlates. Families of children with OCD typically show elevated parental rejection and controlling behaviors, while greater parental warmth is significantly associated with lower symptom severity and functional impairment [36]. Aspects of family functioning such as affective responsiveness, communication, and problem-solving have also been linked to symptom severity in OCD [1, 22, 28, 52].

The view on gene-environment interactions (G × E) suggests that risk factors, whether genetic or environmental, play a probabilistic rather than a deterministic role in disease [2]. Recent systematic reviews synthesizing multiple evidence sources highlight that G × E is associated with OCD susceptibility, clinical manifestations, and treatment response [9, 59]. Epigenetic mechanisms, particularly dynamic and environmentally responsive modifications such as DNA methylation, serve as a molecular substrate for G × E interactions [5, 14, 26, 62]. DNA methylation, an essential epigenetic modification, typically suppresses gene expression when occurring within gene promoter regions [29, 53]. From an epigenetic perspective, the family environment can act as an influential factor in diseases pathogenesis. For instance, Craig F et al. [11] demonstrated that proximal familial risk factors were significantly associated with methylation patterns in the human serotonin transporter gene (solute carrier family 6 member 4, SLC6A4).

The SLC6A4 gene is a part of the serotonergic system, which plays a crucial role in the pathophysiology of OCD and constitutes the target of common pharmacological treatments, such as serotonin reuptake inhibitors (SRIs) and selective serotonin reuptake inhibitors (SSRIs) [51]. Serotonin levels and signaling are regulated by multiple factors, including the serotonin transporter and key biosynthetic enzymes like tryptophan hydroxylase (TPH) [43]. Tryptophan hydroxylase-2 (TPH2) is an isoform of TPH encoded by the TPH2 gene, which impacted serotonin biosynthesis predominantly and altered serotonergic neurotransmission [8, 20, 21, 57]. Several studies have implicated TPH2 in OCD. For example, Mössner et al. [40] reported that TPH2 regulation in the midbrain was critically involved in OCD pathogenesis. Moreover, a study exploring the genetic overlap between anorexia nervosa and OCD identified a single-nucleotide polymorphism (SNP) in TPH2 (rs11179027) as a potential marker for OCD [35]. Functional polymorphisms in TPH2 can modulate gene expression [21, 25, 63], and emerging evidence suggests that TPH2 expression is also epigenetically regulated in response to environmental inputs [8, 15, 41].

Against this background, the family environment—considered a pivotal environmental influence—may be associated with DNA methylation patterns in patients with OCD. Demonstrating such associations would provide valuable insights into the molecular underpinnings of OCD and inform novel therapeutic strategies. While previous research has explored the relationships among family environment, OCD, and DNA methylation independently, few studies have integrated all three factors. This study aims to address this gap by first examining TPH2 DNA methylation levels in patients with OCD and healthy controls, and then investigating the relationships among TPH2 methylation, family environment, and OCD symptom severity.

Methods

Participants

This study employed a cross-sectional design. Participants in the case group were recruited from the inpatient department of Shandong Mental Health Centre between September 2019 and January 2022. Inclusion criteria were as follows: (1) meeting the diagnostic criteria for OCD as outlined in the 10th Revision of the International Statistical Classification of Diseases and Related Health Problems (ICD-10); (2) aged between 18 and 60 years, regardless of gender; and (3) of Han Chinese ethnicity, with both biological parents also of Han Chinese descent. Exclusion criteria included: (1) major physical illnesses affecting the circulatory, urinary, hematological, or musculoskeletal systems; (2) current or past organic brain disorders or endocrine diseases; (3) co-occurring psychoactive substance abuse; (4) pregnancy or lactation; and (5) any history of other diagnosed psychiatric disorders. An age- and gender-matched control group was recruited from the local community. All participants provided informed consent voluntarily. The study was approved by the Ethics Committee of Shandong Mental Health Center (Approval Number: (2020) Ethics Review (R38)), in accordance with the Declaration of Helsinki’s ethical principles for medical research involving human subjects [60].

Assessments

Given the central role of the serotonin system and TPH2 in the etiology and treatment of OCD, both pharmacotherapy and psychotherapy are essential interventions, with the latter often targeting familial and interpersonal dynamics [37, 48]. To analyze potential psychosocial risk factors and inform psychotherapy strategies, this study utilized the Family Assessment Device (FAD) and the Egna Minnen Barndoms Uppfostran (EMBU). The FAD provides a multidimensional assessment of family functioning, enabling researchers and clinicians to evaluate various aspects of the familial environment [39]. The EMBU assesses perceived parenting styles based on individuals'retrospective accounts of their upbringing [47].

Sociodemographic data, including age and gender, were collected using a brief, self-designed questionnaire. OCD symptom severity was assessed using the Yale-Brown Obsessive Compulsive Scale (Y-BOCS) by a trained psychiatrist, with items 1–5 measuring obsessive symptoms and items 6–10 assessing compulsive behaviors [17]. The FAD evaluates seven dimensions of family functioning: problem-solving, communication, roles, affective responsiveness, affective involvement, behavior control, and general functioning, providing a comprehensive overview of family dynamics and adaptability [45]. Parenting attitudes and behaviors were evaluated quantitatively using the EMBU, which identifies four core factors through factor analysis: rejection, emotional warmth, overprotection, and favoring subject [4, 47]. The father's version of the EMBU includes six dimensions: emotional warmth, punishment, excessive interference, preference for subjects, rejection, and overprotection, while the mother's version includes five, excluding overprotection. A total of 26 patients with OCD independently completed both the FAD and EMBU scales.

DNA extraction

Peripheral venous blood samples were collected from all participants after a minimum eight-hour fast, at 7:00 am, using EDTA anticoagulation tubes. Samples were then centrifuged at 3000 rpm for 10 min, and the middle layer of leukocytes was extracted and stored in EP tubes at −80 °C until DNA extraction. Genomic DNA was extracted using a medium-volume whole-blood DNA extraction kit (BioTeKe Corporation). Primers were synthesized by Thermo Fisher, while methylation detection reagents were supplied by Zymo (Methylated DNA Nitrite Kit) and Agena (EpiTYPER™ Reagent Kit).

Determination of DNA methylation level

DNA methylation levels were quantified using the Agena MassArray DNA flight mass spectrometry system and polymerase chain reaction (PCR) performed by Beijing Liuhe Huada Gene Technology Co. The screening of CpG sites within the promoter region of TPH2 was performed by the online prediction website (http://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot). A total of 13 CpG sites were identified. Among these, CpG sites 1, 3, and 8 shared identical molecular weights and peak profiles post-digestion and were therefore combined and analyzed as CpG sites 1/3/8 [13]. CpG site 13 was excluded due to sequencing issues (see Table S3).

Methylation involves the enzymatic conversion of cytosine to 5-methylcytosine at CpG dinucleotides, catalysed by DNA methyltransferases (DNMT) [32]. The MassARRAY system utilizes sodium bisulfite treatment under alkaline conditions, which converts unmethylated cytosines to uracil (U) while leaving methylated cytosines unchanged. The targeted region ranged from −5000 bp to + 1000 bp relative to the transcription start site of TPH2. Primers were designed using Agena's EpiDesigner software. The primer sequence at 5'end: aggaagagag TGTTAGTGGTAGGTTTGAGAGATGA, and the primer sequence at 3'end: cagtaatacgactcactatagggagaaggctACTAAATCCAAAAAAAACCCTCTCC. The PCR protocol and experimental materials are detailed in Supplementary Tables S1 and S2, with the amplification process shown in Supplementary Figure S1. DNA methylation percentages were quantified using EpiTYPER™ software, which calculates methylation levels by comparing the relative areas of G- and A-containing peaks. For example, a methylation value of 0.65 indicates that 65% of cytosines at the specific CpG site are methylated.

Statistical analysis

Methylation data were treated as continuous variables, representing the percentage methylation at each CpG site. For missing data, mean imputation was applied within each group, except in cases where over 40% of values were missing, in which case the sample was excluded. CpG sites 1/3/8 were averaged as a single composite site as previously noted.

Statistical analyses were performed using SPSS version 27.0. The Shapiro–Wilk test was used to assess normality. Chi-square tests were used for categorical comparisons. Independent samples t-tests or Mann–Whitney U tests were used for comparing group means, depending on data distribution. Binary logistic regression was conducted to assess associations between methylation levels and OCD case–control status, with methylation as a continuous predictor and no interaction terms included. Correlations were analyzed using Spearman's rank or Pearson's correlation as appropriate. The significance level was set at P < 0.05.

Results

General information of participants

A total of 58 patients diagnosed with OCD (34 males and 24 females; mean age ± SD: 30.40 ± 13.87 years) were included in this study. The control group consisted of 89 healthy individuals (48 males and 41 females; mean age ± SD: 25.79 ± 8.65 years). There were no statistically significant differences between the two groups in terms of age or gender distribution (see Table 1).

Table 1.

Sample sizes and demographics in case and control groups

	Patients (n = 58)	Controls (n = 89)	Z/χ2	P value
Age	30.40 ± 13.87	25.79 ± 8.65	−1.277	0.202
Gender (Male/Female)	34/24	48/41	2.000	0.157

Z/χ², Standard Normal Deviate/Chi-square Statistic

Comparison of DNA methylation levels between patients and controls

The DNA methylation levels at various CpG sites within the promoter region of the TPH2 gene were compared between patients and controls. As shown in Table 2, methylation levels at CpG site 6 were significantly higher in the case group and positively associated with OCD status (B = 7.565, 95% CI [43.833, 84853.465], P < 0.001). This association remained statistically significant after applying the Bonferroni correction for multiple comparisons (P < 0.005 corrected for 10 tests), and when age and sex were included as covariates (B = 7.547, 95% CI [35.244, 101816.683], P < 0.001). These findings suggest that elevated DNA methylation at CpG site 6 in the TPH2 promoter is positively associated with OCD case–control status, independent of age and sex.

Table 2.

Comparison of DNA methylation levels between groups

	Patients				Controls
CpG sites	Max	Min	M	SD	Max	Min	M	SD	B	SE	z value	P	OR	OR(95%CI)
CpG_1/3/8	0.38	0.00	0.21	0.09	0.55	0.00	0.21	0.09	−0.495	2.245	0.049	0.825	0.610	0.007 ~ 49.624
CpG_2	0.64	0.28	0.45	0.09	0.64	0.00	0.47	0.10	−2.249	2.036	1.220	0.269	0.106	0.002 ~ 5.704
CpG_4	1.00	0.07	0.76	0.25	1.00	0.22	0.81	0.21	−0.753	0.845	0.794	0.373	0.471	0.090 ~ 2.468
CpG_5	0.42	0.00	0.09	0.07	0.25	0.00	0.11	0.06	−2.876	2.949	0.951	0.329	0.056	0.000 ~ 18.235
CpG_6	0.47	0.00	0.22	0.13	0.35	0.00	0.14	0.08	7.565	1.931	15.351	< 0.001**	1928.580	43.833 ~ 84,853.465
CpG_7	0.31	0.00	0.08	0.06	0.47	0.00	0.08	0.08	−2.868	2.845	1.017	0.313	0.057	0.000 ~ 14.987
CpG_9	0.21	0.00	0.05	0.05	0.18	0.00	0.05	0.04	−1.297	4.773	0.074	0.786	0.273	0.000 ~ 3161.378
CpG_10	0.20	0.00	0.08	0.04	0.37	0.00	0.08	0.05	−2.694	4.045	0.444	0.505	0.068	0.000 ~ 187.491
CpG_11	0.33	0.00	0.07	0.07	0.89	0.00	0.07	0.11	−0.216	1.948	0.012	0.912	0.806	0.018 ~ 36.662
CpG_12	0.92	0.00	0.10	0.15	0.56	0.00	0.09	0.11	0.485	1.465	0.110	0.740	1.625	0.092 ~ 28.678

CpG Cytosine-phosphate-Guanine, Max maximum, Min minimum, M mean, SD standard deviation, B regression coefficient, SE Standard Error, z value, Wald Z-Score, OR Odds Ratio, OR (95% CI), Odds Ratio with 95% Confidence Interval

P, P-value; *P < 0.05, **P < 0.01

Associations between epigenetic and environmental factors in OCD patients

A total of 26 OCD patients completed both the FAD and EMBU scales. FAD scores were treated as continuous variables across its subscales, while EMBU factors were dichotomized: a score above the cutoff indicated the presence of a particular parenting style (coded as'1'), and scores below the cutoff indicated its absence (coded as'0') [61]. Correlational analyses were conducted to examine the relationships between TPH2 CpG site methylation levels and family functioning or parenting styles. Spearman’s rank or Pearson’s correlation tests were applied as appropriate. Group differences in methylation based on EMBU factors were assessed using t-tests or Mann–Whitney U tests.

The results showed significant negative correlations between CpG site 2 methylation and the general functioning subscale of FAD (r = −0.629, P < 0.001), and between CpG site 1/3/8 methylation and the roles subscale (r_ρ = −0.401, P = 0.042). A positive correlation was observed between CpG site 7 and the affective involvement subscale (r_ρ = 0.495, P = 0.010).

Regarding the association between methylation levels and EMBU, we found that CpG site 2 methylation significantly differed depending on the presence of paternal emotional warmth (t = −3.815, P < 0.001), punishment (t = 3.034, P = 0.006) and rejection (t = 2.276, P = 0.032). CpG sites 5 (Z = −2.268, P = 0.023) and 9 (Z = −2.151, P = 0.031) were also significantly associated with father’s overprotection. For maternal factors, significant differences were found between CpG site 5 and mother's excessive interference (t = −2.430, P = 0.023), CpG site 10 and mother's rejection (Z = −2.241, P = 0.025), and CpG site 4 and mother's preference (Z = −2.189, P = 0.029). No other significant associations between family environmental variables and TPH2 methylation were identified. Detailed results are presented in Table 3.

Table 3.

Relationship between family environment and DNA methylation levels in patients

		CpG_1/3/8	CpG_2	CpG_4	CpG_5	CpG_7	CpG_9	CpG_10
Roles	rρ/r	−0.401a	−0.213a	0.114a	0.169a	0.384a	0.269a	0.079a
	P	0.042*	0.296	0.579	0.409	0.053	0.184	0.702
General functioning	rρ/r	0.088b	−0.629b	−0.085a	0.020b	0.192a	0.323a	0.273a
	P	0.669	< 0.001**	0.679	0.922	0.347	0.108	0.177
Affective involvement	rρ/r	0.024b	−0.200b	−0.248a	−0.011b	0.495a	0.176a	−0.220a
	P	0.908	0.328	0.222	0.956	0.010*	0.391	0.280
Father's emotional warmth	t/Z	−0.297c	−3.815c	−1.324d	−0.702c	−0.279d	−0.838d	−0.423c
	P	0.769	< 0.001**	0.185	0.489	0.780	0.402	0.676
Father's punishment	t/Z	−0.570c	3.034c	−1.198d	−1.054c	−1.298c	−0.184d	−0.673d
	P	0.574	0.006**	0.231	0.302	0.207	0.854	0.501
Father's rejection	t/Z	0.569c	2.276c	−0.237d	−0.169c	−0.531d	−0.196d	−1.091c
	P	0.574	0.032*	0.813	0.867	0.595	0.845	0.286
Father's overprotection	t/Z	−1.537d	−0.418c	−1.165d	−2.268d	−0.046c	−2.151d	0.744c
	P	0.124	0.680	0.244	0.023*	0.964	0.031*	0.464
Mother's excessive interference	t/Z	0.605c	0.327c	−0.059d	−2.430c	0.000d	−1.175c	−1.164d
	P	0.551	0.747	0.953	0.023*	1.000	0.268	0.244
Mother's rejection	t/Z	0.861c	1.715c	−0.249d	−1.393d	0.615c	−0.071c	−2.241d
	P	0.398	0.099	0.803	0.164	0.545	0.944	0.025*
Mother's preference	t/Z	0.516c	−0.656c	−2.189d	−0.468c	0.823c	−1.084c	−0.108d
	P	0.610	0.518	0.029*	0.644	0.418	0.289	0.914

CpG Cytosine-phosphate-Guanine

^aSpearman's rank correlation

^bPearson’s correlation

^ct-tests

^dMann-Whitney U tests

P, P-value; *P < 0.05, **P < 0.01

Association between epigenetic/family environmental factors and OCD symptom severity

The severity of OCD symptoms was assessed using the Y-BOCS, and statistical analyses were conducted to evaluate relationships with epigenetic and environmental factors. As indicated in Table 4, methylation at CpG site 6 was positively correlated with scores on the obsession (r_ρ = 0.757, P < 0.001), compulsion (r_ρ = 0.337, P = 0.010), and total Y-BOCS (r = 0.676, P < 0.001) scales. Additionally, total Y-BOCS scores were positively associated with methylation at CpG site 12 (r_ρ = 0.278, P = 0.035), and obsession scores were positively correlated with methylation at CpG sites 12 (r_ρ = 0.324, P = 0.013) and 9 (r_ρ = 0.272, P = 0.039).

Table 4.

Association of Family environment and DNA methylation levels with symptom severity

		Obsessive thoughts	Compulsive behaviors	Y-BOCS total scores
CpG_6	rρ/r	0.757a	0.337a	0.676b
	P	< 0.001**	0.010*	< 0.001**
CpG_9	rρ/r	0.272a	0.027a	0.214a
	P	0.039*	0.838	0.106
CpG_12	rρ/r	0.324a	0.142a	0.278a
	P	0.013*	0.289	0.035*
Problem-Solving	rρ/r	0.447a	−0.009b	0.413a
	P	0.022*	0.964	0.036*
Communication	rρ/r	0.442a	0.034b	0.417a
	P	0.024*	0.868	0.034*
Affective Responsiveness	rρ/r	0.603a	0.064b	0.601a
	P	0.001**	0.755	0.001**
General Functioning	rρ/r	0.483a	0.147b	0.571a
	P	0.012*	0.472	0.002**
Father’s punishment	t/Z	0.578c	−3.269c	−1.135d
	P	0.569	0.003**	0.256
Mother’s preference	t/Z	2.738c	0.566c	2.182c
	P	0.011*	0.577	0.039*

^aSpearman's rank correlation

^bPearson’s correlation

^ct-tests

^dMann-Whitney U tests

P, P-value; *P < 0.05, **P < 0.01

Regarding family functioning, significant positive correlations were observed between specific FAD subscales and the severity of obsession and total Y-BOCS scores, respectively: problem-solving (r_ρ = 0.447, P = 0.022; r_ρ = 0.413, P = 0.036), communication (r_ρ = 0.442, P = 0.024; r_ρ = 0.417, P = 0.034), affective responsiveness (r_ρ = 0.603, P = 0.001; r_ρ = 0.601, P = 0.001), and general functioning (r_ρ = 0.483, P = 0.012; r_ρ = 0.571, P = 0.002).

In terms of parenting styles, compulsion severity differed significantly based on the presence of father's punishment (t = −3.269, P = 0.003). Both obsession and total Y-BOCS scores were higher among those who reported mother's preference (t = 2.738, P = 0.011; t = 2.182, P = 0.039). No other significant associations were observed between Y-BOCS scores and family environmental or epigenetic factors.

Discussion

This study explored the associations among DNA methylation of TPH2, family psychological characteristics (including parenting styles and family functioning), and the clinical features of OCD. Our findings revealed that methylation at CpG site 6 within the promoter region of TPH2 was significantly associated with OCD status, and this association remained robust after correction for multiple corrections. Furthermore, methylation at various CpG sites (1/3/8, 2, 4, 5, 7, 9, and 10) was significantly correlated with dimensions of family functioning and parenting styles. Additionally, CpG sites 6, 9, and 12, as well as FAD subscales (problem-solving, communication, affective responsiveness, and general functioning), were associated with OCD symptom severity. Regarding the EMBU, symptom differences were observed in relation to mother's preference and father's punishment.

Epigenetic modification of TPH2 and serotonin dysfunction in OCD

The most robust finding of this study was that elevated DNA methylation at CpG site 6 was significantly associated with both OCD case–control status and symptom severity, suggesting that this epigenetic modification may serve as a risk marker for the disorder. Although other CpG sites did not differ significantly between groups, sites 9 and 12 showed positive correlations with obsession and total symptom scores, supporting a potential broader role for TPH2 methylation in OCD pathophysiology.

While TPH2 mRNA and protein expression were not measured in this study, prior research has linked increased methylation of Tph2 with decreased gene expression in animal models of depression [10]. Given that DNA methylation typically suppresses gene transcription, hypermethylation at TPH2 promoter sites may reduce serotonin synthesis by downregulating enzyme production [30, 34, 43], aligning with the serotonin deficiency hypothesis in OCD [3, 51]. This interpretation is consistent with the therapeutic efficacy of SSRIs, which remain first-line pharmacologic interventions for OCD [24].

Although this study relied on peripheral blood samples, no research to date has confirmed the blood–brain methylation correlation for TPH2. Nevertheless, studies involving other psychiatric biomarkers—such as methylation of FKBP5 (encodes for the Hsp90-associated co-chaperone FK506 binding protein 51), BDNF (brain-derived neurotrophic factor), and PAC₁ (pituitary adenylyl cyclase-activating polypeptide receptor) demonstrated that peripheral methylation patterns can reflect brain-related functional and structural differences [19, 27, 31].

Association between TPH2 methylation and family environment

This study also demonstrated significant associations between TPH2 methylation and family functioning (FAD) as well as parenting styles (EMBU). Specifically, methylation at CpG sites 1/3/8 and 2 was negatively correlated with the “Roles” and “General Functioning” subscales, respectively, while site 7 was positively correlated with “Affective Involvement.” While these findings may seem contradictory, they may reflect the complex gene regulation dynamics of TPH2, which lacks CpG islands but contains scattered CpG sites with diverse regulatory roles [8]. The site-specific nature of methylation response may also reflect interactions with regulatory polymorphisms or environmental exposures [49, 54].

Moreover, significant differences in methylation were found based on the presence or absence of specific parenting styles, including fathers'emotional warmth, punishment, rejection, and overprotection, as well as mothers'excessive interference, rejection, and favoritism. These findings underscore the potential role of early-life family environment in shaping epigenetic alterations in genes implicated in emotional regulation and psychiatric vulnerability. However, due to the limited sample size, detailed analyses of continuous EMBU scores and their relationship with symptom severity were not feasible. Thus, while our findings highlight family dynamics as important in the epigenetic landscape of OCD, further investigation with larger samples is warranted.

Psychological and biological mechanisms underlying findings

Our results suggest potential mechanisms linking family functioning, epigenetic regulation of TPH2, and OCD symptomatology. Previous studies have shown that OCD patients report poorer family functioning across several FAD dimensions except for affective involvement compared to controls [58]. In our study, although FAD scores for controls were unavailable, correlations between poorer family functioning (problem-solving, communication, affective responsiveness, and general functioning) and greater OCD severity were evident.

The serotonergic system, in which TPH2 plays a central role, is integral to cognitive and emotional processes such as emotion regulation (ER) [38]. ER difficulties have been strongly implicated in OCD severity and maintenance [7]. Furthermore, ER may mediate the link between attachment insecurity and poor family functioning [6], and attachment insecurity has been hypothesized to contribute to OCD symptoms [12]. We therefore speculate that dysfunctional family environments may influence TPH2 methylation, alter serotonin activity, disrupt ER, and increase attachment insecurity, ultimately exacerbating OCD symptoms.

With regard to parenting styles, prior research [28, 36] has shown that individuals with OCD report lower parental emotional warmth and higher rejection, punishment, and overprotection. In our study, CpG site 9 methylation varied with paternal overprotection and was positively correlated with obsession scores. Paternal punishment and maternal preference also showed significant associations with compulsion and overall OCD severity, respectively.

While limited studies have explored TPH2 methylation in relation to EMBU factors, emerging research on SLC6A4—another gene in the serotonin pathway—provides relevant insights. For instance, SLC6A4 methylation has been linked to paternal rejection and overprotection in individuals with anorexia nervosa [23], and its short allele has been associated with attachment insecurity [46]. Given the genetic overlap between OCD and anorexia nervosa [33], and shared serotonergic mechanisms involving TPH2 and SLC6A4 [16, 35, 56], our findings support the hypothesis that parenting styles may contribute to OCD pathogenesis through epigenetic modulation of serotonin-related genes.

This study provides a foundation for future research exploring how environmental and biological factors interact to influence OCD. These insights may inform targeted prevention strategies and therapeutic interventions, such as family-based cognitive behavioral therapy (CBT), which has demonstrated superiority over standard treatment modalities [50]. However, several limitations must be acknowledged. First, the relatively small sample size limits statistical power and generalizability. Second, the use of retrospective self-report scales may introduce recall bias. Third, the inclusion of only hospitalized OCD patients may limit the applicability of findings to broader clinical populations. Lastly, the cross-sectional design precludes causal inference. Future longitudinal, multi-omics studies with larger and more diverse samples are needed to validate these findings and elucidate the role of gene-environment interactions in OCD.

Conclusion

In conclusion, this study is the first to investigate the association between TPH2 DNA methylation and OCD status, symptom severity, and family environment. The findings suggest that epigenetic modification of TPH2—particularly at CpG site 6—may contribute to the pathogenesis of OCD. Furthermore, family functioning and parenting styles were significantly associated with TPH2 methylation patterns and symptom expression. These results highlight the interaction between biological and environmental factors in OCD and underscore the importance of integrative approaches that consider both epigenetic and psychosocial influences in future research and clinical practice.

Abbreviations

OCD

Obsessive-compulsive disorder

TPH2

Tryptophan hydroxylase 2

FKBP51

FK506 binding protein 51

BDNF

Brain-derived neurotrophic factor

PAC₁

Pituitary adenylyl cyclase-activating polypeptide receptor

Y-BOCS

Yale-Brown Obsessive Compulsive Scale

EMBU

Egna Minnen Barndoms Uppfostran

FAD

Family Assessment Device

DALYs

Disability-adjusted life years

G × E

Gene-environment interactions

SLC6A4

Solute carrier family 6 member 4

SRIs

Serotonin reuptake inhibitors

SSRIs

Elective serotonin reuptake inhibitors

TPH

Tryptophan hydroxylase

SNP

Single-nucleotide polymorphism

ICD-10

International Statistical Classification of Diseases and Related Health Problems

EDTA

Ethylenediaminetetraacetic Acid

EP

Eppendorf

DNA

Deoxyribonucleic Acid

CpG

Cytosine-phosphate-Guanine

PCR

Polymerase chain reaction

DNMT

DNA methyltransferases

U

Uracil

SPSS

Statistical Package for the Social Sciences

ER

Emotion regulation

CBT

Cognitive behavioral therapy

Authors’ contributions

Dongdong Qiao and Lina Wang designed the study; Lina Wang and Zhenhua Liu were responsible for the clinical diagnosis; Yu Chen and Shiqi Hu conducted sample collection, performed the experiments and analyzed the data; Lina Wang, Yu Chen and Zhenhua Liu were responsible for manuscript writing; Tiangui Yu and Dongdong Qiao supervised the study. All authors have read and approved the final manuscript.

Funding

This study was funded by Shandong Province Key R&D Program Project (2016GSF201200) and Shandong Province Key R&D Program (Science and Technology Demonstration Project) Project (2021SFGC0504). The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data or in writing the manuscript.

Data availability

Researchers interested in this study may contact corresponding author to obtain relevant data via email: qiaovincent@163.com.

Declarations

Ethics approval and consent to participate

This study was conducted in accordance with the Declaration of Helsinki. And the study was approved by the Ethics Committee of Shandong Mental Health Center (Approval Number: (2020) Ethics Review (R38)). An informed consent was signed by each participant before participating in this study. We confirmed that all methods were performed in accordance with the relevant guidelines and regulations.

Consent for publications

Not applicable.

Competing interests

The authors declare no competing interests.